ID: 1144901699

View in Genome Browser
Species Human (GRCh38)
Location 17:18599505-18599527
Sequence CTCGCTCCAATCCACAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144901698_1144901699 -8 Left 1144901698 17:18599490-18599512 CCAATTAAACACAAACTCGCTCC No data
Right 1144901699 17:18599505-18599527 CTCGCTCCAATCCACAAGCCTGG No data
1144901697_1144901699 13 Left 1144901697 17:18599469-18599491 CCACTTGCTTCGGAAAGACAGCC No data
Right 1144901699 17:18599505-18599527 CTCGCTCCAATCCACAAGCCTGG No data
1144901695_1144901699 29 Left 1144901695 17:18599453-18599475 CCAATATCAATGTGGGCCACTTG No data
Right 1144901699 17:18599505-18599527 CTCGCTCCAATCCACAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144901699 Original CRISPR CTCGCTCCAATCCACAAGCC TGG Intergenic
No off target data available for this crispr