ID: 1144905382

View in Genome Browser
Species Human (GRCh38)
Location 17:18636945-18636967
Sequence GATGAAGGAGCCGCTCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 2, 1: 0, 2: 1, 3: 14, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144905382_1144905393 21 Left 1144905382 17:18636945-18636967 CCTCCCAGAGCGGCTCCTTCATC 0: 2
1: 0
2: 1
3: 14
4: 166
Right 1144905393 17:18636989-18637011 CCTTTGCAGGCAACGTCTCCCGG 0: 1
1: 1
2: 0
3: 7
4: 98
1144905382_1144905388 8 Left 1144905382 17:18636945-18636967 CCTCCCAGAGCGGCTCCTTCATC 0: 2
1: 0
2: 1
3: 14
4: 166
Right 1144905388 17:18636976-18636998 CCCTAGCATGTCCCCTTTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144905382 Original CRISPR GATGAAGGAGCCGCTCTGGG AGG (reversed) Intronic
901581314 1:10246192-10246214 AAAGGAGGAGCCACTCTGGGTGG - Intronic
903280416 1:22247037-22247059 GATGAAGGAGCCCCTCACTGTGG + Intergenic
903471148 1:23588232-23588254 GAAGAAGGGGCTGCTCTGGAGGG + Intronic
903888583 1:26555357-26555379 GATGAAAGAGGGGCTCTGGAAGG - Intronic
910330234 1:86065079-86065101 GATGAGGCAGCAGCTCTAGGAGG + Intronic
913257278 1:116964904-116964926 GAGCAAGGAGACGATCTGGGAGG - Intronic
918113528 1:181478652-181478674 GATGAAGGAGCAGGCCTGGTGGG + Intronic
922764023 1:228148435-228148457 GCTGAAGGAGGCGCTCTCTGAGG + Intronic
924112171 1:240711120-240711142 CATGATGGAGGCGCTCAGGGTGG - Intergenic
924587659 1:245374289-245374311 GAGGAAGGTGAGGCTCTGGGAGG + Intronic
924708238 1:246515100-246515122 GATGAAGGAATCGCTCCAGGAGG - Intergenic
1062857780 10:788040-788062 GATGTGGGAGCCGCCCTGGGAGG + Intergenic
1066221111 10:33336500-33336522 GAGGAAAGAGGCGCTCGGGGGGG - Intergenic
1072682060 10:97514719-97514741 GATGAAGGAGTTGGTCTGGGAGG + Intronic
1073204179 10:101759988-101760010 GAGTCAGGAGCCTCTCTGGGAGG + Intergenic
1074057778 10:109938349-109938371 GAAGAAAGAGCTGCCCTGGGTGG + Intergenic
1075923432 10:126232172-126232194 GATGAAGGGGATGATCTGGGTGG + Intronic
1076122061 10:127944282-127944304 GATGGATGAGCACCTCTGGGAGG + Intronic
1076829380 10:132986337-132986359 GAGGAAGGGGCGGCTCTGGGTGG + Intergenic
1077182290 11:1222234-1222256 GAGGAAGCAGCTGCTCCGGGGGG - Intergenic
1080641358 11:34160339-34160361 GATGACGGAGTCGTTCTGTGGGG + Exonic
1084091557 11:66882351-66882373 GCTGCAGGAGACGCTCTGTGAGG - Intronic
1084410896 11:69005385-69005407 GCTGTGGGAGCCGCTCAGGGTGG - Exonic
1088861397 11:113803202-113803224 GATGAAGGGGCCCCGCCGGGGGG - Exonic
1089896654 11:121936790-121936812 CAGCAAGGTGCCGCTCTGGGAGG + Intergenic
1090187934 11:124750507-124750529 GATGGAGGAGATGCTCTCGGTGG + Intronic
1091334778 11:134758209-134758231 GAGGAAGGAGAGGCTCTGGAAGG - Intergenic
1097229192 12:57498812-57498834 GCTGAAGGAGCAGCTGAGGGAGG + Intronic
1099888960 12:88566114-88566136 GATAAATGAGCCACTTTGGGTGG - Intronic
1101811670 12:108112968-108112990 TATGAAGCTGCCGCACTGGGCGG + Intergenic
1102168368 12:110823807-110823829 GTTGAAGGAGCAGCTATGGTGGG - Intergenic
1102237561 12:111303868-111303890 GATGAGAGAGGCTCTCTGGGTGG - Intronic
1113814351 13:113161254-113161276 GCTGGAGGAGCTGCTCTGGGGGG - Intronic
1113881995 13:113632164-113632186 GTGGAAGGAGCAGCTCTGGCGGG - Intronic
1114042018 14:18687825-18687847 GACGGAGGAGCCGTTCTGGATGG + Intergenic
1114548119 14:23517191-23517213 TATGAAGGAGCGTCACTGGGTGG + Intergenic
1114626172 14:24131635-24131657 GCTCAAGGTGCTGCTCTGGGTGG + Exonic
1123895907 15:24829558-24829580 GATGCAGGGGCCGCTCTCTGAGG + Intronic
1132780838 16:1624330-1624352 GATGAAGAAGCAGATCTGGATGG + Intronic
1136394023 16:29983157-29983179 GTTGACGGAGCTGCTCTGGCTGG - Exonic
1136618189 16:31411068-31411090 GAAGTAGGAGCCGATCTGGAGGG - Exonic
1137567079 16:49539981-49540003 GATGCAGGAGCCGCTCTAAGAGG + Intronic
1137708230 16:50549333-50549355 GAAGAAGGAGGCGCGGTGGGAGG - Intronic
1138461968 16:57154455-57154477 GATGGAGGGGCCACTCAGGGAGG + Exonic
1141578333 16:84980259-84980281 GAAGAAGGTGACGCTATGGGCGG - Intronic
1142501225 17:334529-334551 GGAGAAGGAGCTGCACTGGGTGG - Intronic
1142501255 17:334624-334646 GGAGAAGGAGCTGCACTGGGTGG - Intronic
1143204955 17:5134882-5134904 GATGATGGAGTCGCTCCAGGAGG + Intronic
1143373435 17:6454330-6454352 CTTAAAGGAGCCTCTCTGGGTGG - Exonic
1144007602 17:11115187-11115209 GCTGAATGGGCCGCTCTTGGAGG + Intergenic
1144494873 17:15739727-15739749 GATGAAGGAGCCGCTCTGGGAGG + Intronic
1144905382 17:18636945-18636967 GATGAAGGAGCCGCTCTGGGAGG - Intronic
1145760635 17:27423556-27423578 GATGAAGGAGTCGCTCCAGAAGG + Intergenic
1145784661 17:27586162-27586184 GATGCAGAAGCCCCTTTGGGAGG + Intronic
1145798401 17:27668739-27668761 GATGAAGGAGTCACTCCAGGAGG - Intergenic
1146160687 17:30557872-30557894 GATGAAGGAGTCGCTCCAGGAGG + Exonic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1146929664 17:36768352-36768374 GTGGAATGAGCCGCTGTGGGAGG + Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147559470 17:41500048-41500070 AAGGAAGGAGCAGATCTGGGAGG + Intergenic
1147907201 17:43831181-43831203 GATGAAGGAGCCCTACAGGGTGG + Intronic
1148461183 17:47839908-47839930 GTGGATGGAGCAGCTCTGGGTGG - Intronic
1148752528 17:49953544-49953566 GATGTAGGTGCAGCTCTGCGTGG - Intergenic
1149311531 17:55399011-55399033 GAGGAGGAAGCCGCTCAGGGAGG - Intronic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150285498 17:63951621-63951643 GAAGAAGGAGCCGCCCGAGGAGG - Exonic
1152283883 17:79401393-79401415 CATGAAGGAGTCGTTTTGGGGGG - Intronic
1152720439 17:81921030-81921052 GATGAGGGAGTCACTGTGGGTGG - Exonic
1154300348 18:13186314-13186336 GCTGAAGGAGCCCCTCTGGGAGG + Intergenic
1160543523 18:79638315-79638337 GCAGAAGGAGCCGCTCCCGGGGG + Intergenic
1160837314 19:1131045-1131067 GAGGACGGAGCCACTGTGGGGGG - Intronic
1163510616 19:17733093-17733115 GAGGAGGGAGCTGCTCTGAGTGG + Intronic
1164645541 19:29856527-29856549 GATGAAGGGGCGGCTCAGGGAGG + Intergenic
1165695106 19:37894971-37894993 GATGGAGGAGCCGCTGCTGGTGG + Exonic
1167610734 19:50506680-50506702 GATTAAGGAACACCTCTGGGTGG - Intronic
1167660671 19:50794331-50794353 GAGGAAGGAGTAGCTTTGGGGGG + Intronic
1167982924 19:53290970-53290992 GTTGGAGGAGACGCCCTGGGGGG - Exonic
925126545 2:1461244-1461266 GAGGAAGGAGCCTCTGGGGGCGG - Intronic
925231078 2:2234611-2234633 GGTGAAGTAGGCCCTCTGGGAGG - Intronic
926052518 2:9753946-9753968 GATGAGGGAGCCGGGCTGGAGGG + Intergenic
926592150 2:14751299-14751321 GCTGAAGAAGCCACTGTGGGGGG - Intergenic
930708146 2:54524534-54524556 GATGGCGGTGCAGCTCTGGGTGG - Intronic
931522932 2:63119136-63119158 GATGTTGCAGTCGCTCTGGGTGG + Intergenic
932231608 2:70088060-70088082 AATCAGGGAGCCGCACTGGGTGG - Exonic
932284251 2:70519080-70519102 GATGAAGAACACGCTCAGGGCGG + Intronic
933766149 2:85711037-85711059 GCTGCAGGAGACGCCCTGGGAGG + Intergenic
938268199 2:129944707-129944729 GACGGAGGAGCCGTTCTGGATGG - Intergenic
946843192 2:223837609-223837631 GAGGAGGCAGCCGCGCTGGGAGG - Intronic
948436672 2:237958431-237958453 GATGCTGGAGCCGCTCTTGCAGG - Intergenic
948737259 2:240017083-240017105 GGGGAAGGAGCCTATCTGGGAGG - Intronic
948916906 2:241039109-241039131 GATCAGGGAGCCCCTGTGGGGGG - Intronic
1169315009 20:4583140-4583162 GATGAAGGAGCTGAGCTGGGTGG + Intergenic
1172654305 20:36527659-36527681 GATGGAGGCGCCTCACTGGGAGG + Exonic
1174353564 20:49984054-49984076 GACGAAGGAGCCGGTGAGGGTGG - Exonic
1175492666 20:59389715-59389737 GGGCAAGCAGCCGCTCTGGGAGG + Intergenic
1175919378 20:62443089-62443111 GATCAATGAGCTGCTCTGGTTGG + Intergenic
1180143151 21:45905223-45905245 GTTGGAGGAGGTGCTCTGGGGGG - Intronic
1180665859 22:17511450-17511472 GCTGAAGGGGCGGCTCTGGGAGG - Intronic
1180905020 22:19404290-19404312 GGTAAAGGAGCCCCACTGGGCGG + Intronic
1181405302 22:22680302-22680324 GATGCATGGGCAGCTCTGGGGGG - Intergenic
1183289412 22:36990421-36990443 GTTGATGGAGCAGCTCTGCGAGG + Intergenic
1183386397 22:37517975-37517997 GATCATGGAGCAGCGCTGGGCGG + Exonic
1184655103 22:45937122-45937144 GATGGAGGAGCCGCACTGGATGG - Intronic
949402980 3:3684639-3684661 AATGAGGGAGCCTGTCTGGGAGG - Intergenic
950170967 3:10838919-10838941 GAGGAAGGAGCGGAACTGGGAGG - Intronic
950419825 3:12892381-12892403 GAGGAGGGAGCCGCCCTGAGAGG - Intergenic
950451183 3:13066725-13066747 TATCCAGGAGCCGCTCTGGCAGG + Intronic
951863268 3:27277523-27277545 GATGAAGGAGCCTTGGTGGGTGG - Intronic
952213049 3:31248766-31248788 GATGAATGAGAGGCCCTGGGAGG - Intergenic
954327587 3:49871998-49872020 GATCAAGGGGCTGCTCTGGTGGG - Intergenic
954611571 3:51947203-51947225 GGTGGAGGAGCTGGTCTGGGGGG - Intronic
961416726 3:126764620-126764642 TTTGCAGGAGCCGCCCTGGGCGG - Intronic
968686340 4:1961751-1961773 ATTGAAGGAGCCGCCCTGGAAGG - Intronic
975091029 4:70404456-70404478 GCTGAAGGAGTGGATCTGGGAGG - Intronic
975983995 4:80186533-80186555 AAAGAAGCAGCAGCTCTGGGCGG + Intronic
982197144 4:152928023-152928045 GATGGAGGAGCCACTCAGGGAGG - Intergenic
987132618 5:14872417-14872439 TATGGAGGTGCCGCTCCGGGGGG + Intergenic
987474526 5:18374565-18374587 GATGAAGGAGCCGGGCGCGGTGG - Intergenic
990453936 5:55965701-55965723 GATGAATGAGCCGGGCGGGGTGG + Intronic
992457280 5:76927401-76927423 GATGAAGGACCAGCTATGTGAGG - Intergenic
994278898 5:97876049-97876071 AAAGAAGGAGCAGCACTGGGAGG + Intergenic
996844423 5:127883874-127883896 GATGTATGAGCCGCTCAGGCTGG + Intergenic
997206008 5:132050588-132050610 GATGAAAGAGCAGGCCTGGGAGG + Intergenic
999309125 5:150540243-150540265 GGAGAAGGACCCGCTCTGGCAGG + Exonic
999609016 5:153349525-153349547 GATCAAGGAGGGCCTCTGGGAGG + Intergenic
1002428172 5:179187898-179187920 GAGGAAGGAGCGGCTCTGCATGG + Intronic
1002795368 6:467183-467205 GAAGAATGAGGGGCTCTGGGTGG + Intergenic
1004051552 6:12085521-12085543 AAAGTAGGAGCCCCTCTGGGAGG + Intronic
1006124223 6:31827408-31827430 CAGGAAGGGCCCGCTCTGGGCGG - Intergenic
1014155531 6:118104949-118104971 AGTGAAGGAGCAGCTCTGGAGGG - Intronic
1015786552 6:136924444-136924466 GATGGAGGAGCTGCCCGGGGAGG + Exonic
1017756293 6:157532067-157532089 GGGGAAGGAGCCGCTGGGGGAGG + Intronic
1018937692 6:168284326-168284348 GCTGAAGGTGCCTGTCTGGGAGG - Intergenic
1018962432 6:168458206-168458228 GATCCAGCAGCCTCTCTGGGAGG + Intronic
1019614607 7:1953422-1953444 GGGGAGGGAGCCGCACTGGGGGG + Intronic
1019820735 7:3240952-3240974 GAGGAAGGAGCGGGTGTGGGTGG - Intergenic
1020119566 7:5495513-5495535 CAGGAAGGAGTCGCTCTGGCTGG - Intronic
1022799286 7:33760372-33760394 GATGAAAGAGCCTCTCTGTATGG + Intergenic
1025613700 7:63100117-63100139 GATGAAGGGGCCGTCCAGGGAGG - Intergenic
1029114522 7:98230520-98230542 GAGGAGAGAGCCGCTGTGGGAGG - Intronic
1029123967 7:98284973-98284995 GATGAGGTAGCTGCGCTGGGAGG + Intronic
1032348810 7:131141150-131141172 GATGAATGAGATGCCCTGGGAGG - Intronic
1034343961 7:150374473-150374495 GATGAAGGAGCCTCTGGGAGGGG + Intronic
1034345865 7:150384778-150384800 GAGGGAGGAGCTGCTCTGGGAGG + Intronic
1035938061 8:3864680-3864702 GATGAAGGTGCCCTACTGGGAGG + Intronic
1036970433 8:13348951-13348973 GAGGCAGCAGCCGCTCTGGAAGG + Intronic
1037915430 8:22770105-22770127 GAAGCAGGCGCCCCTCTGGGTGG + Intronic
1038564626 8:28609521-28609543 CCTGAAGGAGGAGCTCTGGGTGG + Intronic
1038929705 8:32179115-32179137 GAGGAATGAGCTGCTCTGTGAGG + Intronic
1039896573 8:41720702-41720724 GATGAAGGAGGGGCACTGGGAGG + Intronic
1043164531 8:76886795-76886817 GATGAAGGAACTTCTCTGGCTGG + Intergenic
1046595055 8:116251608-116251630 GAGGAATGAGCAACTCTGGGAGG + Intergenic
1049843127 8:144786971-144786993 GACGCAGAAGCCGCTCTGTGCGG + Intronic
1058577151 9:106415874-106415896 GTTGAAGGAGCGGGTCTGGTGGG + Intergenic
1059364601 9:113776457-113776479 ATGGAAGGAGCCGTTCTGGGTGG - Intergenic
1059460807 9:114428777-114428799 GCTGAAGGATCTGCTCAGGGGGG - Intronic
1060446385 9:123692074-123692096 GACGAAGGAACAGCTCTTGGGGG - Intronic
1060528663 9:124334759-124334781 GCTGGAGTAGCCGCTGTGGGAGG + Intronic
1061164843 9:128916329-128916351 GGTGAAGGAGCGGCTGTGGAGGG + Exonic
1061540771 9:131277058-131277080 GCTGACGGCGCAGCTCTGGGCGG + Intergenic
1062218192 9:135400306-135400328 GATGATGGAGCCGCTCTGCTGGG - Intergenic
1062349662 9:136132738-136132760 GGTGCAGGAGCCGCACAGGGAGG - Intergenic
1186515805 X:10165399-10165421 CATGAAGGAGAGGCTGTGGGTGG + Intronic
1186923153 X:14303783-14303805 AAGGAAGGGGCCTCTCTGGGGGG + Intergenic
1187001264 X:15181532-15181554 GATGAAGGAGCCTCAATGAGAGG - Intergenic
1187391239 X:18887749-18887771 GATGAAGCAGCCGTTCTTAGTGG - Intergenic
1190292560 X:49002172-49002194 GATGCAGGTGCCGCTCGCGGTGG - Exonic
1191861337 X:65668292-65668314 AAGGAGGGAGCCGCTCGGGGCGG + Intronic
1192174830 X:68879116-68879138 GATGAAGGAGGCGTGGTGGGGGG + Intergenic
1193856126 X:86604880-86604902 GATGTAGGAGCCCGTCTGTGAGG + Intronic
1194935036 X:99938665-99938687 TTTGCAGGAGCCGCCCTGGGCGG - Intergenic
1195535535 X:106004926-106004948 GATGAAGGAGGCGATATTGGAGG + Intergenic