ID: 1144908026

View in Genome Browser
Species Human (GRCh38)
Location 17:18653798-18653820
Sequence TTGGCCACAGGCGGGCATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 2, 1: 0, 2: 1, 3: 13, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144908018_1144908026 9 Left 1144908018 17:18653766-18653788 CCTGCTATCTTTAGAAAGACTTG 0: 2
1: 0
2: 0
3: 13
4: 135
Right 1144908026 17:18653798-18653820 TTGGCCACAGGCGGGCATCTGGG 0: 2
1: 0
2: 1
3: 13
4: 143
1144908017_1144908026 14 Left 1144908017 17:18653761-18653783 CCGAGCCTGCTATCTTTAGAAAG 0: 2
1: 0
2: 6
3: 14
4: 208
Right 1144908026 17:18653798-18653820 TTGGCCACAGGCGGGCATCTGGG 0: 2
1: 0
2: 1
3: 13
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144908026 Original CRISPR TTGGCCACAGGCGGGCATCT GGG Intronic
900629781 1:3628179-3628201 TTGGCCACAGGAGAGCATGGTGG + Intronic
901070252 1:6513383-6513405 TTGACCCCAGGCGGGCATCCAGG - Intronic
903549940 1:24150773-24150795 CTGGCCACAAGCGGGCATGGTGG + Intergenic
904117795 1:28175312-28175334 TGGGCCTCAGGTGGGCATCCGGG - Intronic
907333475 1:53686076-53686098 ATGGCCATAGGTGGGCAGCTGGG - Intronic
912538382 1:110393714-110393736 TTGGCCTCTGGCTGGCAACTGGG + Intergenic
913238992 1:116811528-116811550 TTGGCCATTGGTTGGCATCTGGG + Intergenic
915929932 1:160054061-160054083 CTGCCCACAGGATGGCATCTTGG + Intronic
917866001 1:179196105-179196127 TTGGCCCTTGGCTGGCATCTAGG - Intronic
917866547 1:179201120-179201142 TTGGCCCTTGGCTGGCATCTAGG - Intronic
920665671 1:207961040-207961062 TTGGCACCACGCGGGCATATTGG - Intergenic
920889074 1:209964946-209964968 TTGGCCCTTGGCTGGCATCTGGG - Intronic
921066990 1:211630461-211630483 TTGGTCACATGCTGGCTTCTTGG - Intergenic
922867234 1:228870516-228870538 CTGGCCACAGGCGGTCGTCTAGG - Intergenic
1067741336 10:48898009-48898031 TTGGCAATAGGCGAGCACCTTGG - Intronic
1073638043 10:105219542-105219564 TTGGCCCCAGGCTGGTATCTGGG - Intronic
1075535335 10:123266773-123266795 GTGGCAACAGGGGGCCATCTTGG + Intergenic
1076010354 10:126983110-126983132 TTGCCCACAGTGGGGCACCTTGG - Intronic
1076474711 10:130744018-130744040 TCTGCCAGAGGAGGGCATCTGGG - Intergenic
1081861885 11:46337874-46337896 TTGGCCCCAGAAGGGCCTCTAGG + Intronic
1082002407 11:47400326-47400348 TGGGCCGCAGCCGGGCAGCTCGG - Intergenic
1088264209 11:107974255-107974277 TTGGCCCTTGGCTGGCATCTAGG - Intergenic
1088504126 11:110512624-110512646 GTGGGCACAGGAGGGCATCCAGG - Intergenic
1089713127 11:120331575-120331597 TTGGCCACTGGCCGGCATTTGGG - Intronic
1090827349 11:130397128-130397150 TTGGCCCTTGGCTGGCATCTGGG + Intergenic
1091019696 11:132088085-132088107 ATGGCCACAGGTGTGCATGTGGG - Intronic
1094360527 12:29625778-29625800 TTCCCCACAGGCTGTCATCTCGG - Intronic
1094475023 12:30834118-30834140 TTGGCCCCATGGTGGCATCTAGG - Intergenic
1095590014 12:43892528-43892550 TTGGCCCTTGGCTGGCATCTGGG - Intronic
1095910756 12:47424371-47424393 ATAGCCACAGGCAGGCAGCTAGG - Intergenic
1097135821 12:56853977-56853999 TGAGGCTCAGGCGGGCATCTTGG + Intergenic
1098955034 12:76680862-76680884 TTGGCCATTGGCTGGCATCTGGG + Intergenic
1102088799 12:110168863-110168885 TTGGCCCTTGGCTGGCATCTGGG + Intronic
1108490356 13:50975456-50975478 TTGGCCTTTGGCTGGCATCTGGG + Intergenic
1110407848 13:75170456-75170478 TTGTCCACAGCTTGGCATCTGGG - Intergenic
1112216644 13:97437325-97437347 GTGGCCACAGGCTGCCATATTGG + Intronic
1113653386 13:112053810-112053832 TTGCCCACAGCCGGCCGTCTGGG - Intergenic
1115754433 14:36518353-36518375 CTGGCCACAGGCGGCGAACTGGG + Intronic
1116487412 14:45467211-45467233 TTGGCCTTTGGCTGGCATCTTGG + Intergenic
1119267739 14:73273953-73273975 TTGGCCTCAGGAGGGCTTCAAGG - Exonic
1122715576 14:103694993-103695015 ACGGCCACAGGCGAGCAGCTCGG - Intergenic
1122740704 14:103870172-103870194 TTGGCCACAGGCTGGTACGTGGG + Intergenic
1122886522 14:104712818-104712840 TTGCCCCCAGGCCAGCATCTCGG + Exonic
1126217790 15:46176384-46176406 TGGGCCACAGGGGAGAATCTTGG + Intergenic
1126819931 15:52492623-52492645 TTGGCCCTTGGCGAGCATCTGGG - Intronic
1127917537 15:63467499-63467521 TTCCCCACGGTCGGGCATCTGGG - Intergenic
1128807044 15:70538859-70538881 TTGGCCCTTGGCTGGCATCTGGG + Intergenic
1128810647 15:70569494-70569516 TTGGCCCTTGGCTGGCATCTGGG - Intergenic
1128862408 15:71084920-71084942 TTGGCCCCTGGTGGGCATCTGGG + Intergenic
1130411075 15:83649261-83649283 TTGGCCACAGGGAGCCACCTTGG + Intergenic
1131483607 15:92802419-92802441 ATGGCCCCAGCCGGGCATGTTGG - Intronic
1131966325 15:97847935-97847957 TTGGCCAGAGGTGTGCATCTTGG - Intergenic
1132658962 16:1053204-1053226 TTGGCCACAGGCTGGCCACCAGG + Intergenic
1134194928 16:12152407-12152429 TTGGCCTCAGATGGGCATGTGGG + Intronic
1134675892 16:16090395-16090417 TTGCCCACAGACGCGGATCTTGG + Exonic
1136514632 16:30760751-30760773 TTGGCCACCGGCGTGAAGCTGGG + Exonic
1136598319 16:31266762-31266784 TTGGCAAGAGGTGGGAATCTTGG + Intronic
1138111248 16:54325829-54325851 TTGGACACAGGGGGAAATCTTGG + Intergenic
1139351344 16:66338096-66338118 TTAGCCACAGGCTGTCATCTAGG + Intergenic
1139632747 16:68240217-68240239 TTGGCCTGATGGGGGCATCTAGG - Intergenic
1139831044 16:69798615-69798637 TCTGCCACAGGGGGGCATCTGGG + Intronic
1141866123 16:86751283-86751305 TTGGCCACATGTTGGCATCTGGG - Intergenic
1142499514 17:324345-324367 ATGGCCGCAGGCGGGCATCAGGG - Intronic
1144492448 17:15725389-15725411 TTGGCCACAGGCGGGCATCTGGG - Intergenic
1144824630 17:18098884-18098906 TTGGCCACAGGTTGGCATCTGGG + Intronic
1144908026 17:18653798-18653820 TTGGCCACAGGCGGGCATCTGGG + Intronic
1148052119 17:44774592-44774614 TGGGCCACACGGGGGCCTCTGGG - Intronic
1151239768 17:72748804-72748826 TTGGCTAGAGGCATGCATCTGGG - Intronic
1151680763 17:75621491-75621513 TTGGCCACAGGCTCCCATCCAGG + Intergenic
1153837498 18:8977094-8977116 TTGGCCACACCCGGCCACCTTGG - Intergenic
1154344274 18:13529211-13529233 TTGGCCAGTGCCGGGCAACTGGG - Intronic
1156157459 18:34320282-34320304 TTGGCCACAGTCAGAAATCTTGG - Intergenic
1159892041 18:73962118-73962140 TTGGCCACAGGCAAGCAGGTAGG + Intergenic
1160232652 18:77059890-77059912 TGGGAGACAGGCGGGCTTCTTGG + Intronic
1160836971 19:1129461-1129483 TGGGCCTCAGGCGGGCAGCATGG - Intronic
1161017366 19:1989941-1989963 TGGCACACAGGTGGGCATCTGGG - Intronic
1161976483 19:7610637-7610659 CTGGGCCGAGGCGGGCATCTGGG + Intronic
1166601324 19:44097645-44097667 TTACCCACAGGAGGGCATTTTGG + Intronic
1167092378 19:47353458-47353480 TTGGCCAGAAGCAGGCATTTGGG + Exonic
1167181392 19:47906780-47906802 GTGGCCAGAGGCGGCCATATTGG - Intergenic
927895039 2:26776156-26776178 TTAGACACAGGCAGGCCTCTGGG + Intronic
929266071 2:39920399-39920421 TTGGCCACAGGTGGGGCTGTGGG + Intergenic
930748846 2:54912802-54912824 TTGGTCACTGATGGGCATCTTGG + Intronic
931196520 2:60057211-60057233 TTGGCCAAAGGTGGGAAGCTGGG - Intergenic
934920041 2:98335661-98335683 TTTGCCACAGGAGGGGATGTGGG + Intronic
935312739 2:101801659-101801681 TTGGCCTTTGGCTGGCATCTGGG - Intronic
938244595 2:129766828-129766850 TTCCCCACTGGTGGGCATCTGGG - Intergenic
938492204 2:131767166-131767188 TTGCCCTCAGCTGGGCATCTGGG + Exonic
938495363 2:131795177-131795199 TTGCCCTCAGCTGGGCATCTGGG - Exonic
938560065 2:132464353-132464375 TTGGCCTATGACGGGCATCTGGG + Intronic
940337986 2:152548298-152548320 TTGGCCCTTGGCTGGCATCTAGG + Intronic
943676913 2:190724637-190724659 TTGGCCCTTGGCTGGCATCTAGG + Intergenic
946188743 2:217996181-217996203 TTGGCCACAGGAAGGCTTGTGGG - Intronic
947340276 2:229130965-229130987 TTGGGCACAGGCGTGCACCCAGG - Intronic
1169017054 20:2300541-2300563 TTGGCTACAGGGCGGCAGCTTGG + Intronic
1169405227 20:5316560-5316582 TTGGGCGCAGGCGGGCCGCTCGG + Intergenic
1169815123 20:9648557-9648579 TTGGCCCTTGGCTGGCATCTGGG - Intronic
1172266011 20:33614886-33614908 TGGGCCACTGGCTGGCATCTAGG - Intronic
1174537733 20:51265552-51265574 TTGGCCTGGGGCTGGCATCTGGG - Intergenic
1175116990 20:56689632-56689654 TAGGCCTCAGGTTGGCATCTGGG + Intergenic
1175298197 20:57923760-57923782 ATGGCCACAGGGAGCCATCTGGG - Intergenic
1176003689 20:62847675-62847697 ATGGCCACTGGAGGGCCTCTCGG - Intronic
1176709493 21:10136974-10136996 TTGCCCTCAGCTGGGCATCTGGG + Intergenic
1177551799 21:22632664-22632686 TCCACCACTGGCGGGCATCTAGG - Intergenic
1178921675 21:36743026-36743048 TGGGCCACAGGTGTGCATGTTGG + Intronic
1180224001 21:46378481-46378503 CTGCCCACACGCAGGCATCTCGG - Intronic
1181049117 22:20230454-20230476 TTGGCCCCATGCGGGCCCCTGGG - Intergenic
1181146999 22:20855899-20855921 TTGGCCTTTGGCTGGCATCTGGG - Intronic
954285624 3:49616961-49616983 CTGGCCACAGGAGGGCTGCTGGG - Intronic
954314222 3:49792483-49792505 TTGGCCCTAGGCTGGCTTCTTGG - Exonic
960275030 3:115719334-115719356 TTGACCATTGGCTGGCATCTGGG + Intronic
966007324 3:175031512-175031534 TTGACCACAGATGGGCACCTGGG + Intronic
969522256 4:7685286-7685308 GTGGCCTCAGGCAGGCATGTGGG + Intronic
973994868 4:56448290-56448312 TTAGCCACAGCCGGGCATGGTGG - Intronic
976849526 4:89529347-89529369 TTGGCCTTAGGGGCGCATCTGGG - Intergenic
977013628 4:91664083-91664105 TTAGCCACAGGAGAGCACCTTGG - Intergenic
980960555 4:139470518-139470540 ATGGCCACAGGGGGGCCTTTGGG - Intronic
984024737 4:174529588-174529610 TTGGTCACAGGCAGGTATATGGG + Intergenic
986089799 5:4493122-4493144 GTGGACACAGGCAGGCCTCTGGG + Intergenic
987607841 5:20161234-20161256 TTGGCATCAGCCAGGCATCTAGG - Intronic
990334635 5:54760223-54760245 TTGGACAGTGGCGGGCCTCTTGG + Intergenic
994068295 5:95568702-95568724 TTGGCCCCTGTCTGGCATCTAGG + Intronic
1003923037 6:10851248-10851270 TTGGTCACAGTGGGACATCTGGG + Intronic
1006537226 6:34709555-34709577 GTGGGCCCAGGCAGGCATCTGGG + Intergenic
1009394206 6:63178415-63178437 TTGGCCCTTGGCTGGCATCTGGG - Intergenic
1014240506 6:119012789-119012811 TTGGCCCTTGGCTGGCATCTGGG - Intronic
1018269098 6:162056623-162056645 TTGGCCCTTGGCTGGCATCTGGG + Intronic
1021181079 7:17506793-17506815 TTGGCTAAAGGCAGGCATCTGGG + Intergenic
1021428364 7:20529842-20529864 TTGTCCATTGACGGGCATCTGGG - Intergenic
1024926974 7:54627428-54627450 TTGGCCCTTGGCTGGCATCTGGG + Intergenic
1026482220 7:70789415-70789437 TTGACCACATGCAGCCATCTTGG + Intronic
1028598952 7:92579937-92579959 CTGGCCCTAGGTGGGCATCTGGG + Intronic
1029220941 7:98989733-98989755 TAGGCCACAGGCTGGCAGCCAGG - Intronic
1030112878 7:106041468-106041490 GTGGCCACAGGGTGGAATCTTGG - Intergenic
1032410153 7:131688872-131688894 GTGGCCACAGCTGGGCATTTAGG + Intergenic
1038444202 8:27592387-27592409 TTGGCCACAAGGGGGCAGCGCGG - Intergenic
1038609345 8:29045488-29045510 TTGGTTACAGGTTGGCATCTAGG + Intronic
1039441730 8:37599690-37599712 TGGGCCACAGGCTGGTTTCTTGG - Intergenic
1041099663 8:54383198-54383220 CTGGCCTCAGGCGGGCAGCCAGG + Intergenic
1049408945 8:142463989-142464011 GTGGCCACAGGCTGGCACCAGGG + Exonic
1051401061 9:16683178-16683200 TTGACCACAGTAGGGGATCTTGG + Intronic
1052268868 9:26605528-26605550 TTGGCCCTTGGCTGGCATCTGGG + Intergenic
1053646466 9:40122510-40122532 TTGCCCTCAGCTGGGCATCTGGG + Intergenic
1053759247 9:41341041-41341063 TTGCCCTCAGCTGGGCATCTGGG - Intergenic
1054327477 9:63720412-63720434 TTGCCCTCAGCTGGGCATCTGGG + Intergenic
1054538103 9:66253463-66253485 TTGCCCTCAGCTGGGCATCTGGG - Intergenic
1060612498 9:124980399-124980421 TTGGCCCCTGGCTGGCTTCTGGG + Intronic
1060944063 9:127559655-127559677 TTGGCCACAGATGGGCAGGTGGG + Intronic
1061765519 9:132878788-132878810 TTGGCCAGAGCCGGGGAGCTGGG - Intronic
1202794252 9_KI270719v1_random:105941-105963 TTGCCCTCAGCTGGGCATCTGGG + Intergenic
1203577793 Un_KI270745v1:21647-21669 TGGGCCACACGCGGGCTGCTGGG - Intergenic
1185480347 X:441557-441579 TGGGACACAGCCGTGCATCTGGG - Intergenic
1185619259 X:1443397-1443419 TTGGACACACGCCGCCATCTTGG + Intronic
1185619912 X:1447546-1447568 TTGGACACACACGGCCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1185620061 X:1448587-1448609 TTGGACACACACGGCCATCTTGG + Intronic
1186516766 X:10172063-10172085 TTGGCCCTTGGCTGGCATCTGGG - Intronic
1191735000 X:64379605-64379627 TTGGACACAGGCATGCATATTGG - Intronic
1200118810 X:153780944-153780966 TTGCCCACAGCCGAGCAGCTGGG + Intronic