ID: 1144909811

View in Genome Browser
Species Human (GRCh38)
Location 17:18672005-18672027
Sequence TGATGAGCTGGATGCGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 2, 1: 0, 2: 2, 3: 11, 4: 272}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144909811_1144909822 24 Left 1144909811 17:18672005-18672027 CCGTCCACGCATCCAGCTCATCA 0: 2
1: 0
2: 2
3: 11
4: 272
Right 1144909822 17:18672052-18672074 GACCACTTGGAGAGCTGGGAGGG 0: 1
1: 1
2: 2
3: 19
4: 259
1144909811_1144909816 -5 Left 1144909811 17:18672005-18672027 CCGTCCACGCATCCAGCTCATCA 0: 2
1: 0
2: 2
3: 11
4: 272
Right 1144909816 17:18672023-18672045 CATCACTGCTGCGTGACGTGGGG 0: 2
1: 0
2: 0
3: 6
4: 107
1144909811_1144909819 20 Left 1144909811 17:18672005-18672027 CCGTCCACGCATCCAGCTCATCA 0: 2
1: 0
2: 2
3: 11
4: 272
Right 1144909819 17:18672048-18672070 GCCAGACCACTTGGAGAGCTGGG 0: 1
1: 1
2: 2
3: 15
4: 122
1144909811_1144909814 -7 Left 1144909811 17:18672005-18672027 CCGTCCACGCATCCAGCTCATCA 0: 2
1: 0
2: 2
3: 11
4: 272
Right 1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG 0: 2
1: 0
2: 0
3: 4
4: 75
1144909811_1144909821 23 Left 1144909811 17:18672005-18672027 CCGTCCACGCATCCAGCTCATCA 0: 2
1: 0
2: 2
3: 11
4: 272
Right 1144909821 17:18672051-18672073 AGACCACTTGGAGAGCTGGGAGG 0: 1
1: 1
2: 3
3: 28
4: 223
1144909811_1144909815 -6 Left 1144909811 17:18672005-18672027 CCGTCCACGCATCCAGCTCATCA 0: 2
1: 0
2: 2
3: 11
4: 272
Right 1144909815 17:18672022-18672044 TCATCACTGCTGCGTGACGTGGG 0: 2
1: 0
2: 1
3: 5
4: 91
1144909811_1144909818 19 Left 1144909811 17:18672005-18672027 CCGTCCACGCATCCAGCTCATCA 0: 2
1: 0
2: 2
3: 11
4: 272
Right 1144909818 17:18672047-18672069 TGCCAGACCACTTGGAGAGCTGG 0: 1
1: 1
2: 1
3: 12
4: 127
1144909811_1144909817 11 Left 1144909811 17:18672005-18672027 CCGTCCACGCATCCAGCTCATCA 0: 2
1: 0
2: 2
3: 11
4: 272
Right 1144909817 17:18672039-18672061 CGTGGGGCTGCCAGACCACTTGG 0: 1
1: 1
2: 0
3: 11
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144909811 Original CRISPR TGATGAGCTGGATGCGTGGA CGG (reversed) Intronic
900649993 1:3725964-3725986 GGATGGGGTGGATGGGTGGATGG + Intronic
900883473 1:5399157-5399179 TGAATAGATGGATGGGTGGATGG + Intergenic
900883498 1:5399287-5399309 TGAGAAGGTGGATGTGTGGATGG + Intergenic
901318075 1:8322249-8322271 GGATGAGATGGATGGATGGATGG + Intronic
901836163 1:11925610-11925632 TGTTGAGCTGGATGCGCTGCAGG + Exonic
902078721 1:13806570-13806592 TGATGAGCTGGATGTGGGGATGG - Intronic
902202663 1:14845346-14845368 TGAAGGGATGGATGAGTGGATGG + Intronic
905245574 1:36610853-36610875 TGATGGGTTGGTTGCTTGGATGG - Intergenic
906659442 1:47572153-47572175 TGATGACATAGATGGGTGGATGG - Intergenic
907973995 1:59413351-59413373 TGATGAGTTGGATGGATGAATGG + Intronic
914747749 1:150512108-150512130 AGATGAGCTGGAACAGTGGATGG - Intronic
916668390 1:166989087-166989109 TGATTGGCTGGGTGCGTGGCAGG - Exonic
917443142 1:175084333-175084355 TGTTGAGCATGATGCATGGAAGG + Intronic
919829574 1:201531098-201531120 GGGTGGGCTGGATGAGTGGAGGG + Intergenic
919923705 1:202181429-202181451 TGAGGAGCTGGGTGCAGGGAGGG + Intergenic
924625447 1:245693426-245693448 TGATGGGCTGGTTGCTTGGTTGG + Intronic
1062964213 10:1594903-1594925 CTGTGTGCTGGATGCGTGGATGG - Intronic
1063467872 10:6259402-6259424 TGAGTAGATGGATGGGTGGATGG - Intergenic
1064334512 10:14426535-14426557 TGAAGGGATGGATGGGTGGATGG + Intronic
1067233330 10:44426866-44426888 TGCTGAGTTGGGTGTGTGGAGGG + Intergenic
1067702430 10:48583467-48583489 TGAACAGGTGGATGCATGGATGG - Intronic
1069218414 10:65852164-65852186 TGATGATTTGAATGCCTGGATGG + Intergenic
1069601623 10:69711825-69711847 TGAAGAGATGGATGGATGGATGG - Intergenic
1070350237 10:75584512-75584534 TGTTTAGGTGGATGTGTGGATGG + Intronic
1072391182 10:94988702-94988724 TGAAGAGATAGATGGGTGGATGG - Intronic
1072422306 10:95299349-95299371 TGATGAGCTGGATTCTTGTATGG + Intergenic
1074366256 10:112859837-112859859 TGATCAGACGGATGGGTGGATGG + Intergenic
1074366294 10:112860053-112860075 TGATCAGATGGATGGGTGGATGG + Intergenic
1074366320 10:112860201-112860223 TGATCAGATGGATGGATGGATGG + Intergenic
1074896308 10:117780515-117780537 TGAGTAGATGGATGCATGGATGG - Intergenic
1074896347 10:117780730-117780752 TGAATAGATGGATGCATGGATGG - Intergenic
1075066698 10:119293704-119293726 TGATGGCCTGGATGCCTGGGTGG + Intronic
1075391858 10:122097872-122097894 TGCTGAGCTGGCTGTGGGGATGG - Intronic
1076867342 10:133174581-133174603 TGAAGGGATGGATGAGTGGATGG + Intronic
1077159587 11:1106574-1106596 TGGTTGGGTGGATGCGTGGATGG - Intergenic
1077312162 11:1893712-1893734 TGAAGGGATGGATGCATGGATGG + Intergenic
1077312198 11:1893906-1893928 TGGAGAGATGGATGAGTGGATGG + Intergenic
1077315046 11:1915839-1915861 TGAAGAGATGGATGGATGGATGG + Intergenic
1077374956 11:2201334-2201356 GGATGAGGTGGATGGATGGATGG + Intergenic
1077374971 11:2201399-2201421 GGATGAGGTGGATGGATGGATGG + Intergenic
1077480978 11:2814439-2814461 TGAAGAGATGGGTGGGTGGATGG + Intronic
1079298881 11:19259684-19259706 GGATGAGTTAGATGGGTGGATGG - Intergenic
1084330204 11:68425683-68425705 TGATGAGGTAGATGGGTGAAGGG + Intronic
1084569448 11:69950631-69950653 TGTTGAGCTGGTTGCTGGGAAGG - Intergenic
1084612167 11:70210154-70210176 AGATGGGCTGGATGGGTGGAAGG - Intergenic
1084693619 11:70741060-70741082 TTATGAGATGGATGATTGGATGG - Intronic
1084705159 11:70811848-70811870 TGATAAGATGGATGGGTGGATGG - Intronic
1084816502 11:71650420-71650442 TGGGGAGCTGGATGACTGGATGG - Intergenic
1085515974 11:77112232-77112254 GGGTGGGCTGGATGGGTGGATGG + Intronic
1090624602 11:128595112-128595134 TGAAGAGATGGATGGATGGATGG + Intergenic
1090666139 11:128916239-128916261 TGATTAGATGGATGGATGGATGG + Intronic
1090776936 11:129974035-129974057 TGGTGAGCTGGAGGCGGGGCTGG - Intronic
1090939703 11:131376148-131376170 TGATGGGATGGAAGCGGGGAGGG + Intronic
1091977984 12:4842067-4842089 TGATGAGGAGGAGGAGTGGAAGG + Intronic
1092100590 12:5880781-5880803 TGAAGAGATGGATAGGTGGATGG + Intronic
1092218604 12:6698636-6698658 TGAAGAGCTGGAGGGATGGAAGG + Intronic
1092631875 12:10388790-10388812 TGATGGGGTGGATTCGTGGTCGG - Exonic
1093245532 12:16731512-16731534 TGATGAGCTGGAGCACTGGAGGG + Intergenic
1095733877 12:45535700-45535722 TGATTGGGTGGATGCATGGATGG - Intergenic
1100523942 12:95402724-95402746 TGCTCACCTGGATGTGTGGATGG + Intergenic
1101063458 12:100995390-100995412 TGATGAGTTAGAGGCGTGGGAGG + Intronic
1102396966 12:112594466-112594488 TGATGAGATGGATAGATGGAAGG - Intronic
1102895575 12:116595662-116595684 TGGAGAGGTGGATGGGTGGATGG + Intergenic
1103017772 12:117508932-117508954 GGATGGGATGGATGAGTGGATGG + Intronic
1104813927 12:131635070-131635092 TGGGGAGATGGATGGGTGGATGG - Intergenic
1105211199 13:18258152-18258174 TGGTGAGATGGATGGGTGAAAGG - Intergenic
1105279624 13:18955818-18955840 TGGTTGGATGGATGCGTGGATGG - Intergenic
1105693841 13:22869274-22869296 TTATGAGATGGATGAATGGATGG + Intergenic
1107103604 13:36620250-36620272 TTATGAACTGTATGCATGGATGG + Intergenic
1107261181 13:38493590-38493612 TGATTAGTTGGCTGTGTGGAAGG + Intergenic
1108947615 13:56043625-56043647 TGCTGAGCTTGATGCGTGTCAGG - Intergenic
1111350435 13:87021649-87021671 TGATGAACTGGATAAGTGTAAGG + Intergenic
1112387451 13:98953054-98953076 TAATTAGCTGGATGAGTGAAAGG - Intronic
1113417561 13:110140209-110140231 TGAAGAGATGGATCAGTGGATGG + Intergenic
1113876676 13:113598839-113598861 TGATGAGCTGCAGGCGAGGGTGG - Intronic
1117006489 14:51425954-51425976 TTATGTGCTGAATGAGTGGATGG + Intergenic
1119217726 14:72881929-72881951 TGATGAGCTGGGTAAGTGAAGGG + Intronic
1121277445 14:92677919-92677941 TGAGTAGATGGATGCATGGATGG - Intronic
1122867585 14:104614411-104614433 TGGAGAGATGGATGGGTGGATGG + Intergenic
1126607209 15:50490359-50490381 TTATGAGTTGGAGGGGTGGAAGG - Exonic
1128666576 15:69542560-69542582 TGATGGGATGGCTGGGTGGATGG + Intergenic
1129644145 15:77414863-77414885 TTATGAGCTGGAAGCCTGTAAGG - Intronic
1130134238 15:81168626-81168648 TTTTGAGCTGGGTGCCTGGACGG + Intronic
1130830717 15:87595916-87595938 TGAAGAACTGGATGGGTAGAGGG - Intergenic
1131531859 15:93200593-93200615 AGATGAGCTGGGGGCCTGGAGGG + Intergenic
1132351532 15:101142413-101142435 TGATTGGGTGGATGGGTGGATGG - Intergenic
1132654079 16:1034572-1034594 TGGATAGATGGATGCGTGGATGG - Intergenic
1133326836 16:4947088-4947110 TGAAGAGATGGATGAATGGATGG - Intronic
1133326848 16:4947144-4947166 TGAAGAGATGGATGGATGGATGG - Intronic
1134325498 16:13203975-13203997 TGAATAGGTGGATGGGTGGATGG - Intronic
1134531796 16:14989533-14989555 TGTTGAGCTGGATGCGCTGCAGG + Intronic
1134651340 16:15911306-15911328 TAAAGAGATGGATGGGTGGATGG + Intergenic
1134766895 16:16767105-16767127 TGAGTAGATGGATGGGTGGATGG - Intergenic
1135608518 16:23844471-23844493 TGAAGGGATGGATGCATGGATGG - Intronic
1135636185 16:24077567-24077589 GGATGAGTTGGCTGAGTGGATGG - Intronic
1135893035 16:26374316-26374338 TGATTGGCTGGGTGGGTGGATGG + Intergenic
1136608003 16:31349377-31349399 TGAACAGGTGGATGGGTGGAAGG - Intergenic
1137569453 16:49555822-49555844 TGGAGAGATGGATGTGTGGATGG + Intronic
1137625575 16:49905923-49905945 TGAATAGTTGGATGGGTGGATGG + Intergenic
1138519613 16:57563560-57563582 TGATCAGCTGGATCCCTGGCAGG + Intronic
1138810310 16:60141185-60141207 TGTTGGGTTGGATGCGGGGAGGG + Intergenic
1139447092 16:67004615-67004637 TGATGAGCAGGATGGGAGCAGGG + Intronic
1139749465 16:69100510-69100532 TGATGGGCTGGATGCCAGGGAGG + Intergenic
1141889566 16:86917735-86917757 AGATGAGAAGGATGTGTGGAAGG - Intergenic
1142152902 16:88520611-88520633 TGATTAGGTGGGTGGGTGGATGG + Intronic
1142421247 16:89972041-89972063 TGATGTCCTGGAGACGTGGACGG + Exonic
1142846304 17:2679563-2679585 TGATTAGATGGATGATTGGATGG + Intronic
1142934478 17:3316746-3316768 TGATTAACTGGATGCAGGGAAGG - Intergenic
1142955621 17:3519507-3519529 TGATTAGATGGATGGATGGATGG + Intronic
1142955664 17:3519759-3519781 TGATTAGATGGATGGATGGATGG + Intronic
1142955689 17:3519899-3519921 TGATTAGATGGATGGATGGATGG + Intronic
1144621747 17:16822666-16822688 TGATGAGGTGGAGGAGAGGAGGG - Intergenic
1144909811 17:18672005-18672027 TGATGAGCTGGATGCGTGGACGG - Intronic
1145017614 17:19409426-19409448 TGAGAACCTGGATGCGGGGAGGG - Intergenic
1147573733 17:41587008-41587030 TGATGAGGCGGATGAGAGGAGGG - Intergenic
1148160862 17:45449486-45449508 TGGTTAGGTGGATGAGTGGATGG - Intronic
1148346066 17:46904330-46904352 GGATGGGGTGGATGGGTGGATGG + Intergenic
1150392136 17:64796292-64796314 TGGTTAGGTGGATGAGTGGATGG - Intergenic
1150439031 17:65176898-65176920 TGAAGAGATGGATGGATGGATGG - Intronic
1152038043 17:77885317-77885339 TGATTGGATGGATGGGTGGATGG + Intergenic
1152766981 17:82147126-82147148 TGATTGGATGGATGGGTGGATGG + Intronic
1154335047 18:13458182-13458204 TGCTGAGCAGGAGCCGTGGAGGG + Intronic
1158562472 18:58526426-58526448 TGAGGAGCTGGCTGCTGGGATGG - Intronic
1159111886 18:64069412-64069434 TGGTGGGCTGGATGAGTGGTTGG + Intergenic
1161227547 19:3154121-3154143 TGAATAGATGGATGGGTGGATGG + Intronic
1161227667 19:3154621-3154643 TGAATGGCTGGATGGGTGGATGG + Intronic
1161227687 19:3154708-3154730 TGAATGGCTGGATGGGTGGATGG + Intronic
1161372996 19:3924081-3924103 TGAATAGATGGATGAGTGGAGGG + Intronic
1161489349 19:4553413-4553435 AGGTGAGTTGGATGGGTGGATGG + Intronic
1161489385 19:4553578-4553600 AGATGAGATGGAAGGGTGGATGG + Intronic
1161499016 19:4603075-4603097 TGAGTAGATGGATGAGTGGATGG + Intergenic
1161499076 19:4603362-4603384 TGAGTAGATGGATGGGTGGATGG + Intergenic
1161681465 19:5681775-5681797 TGAATAGATGGATGGGTGGATGG - Intronic
1163276880 19:16290471-16290493 TGACAGGCTGGATGGGTGGATGG - Intergenic
1163571305 19:18083919-18083941 TGGTGAGGTGGATGGATGGATGG - Intronic
1165144383 19:33722062-33722084 GGATGAGATGGATGGATGGATGG + Intronic
1165843118 19:38801307-38801329 TGGAGAGATGGATGCATGGATGG + Intergenic
1165932678 19:39370063-39370085 CACTGAGCTGGATGGGTGGAAGG - Exonic
1167702962 19:51061266-51061288 TGATTGGATGGATGCATGGATGG - Intronic
926038266 2:9652239-9652261 TGAATAGGTGGATGGGTGGATGG - Intergenic
926038272 2:9652263-9652285 TGGTTAGATGGATGAGTGGATGG - Intergenic
926038298 2:9652395-9652417 TGAATAGGTGGATGGGTGGATGG - Intergenic
926696479 2:15772697-15772719 GGATGAGATGGCTCCGTGGAGGG + Intergenic
930354686 2:50302933-50302955 TGAATAGATGGATGGGTGGATGG - Intronic
935019408 2:99215595-99215617 TGCAGAGATGGATGGGTGGATGG + Intronic
938185361 2:129226947-129226969 TGAATAGATGGATGGGTGGATGG + Intergenic
946119321 2:217495649-217495671 TGCTGAACTGGATACGTGGTAGG + Intronic
947836096 2:233176684-233176706 TGAATAGGTGGATGGGTGGATGG + Intronic
948366400 2:237457711-237457733 GGATGGGTTGGATGGGTGGATGG + Intergenic
948561332 2:238855492-238855514 TGATAATCTGCATGCGTAGATGG + Intronic
948899904 2:240950975-240950997 TGAGTAGGTGGATGGGTGGATGG - Intronic
948899911 2:240951003-240951025 TGAGGAGGTGAATGGGTGGATGG - Intronic
948899918 2:240951031-240951053 TGAGCAGGTGGATGGGTGGATGG - Intronic
948899932 2:240951087-240951109 TGAACAGGTGGATGGGTGGATGG - Intronic
948899976 2:240951311-240951333 TGAACAGGTGGATGGGTGGATGG - Intronic
1168928792 20:1604661-1604683 AGTAGAGCTGGATGAGTGGAGGG + Intronic
1168969587 20:1921771-1921793 AGTAGAGCTGGATGAGTGGAGGG - Intronic
1170557154 20:17524011-17524033 TGATGAGTTGTAGGCATGGAAGG + Intronic
1170896223 20:20417105-20417127 TTTTGAGAGGGATGCGTGGATGG - Intronic
1171018663 20:21564295-21564317 TGGGGAGCTGGATGGGTGGGAGG + Intergenic
1172184917 20:33025521-33025543 TGAGTAGGTGGATGCATGGATGG - Intergenic
1172194151 20:33080688-33080710 TGGTGAGCTGGATGTGTGGAAGG + Intronic
1172483402 20:35284834-35284856 AGAGGGGCTGGATGCGTGGCGGG - Exonic
1172578852 20:36030917-36030939 TGATAAGCTGGATGTGGGGGAGG + Intergenic
1173197802 20:40930286-40930308 TGAGGAGCTGTATGCCTGGATGG - Intergenic
1174550437 20:51357931-51357953 TGAGTAGATGGATGGGTGGATGG + Intergenic
1174550463 20:51358034-51358056 TGAGTAGATGGATGGGTGGATGG + Intergenic
1175277319 20:57781016-57781038 TGAATAGGTGGATGGGTGGATGG - Intergenic
1175301939 20:57949065-57949087 GGATGAGATGGATGGATGGATGG + Intergenic
1175301952 20:57949129-57949151 GGATGAGATGGATGGATGGATGG + Intergenic
1175551625 20:59821687-59821709 TGAAGAGATGGATGAGTGAATGG + Intronic
1176129765 20:63491791-63491813 TGAGGAGGTAGATGAGTGGATGG + Intronic
1179925181 21:44530231-44530253 GGATGAACAGGATGGGTGGATGG - Intronic
1179939581 21:44628926-44628948 TGCTGGGCTGGGTGGGTGGAGGG + Intronic
1180765037 22:18341285-18341307 TGGTGAGATGGATGGGTGAAAGG + Intergenic
1180813992 22:18778399-18778421 TGGTGAGATGGATGGGTGAAAGG - Intergenic
1181053557 22:20248875-20248897 TGCTGGGCTGCCTGCGTGGAGGG + Intronic
1181200177 22:21212734-21212756 TGGTGAGATGGATGGGTGAAAGG - Intronic
1181701560 22:24624225-24624247 TGGTGAGATGGATGGGTGAAAGG + Intronic
1183707101 22:39480846-39480868 TGAAGAGCTGGATGTGAGCAAGG - Intronic
1184275756 22:43408824-43408846 GGATGAGCTGGAGGCCTGGGTGG - Intergenic
1184460804 22:44636828-44636850 TGAACAGATGGATGGGTGGATGG + Intergenic
1184870973 22:47238332-47238354 TGACGAGGTGGATGAGAGGATGG - Intergenic
1184993084 22:48183635-48183657 TGATGATCTGGATGCCTGTGAGG - Intergenic
1185046188 22:48529759-48529781 TGATGGGTTGGGTGTGTGGACGG + Intronic
1185193395 22:49452909-49452931 TGATGATGTGAATGTGTGGATGG + Intronic
1203226659 22_KI270731v1_random:82190-82212 TGGTGAGATGGATGGGTGAAAGG + Intergenic
1203264091 22_KI270734v1_random:4086-4108 TGGTGAGATGGATGGGTGAAAGG - Intergenic
949170515 3:990771-990793 TGAATAGATGGATGCATGGATGG + Intergenic
950145900 3:10649600-10649622 GGATGAGATGGATGGGTGAATGG + Intronic
950173447 3:10854998-10855020 TGAGTAGATGGATGGGTGGATGG + Intronic
950340854 3:12242932-12242954 TGAAGAGATGGATGGATGGATGG - Intergenic
950474229 3:13205630-13205652 TGAAGAGATGGATGGATGGAGGG - Intergenic
950474352 3:13206097-13206119 TGGAGAGCTAGATGGGTGGATGG - Intergenic
952307682 3:32160348-32160370 GGATGAGATGGATGGATGGATGG + Intronic
954088524 3:48266313-48266335 TGATGATCAGGATGTCTGGATGG - Intronic
955410467 3:58652433-58652455 TGAGTAGATGGATGGGTGGATGG - Intronic
955410488 3:58652516-58652538 TGAGTAGATGGATGGGTGGATGG - Intronic
955826986 3:62957868-62957890 TGATGAGTTGGCTGAGTGGGTGG + Intergenic
961638889 3:128352439-128352461 TCACCAGCTGGATGCGGGGAGGG - Intronic
963761063 3:149287780-149287802 TGCAGAGCTGGAAGCGGGGATGG - Intergenic
965948473 3:174272640-174272662 TGATGATATGGATGGATGGATGG + Intronic
967993305 3:195147818-195147840 TGAGGAAGTGAATGCGTGGAAGG - Intronic
968733545 4:2283506-2283528 TGATTAGATGGATGGGTGGGTGG - Intronic
969304515 4:6318162-6318184 TGATCAGGTGGCTGTGTGGATGG + Intergenic
969474110 4:7411553-7411575 TGAAGAAATGGATGGGTGGATGG - Intronic
974428224 4:61766691-61766713 TGATGAGCTTGATGGGTGTCAGG + Intronic
974906102 4:68059345-68059367 TTATGTGCTGGATTCATGGAAGG - Exonic
975354181 4:73381123-73381145 TGAGGAGCTGGATCCGTTGAAGG + Intergenic
975357331 4:73423519-73423541 TGATGAGCTGGAGGAGTTGGAGG + Intergenic
976082168 4:81367896-81367918 TGATGAGCTGGAAATGTGGGTGG + Intergenic
976182301 4:82410377-82410399 TGATGTGCTGAATGTGTTGAGGG - Intergenic
977900840 4:102420585-102420607 TGAGGGGGTGGATGGGTGGATGG + Intronic
979295779 4:119031147-119031169 TGATGGGTTGGATGTGGGGAAGG - Exonic
981558754 4:146024165-146024187 TAATAACCTGGAGGCGTGGAGGG - Intergenic
984752292 4:183289503-183289525 TGATGAGCTGCAGGCGCTGAGGG + Exonic
985709240 5:1419030-1419052 GGATGGGATGGATGGGTGGATGG - Intronic
987375750 5:17232568-17232590 TAAAGGGCTGGATACGTGGAAGG + Intronic
989532213 5:42521123-42521145 TGATCAGCTGGATGCGTATATGG + Intronic
1000906005 5:166966417-166966439 TGATGAGATTGATTCGTTGATGG - Intergenic
1001713388 5:173795361-173795383 TGCTGTGCTGGGTGCCTGGAAGG - Intergenic
1003003554 6:2360028-2360050 TGATGAGCTGTGTGCTTGGAAGG + Intergenic
1003972620 6:11313505-11313527 TGAATAGATGGATGGGTGGATGG + Intronic
1006043907 6:31277472-31277494 TTATGAGTTGGAGGGGTGGAAGG - Intronic
1007251154 6:40496055-40496077 TGAGCATCTGGATGGGTGGATGG - Intronic
1007376932 6:41463303-41463325 TGAACAGATGGATGAGTGGATGG + Intergenic
1013283854 6:108663733-108663755 TGATGAGCTGGATGCGTGGACGG + Exonic
1015749760 6:136548895-136548917 TGATGAGCTAGACGCTGGGACGG - Intronic
1017762774 6:157583966-157583988 TGATGAGCAGGGTGGGTGGGTGG + Intronic
1018185333 6:161261623-161261645 TGATTAGCTGGATTTGTGGAAGG - Intronic
1019055046 6:169217968-169217990 GGATGAAATGGATGGGTGGATGG + Intronic
1019055052 6:169217989-169218011 GGATGAGATGGGTGGGTGGATGG + Intronic
1019055064 6:169218035-169218057 GGATGAGATGGATGGATGGATGG + Intronic
1019055093 6:169218131-169218153 GGATGAGATGGATGGATGGATGG + Intronic
1019055106 6:169218193-169218215 GGATGAGATGAATGGGTGGATGG + Intronic
1019055111 6:169218217-169218239 TGATGAGATGGTTGGGTGGCTGG + Intronic
1019055154 6:169218418-169218440 GGATGAGATGGATGAGTGGGTGG + Intronic
1019055172 6:169218483-169218505 GGATGAAATGGATGGGTGGATGG + Intronic
1019055180 6:169218512-169218534 GGATGAGATGGATGGGTGGGTGG + Intronic
1019055249 6:169218795-169218817 GGATGAGATGGATGAGTGCATGG + Intronic
1019055301 6:169219047-169219069 GGATGAGATGGATGGATGGATGG + Intronic
1019134147 6:169897791-169897813 AGGTGAGCTGGATGGGTGGGAGG - Intergenic
1019175744 6:170158534-170158556 TGAGAAGCTGGAAGCGTGGAGGG + Intergenic
1019913200 7:4114168-4114190 CGAGGAGCTGGAGGAGTGGATGG + Exonic
1022219226 7:28295645-28295667 TAAAGAGGTGGATGCATGGATGG + Intergenic
1024952760 7:54881939-54881961 TGGTGAGTTGGATGCATGGTTGG + Intergenic
1026308124 7:69160222-69160244 TGATGGGCTTGATGCATGGAGGG - Intergenic
1031040571 7:116834584-116834606 TCATTAGCTGGATGGATGGAGGG + Intronic
1031880016 7:127187078-127187100 TGAGGAGATGGATGCATTGAAGG - Intronic
1031998744 7:128250468-128250490 TGAGGAGCTGGAGGGGTGGGTGG + Intronic
1032500086 7:132393493-132393515 TGATGAGCTTGTTGGGAGGAAGG - Intronic
1033239229 7:139663415-139663437 TGATGAGCTGGAGGCCTCGTGGG + Intronic
1034007118 7:147485013-147485035 TGATGGGAGGGATGAGTGGATGG + Intronic
1034112286 7:148548592-148548614 TGATTAGTTGCATGAGTGGAGGG - Intergenic
1036762010 8:11515741-11515763 TGCTGCGCTGCATGCGGGGATGG + Intronic
1036897592 8:12648366-12648388 TGGGGAGCTGGATGACTGGATGG + Intergenic
1038440917 8:27570209-27570231 TGAAGGGATGGATGCATGGATGG + Intergenic
1038486746 8:27940790-27940812 TGATGATTTGGATGGATGGATGG - Intronic
1039075852 8:33689834-33689856 TGGGGAGCTGGAAGCGGGGATGG - Intergenic
1039407790 8:37327832-37327854 GCATGAGCTGGAGGCATGGAGGG + Intergenic
1042174722 8:66027760-66027782 AGATAAGCTTGATGCGGGGAGGG - Intronic
1042777518 8:72450201-72450223 TGATTAGCTGGAACCTTGGATGG - Intergenic
1043072294 8:75653753-75653775 TGAGGAGATGGATGAATGGAGGG + Intergenic
1045045642 8:98274289-98274311 AGATGGGATGGATGGGTGGATGG - Intronic
1047154738 8:122304087-122304109 TGTTGAGGTGGATGGATGGATGG + Intergenic
1049175044 8:141187103-141187125 TGATGGGGTGGCTGCTTGGAGGG - Intronic
1049713860 8:144080341-144080363 TGCTCAGCTGGCTTCGTGGACGG + Exonic
1051427455 9:16947483-16947505 TGATCAGATGGATGTGTGGGTGG - Intergenic
1051447821 9:17159737-17159759 TGTTGAGCTGGAAAGGTGGAAGG + Intronic
1052564884 9:30136817-30136839 TGATCAACTGGATGCAGGGATGG + Intergenic
1057172583 9:92971993-92972015 AGATCAGCTGGGTGCCTGGAAGG - Intronic
1058418888 9:104816588-104816610 TGGACAGCTGGATGGGTGGATGG + Intronic
1060748476 9:126153527-126153549 GGATGAACTGGATGGATGGATGG - Intergenic
1061080575 9:128367371-128367393 TGATGAGCTGGAGGACTGGGGGG + Intergenic
1061256655 9:129457389-129457411 TGAGTAGATGGGTGCGTGGATGG + Intergenic
1061431741 9:130535656-130535678 TGAGCAGCTGGAGGCGGGGATGG + Intergenic
1061594215 9:131618557-131618579 AGATGAGATGGATGAGTAGATGG - Intronic
1062149793 9:135011874-135011896 TGATGATGTGCATGGGTGGAGGG - Intergenic
1062211939 9:135369657-135369679 TGATGTGCTGGGTGCCTGGTAGG - Intergenic
1062217039 9:135394826-135394848 TGCTTAGATGGATGGGTGGATGG + Intergenic
1185495201 X:549478-549500 TGAGTAGATGGATGGGTGGATGG - Intergenic
1185497411 X:565958-565980 TGGATAGCTGGATGAGTGGATGG + Intergenic
1185497442 X:566101-566123 TGGATAGCTGGATGGGTGGATGG + Intergenic
1185613208 X:1404269-1404291 GGATGAGATGGATGGATGGATGG + Intronic
1186523793 X:10229098-10229120 TGGAGGGCTGGATGGGTGGAAGG + Intronic
1197085487 X:122468930-122468952 AAATGAGCTGGAAGCCTGGAGGG - Intergenic
1200403720 Y:2787028-2787050 CGGTGAGCTGGCTGCGTTGATGG + Exonic