ID: 1144908881

View in Genome Browser
Species Human (GRCh38)
Location 17:18661840-18661862
Sequence CCTCACATGCATATTATGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 124}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144908881 Original CRISPR CCTCACATGCATATTATGGA TGG Exonic
903914502 1:26753754-26753776 CCTAACAGGCATCTTCTGGAAGG - Intronic
905879446 1:41454169-41454191 CCTGGAATGCATATTCTGGAAGG - Intergenic
907949770 1:59171068-59171090 TCTCACGTTCATGTTATGGATGG - Intergenic
908608049 1:65822531-65822553 TCTAACATGCAAATTTTGGAGGG - Intronic
915102892 1:153513413-153513435 CCTCTGATGCATATGGTGGAAGG + Intergenic
915230364 1:154441429-154441451 CCACACATGCATAGGGTGGAGGG - Intronic
916275495 1:162989133-162989155 CCTCACATGCGTCCTATGAAAGG + Intergenic
917274319 1:173315248-173315270 AGTCACATGCATAGAATGGATGG + Intergenic
917779787 1:178381305-178381327 CTTCTCATGCAGATTATGGCAGG - Intronic
918821077 1:189254788-189254810 CCACACATACACATTCTGGAAGG - Intergenic
918948593 1:191105002-191105024 CTTCACATGTATATAATGAATGG - Intergenic
922389178 1:225121235-225121257 CCTCACATGCTTATTTTTTATGG + Intronic
924391571 1:243566042-243566064 CCTCACATGCTTTGTATGCATGG + Intronic
1064337259 10:14454896-14454918 CCTCACAGGCAAAATATGAAAGG + Intronic
1067051564 10:43024571-43024593 CCTGACATGGATGATATGGATGG + Intergenic
1068411039 10:56654951-56654973 TCTCACACACATCTTATGGATGG - Intergenic
1069160360 10:65084639-65084661 CCTCAGAAGCAGATTCTGGAGGG + Intergenic
1072032113 10:91530819-91530841 CCTCACATCAGTTTTATGGATGG + Intergenic
1072819167 10:98539219-98539241 CCTAACATGCTTTTTAAGGAAGG - Intronic
1074195614 10:111182034-111182056 CTTCACATTCAAATTTTGGATGG + Intergenic
1074512488 10:114128625-114128647 CCTCACATGAATTTTTTGCAGGG + Intronic
1075697879 10:124449304-124449326 CATCACCTCCATTTTATGGATGG - Intronic
1078015511 11:7610137-7610159 AGTCACAGGCCTATTATGGATGG - Intronic
1086024620 11:82275399-82275421 CCTCACAGGATTATTATGAAAGG + Intergenic
1086666078 11:89484022-89484044 TCTCTCATCCATAGTATGGAAGG - Intronic
1089310593 11:117555857-117555879 CCTCTCCTGCAGAGTATGGAGGG + Intronic
1089910830 11:122099298-122099320 CCACACATGTGTATCATGGATGG - Intergenic
1090526219 11:127540437-127540459 CCTCGCATGCATTCTATGGATGG - Intergenic
1093885723 12:24457971-24457993 CCTCACATCCCTATTTAGGAAGG - Intergenic
1094838498 12:34333331-34333353 CCTCACATGCACAGTGTGGAGGG - Intergenic
1096553782 12:52390950-52390972 CCTCACTGGCACATTCTGGAGGG + Intergenic
1098891364 12:76013060-76013082 CCTCACATGCTCATTTTGGCAGG + Intergenic
1099873685 12:88378881-88378903 CCTCACAGGAATTTTATGAAGGG + Intergenic
1107115528 13:36742064-36742086 GCTCAAATGCATATCATGTATGG + Intergenic
1110718855 13:78738895-78738917 CCACACTTGCATATCATGAAGGG - Intergenic
1113434075 13:110275757-110275779 CCTCAAATGCATATTACTAAGGG + Intronic
1118169004 14:63366983-63367005 CCTGAAAAGCATATTCTGGAGGG + Intergenic
1124175244 15:27418139-27418161 CCTCAGATGAATATGAAGGAAGG + Intronic
1124932966 15:34141061-34141083 CCTGTCAGGCATATTAAGGATGG + Exonic
1125480809 15:40078699-40078721 CATCACCTGCACACTATGGAAGG - Intergenic
1129540554 15:76343892-76343914 CCCCACTTGCAGATGATGGAAGG + Intergenic
1131777836 15:95821935-95821957 TATCACTTGCATATTGTGGAAGG - Intergenic
1132417760 15:101635928-101635950 CCACACATACATATGATAGAAGG - Intronic
1135615444 16:23907574-23907596 CCTCACATGCATCTAATCAACGG - Intronic
1137849863 16:51731033-51731055 CATCATATGCAAATTATGCATGG - Intergenic
1142886603 17:2916621-2916643 CTTCACTTGCATAATAGGGACGG + Intronic
1144908881 17:18661840-18661862 CCTCACATGCATATTATGGATGG + Exonic
1151001358 17:70380752-70380774 CCTCAGATGTATATTTAGGATGG - Intergenic
1154087856 18:11324654-11324676 CCTCCCATGATTATTATGGCAGG - Intergenic
1155124377 18:22857135-22857157 CTTCACATGCTTTTGATGGAAGG + Intronic
1155278983 18:24218823-24218845 CCTCACATGCTTATTTTTTATGG - Intronic
1155919809 18:31592295-31592317 CCCCAAATACATTTTATGGAGGG - Intronic
1156358481 18:36362624-36362646 CCTCACCTGCATCCTATGGCTGG - Intronic
1159299469 18:66544050-66544072 CTTCAAATACATAATATGGAAGG + Exonic
1160255042 18:77241064-77241086 ACTGACCTGCATTTTATGGAAGG + Intergenic
1167644445 19:50698067-50698089 CCTCAGATGTTTATTAAGGATGG - Intronic
1167906184 19:52662708-52662730 CCTCACCTGTATATTACAGATGG + Intronic
930341671 2:50123831-50123853 CTTCAGATGGATATTGTGGAAGG + Intronic
932569793 2:72932589-72932611 CCTCTCATGCATAATCTGGGAGG - Intronic
934851427 2:97704098-97704120 CCTCACGTGATTATTATGCATGG - Intergenic
934952449 2:98586685-98586707 CCTCAGCTGCATCTGATGGAGGG - Intronic
938131995 2:128724701-128724723 CCGAACATGCAGATGATGGATGG - Intergenic
938867708 2:135441002-135441024 CCCAACATTCATATAATGGAAGG + Intronic
941096763 2:161245839-161245861 CCTCAAATGCATTTTTTGGAAGG + Intergenic
943166940 2:184340894-184340916 CCTCACATCCAAAATTTGGATGG + Intergenic
1174702837 20:52626330-52626352 CCTGAGATGCTTATTCTGGAGGG - Intergenic
1175346762 20:58285009-58285031 GCTCACAAGGATGTTATGGATGG - Intergenic
1181175965 22:21035887-21035909 TCTCAAATGCATATTATTAAGGG - Intergenic
1184923682 22:47623229-47623251 CCTTGCATGCATGATATGGAAGG + Intergenic
953861749 3:46550216-46550238 CCTCATCTGCAAATTAGGGATGG + Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
955926306 3:64008657-64008679 CCTCACATGCACAATATTGGGGG + Intergenic
960621940 3:119645649-119645671 CTTCACAGGCATAGAATGGAGGG + Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
964735271 3:159911044-159911066 CTTCACATGCACAGTATGAATGG + Intergenic
964979299 3:162659737-162659759 CTTCACATGCAAATAATGGATGG - Intergenic
965332763 3:167397329-167397351 CCTCACATACACTGTATGGATGG + Intergenic
969103956 4:4791048-4791070 CCTCAAATGCATTTAATGCATGG + Intergenic
971562790 4:28102642-28102664 TCTCAGATGCATATTATGCTGGG + Intergenic
971889508 4:32500036-32500058 CCTCACATTGTTATTTTGGAAGG - Intergenic
973031098 4:45340922-45340944 ACTAACAGGCATATTATGCATGG + Intergenic
978330499 4:107607959-107607981 CCTCAAATGCATATCATTAAGGG + Intronic
981837533 4:149072699-149072721 TCCCACATGCATATTGTGGGAGG + Intergenic
983081166 4:163387183-163387205 CCACGCACGCATATTATGGAGGG + Intergenic
985889005 5:2701202-2701224 CCTCAAATGCACATTGTGAAAGG - Intergenic
989516515 5:42349556-42349578 ACTAACAGGCATATTAGGGAAGG - Intergenic
991051703 5:62279568-62279590 ATGCTCATGCATATTATGGAAGG + Intergenic
993841929 5:92890686-92890708 ACAGACATGCTTATTATGGATGG - Intergenic
996261067 5:121469103-121469125 ACTAACAGGCATATTATGCATGG + Intergenic
1001840569 5:174873031-174873053 CCCCTCATGCATTTTAAGGAGGG + Intergenic
1007796788 6:44355283-44355305 ACTTAAATGCATATTATTGAGGG - Intronic
1008120371 6:47608853-47608875 CATCAAATGTATATTATGGATGG - Intronic
1013780303 6:113721205-113721227 CCTCACATGCTTATTTTTTATGG - Intergenic
1014641772 6:123920499-123920521 TCTCACATGGAAAATATGGAAGG - Intronic
1014767441 6:125422878-125422900 CCTCTCATGCATATTTGTGAGGG + Intergenic
1015116366 6:129654143-129654165 CCTAACATGAATATGAGGGACGG + Intronic
1015333321 6:132006433-132006455 CCTCATATGCATAATATCCAAGG - Intergenic
1015848033 6:137542181-137542203 CCTCACAACCATATTAATGAGGG - Intergenic
1016089704 6:139961738-139961760 CCACACATACATATTATGCTAGG - Intergenic
1022458413 7:30579718-30579740 CCTCACAAGCATGTCATGAATGG + Intergenic
1023621983 7:42082617-42082639 TCTCACAAGCATATTATGTGGGG + Intronic
1027947757 7:84770980-84771002 ACTAAAATGCATATTATAGAAGG - Intergenic
1029170323 7:98625543-98625565 CCCCACAAGCATATTTTGGTGGG + Intronic
1031158760 7:118141384-118141406 CCCCACCTGCATATTTTGCATGG + Intergenic
1031335235 7:120521738-120521760 ACTCACATATATATTATAGATGG - Intronic
1036009284 8:4703075-4703097 ACTCAAATGCAAATTATGTATGG - Intronic
1037828275 8:22173050-22173072 ATTTACTTGCATATTATGGAAGG + Intronic
1039663017 8:39487699-39487721 CCTTACCTGCATATTAAGCAGGG - Intergenic
1041994019 8:64030217-64030239 GCTCACATGCATCTTTGGGATGG - Intergenic
1044779448 8:95728974-95728996 CATCAAATGGATATTATGGTAGG + Intergenic
1046610970 8:116425205-116425227 TCTCACAAGCATAATATTGAGGG + Intergenic
1047816032 8:128463801-128463823 CCTAACATGGATATTATTCAGGG - Intergenic
1050847942 9:10247062-10247084 CTTCACATGCATAAAATGTAAGG + Intronic
1052774124 9:32716726-32716748 CCCCACATGCATATTCCGGCAGG - Intergenic
1059281355 9:113136693-113136715 CCTCATATGCATGGTCTGGATGG - Intergenic
1060961879 9:127686578-127686600 CCTGACATTCATATCAAGGAAGG - Intronic
1185956457 X:4496146-4496168 CCACACAGTCACATTATGGAAGG - Intergenic
1188236293 X:27735662-27735684 CCATACATGCATATTAAGAATGG + Intronic
1188288604 X:28360799-28360821 TCTCATATGCATAACATGGAAGG + Intergenic
1188608701 X:32068836-32068858 CCTCACTTCCATATTATGGTGGG - Intronic
1188709158 X:33372924-33372946 CCTTAAATGCATATTACTGAGGG - Intergenic
1194833689 X:98656845-98656867 CCTCACAAGTATATTTTGCAGGG - Intergenic
1197743862 X:129917412-129917434 CCTCACACACATATTATGTGTGG - Intronic
1199728614 X:150608628-150608650 CCTCACATACATATTTTGTGTGG + Intronic
1200181083 X:154151074-154151096 CCTCACATCCATATACTGAAGGG + Intronic
1200186728 X:154188188-154188210 CCTCACATCCATATACTGAAGGG + Intergenic
1200192379 X:154225326-154225348 CCTCACATCCATATACTGAAGGG + Intronic
1200198134 X:154263130-154263152 CCTCACATCCATATACTGAAGGG + Intronic
1201486590 Y:14501319-14501341 AGTCACATACATATTATTGAGGG + Intergenic
1202252404 Y:22886898-22886920 ACTCTCATGCATACTATGTAAGG - Intergenic
1202405393 Y:24520647-24520669 ACTCTCATGCATACTATGTAAGG - Intergenic
1202465387 Y:25149435-25149457 ACTCTCATGCATACTATGTAAGG + Intergenic