ID: 1144901695

View in Genome Browser
Species Human (GRCh38)
Location 17:18599453-18599475
Sequence CAAGTGGCCCACATTGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144901695_1144901699 29 Left 1144901695 17:18599453-18599475 CCAATATCAATGTGGGCCACTTG No data
Right 1144901699 17:18599505-18599527 CTCGCTCCAATCCACAAGCCTGG No data
1144901695_1144901700 30 Left 1144901695 17:18599453-18599475 CCAATATCAATGTGGGCCACTTG No data
Right 1144901700 17:18599506-18599528 TCGCTCCAATCCACAAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144901695 Original CRISPR CAAGTGGCCCACATTGATAT TGG (reversed) Intergenic
No off target data available for this crispr