ID: 1144909814

View in Genome Browser
Species Human (GRCh38)
Location 17:18672021-18672043
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144909811_1144909814 -7 Left 1144909811 17:18672005-18672027 CCGTCCACGCATCCAGCTCATCA 0: 2
1: 0
2: 2
3: 11
4: 272
Right 1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG 0: 2
1: 0
2: 0
3: 4
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900131765 1:1090237-1090259 CTCATCTGTGCTGCGGGACCTGG - Intronic
902756987 1:18555582-18555604 CTCATGACTGCTGCTTGTCTTGG - Intergenic
909486254 1:76177855-76177877 TTCATCACTCTTGAGTGACGGGG + Intronic
915261059 1:154677345-154677367 CTCCTCACTGCTGCGAAAGGAGG + Intergenic
915862575 1:159461728-159461750 CTCATTACTGCTGGGTGGAGTGG + Intergenic
923025587 1:230201342-230201364 CTCATCACAGCTGGTTGCCGTGG - Intronic
1067431120 10:46246771-46246793 CTCTTCACTGCAGAGTGAAGAGG - Intergenic
1067442287 10:46315456-46315478 CTCTTCACTGCAGAGTGAAGAGG + Intronic
1069869913 10:71526840-71526862 CCCATCTCTGCTCTGTGACGTGG - Intronic
1073094857 10:100973172-100973194 CTCAACACTGCTGCTGGAGGAGG + Exonic
1075004188 10:118818704-118818726 CTCCTCACTGCTCCGTGCCCAGG + Intergenic
1078119351 11:8490537-8490559 CTCTTCACAGCTGTGAGACGGGG - Intronic
1089787426 11:120918057-120918079 CTCATCTCTGCTGTGTGGCTGGG - Intronic
1101880613 12:108623191-108623213 CTCATCCCTGTTGCCTGATGGGG - Exonic
1104662444 12:130620891-130620913 CTCACCACTGCTGGGTGGGGTGG - Intronic
1104877246 12:132044168-132044190 GTCATCACTGCGTCCTGACGGGG - Exonic
1106453033 13:29901437-29901459 CTCATCAGTTCTGTGTGATGTGG - Intergenic
1111963208 13:94834023-94834045 CTCATCTCTGCTGATTGAAGAGG - Intergenic
1115116465 14:29886074-29886096 CGTATCACTGCTACGTGAAGGGG - Intronic
1121321232 14:92992790-92992812 CACCTGAATGCTGCGTGACGTGG + Intronic
1122711921 14:103664961-103664983 CACATCACTGCTGGGTGCTGGGG + Intronic
1129753263 15:78080617-78080639 CTCATCTGTGCTGGGTGACCAGG - Intronic
1139480517 16:67227984-67228006 CTCAGCCCTGCTTGGTGACGAGG + Intronic
1141665996 16:85465399-85465421 TTCATTACTGCTGTGTGACTTGG + Intergenic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1145804938 17:27719954-27719976 CTCATCACTGCTGAGAAAGGAGG + Intergenic
1147941898 17:44054682-44054704 CCCATCACTGCTGAGTGGCAGGG - Intronic
1149595526 17:57862541-57862563 CCCATCCCTGCTGGGTGACCGGG + Exonic
1150009023 17:61487854-61487876 CTTATCACAGCAGCCTGACGGGG + Intergenic
1156397152 18:36708741-36708763 CACATCACTGCTGCTTGACAGGG - Intronic
1158525916 18:58213624-58213646 CTCATCACTGGTGAGTGACTTGG - Intronic
1163215125 19:15871025-15871047 CTCAGCTCTGCTGTGTGACTTGG - Intergenic
1163228294 19:15980174-15980196 CTCAGCTCTGCTGTGTGACTTGG - Intergenic
1166420355 19:42631704-42631726 CTCATGACTTCTGGGTGTCGGGG - Intronic
1166567177 19:43772328-43772350 CTCCTCTCTGCTGTGTGACCTGG + Intronic
1166859063 19:45799253-45799275 CTCTGCCCTGCTGCGTGACAGGG - Intronic
926305184 2:11633003-11633025 CTGATGACTCCTGCGTGATGTGG + Exonic
926747055 2:16167520-16167542 CCAAGCACTGCTGGGTGACGAGG + Intergenic
933426850 2:82124822-82124844 GTCAGCACTGCTGCCAGACGGGG + Intergenic
936802819 2:116287731-116287753 CTCCTCACTGCTGAGAGAGGAGG + Intergenic
946542399 2:220699006-220699028 CTCATCAGTGCTGTGTCAGGAGG - Intergenic
947170013 2:227301379-227301401 CTCATCAGTGATGCGTAATGAGG + Intronic
947354781 2:229280696-229280718 CTCATCAATGCACCGTGACCTGG - Intergenic
948111016 2:235456024-235456046 CTTATCACTGCTGTTTCACGTGG - Intergenic
1173351384 20:42248618-42248640 CTCAACACTGCTGTGTGGCCAGG - Intronic
1173620577 20:44432740-44432762 CCCATCACTGCCGCCTGATGGGG + Exonic
1174450413 20:50616702-50616724 CTCTTCTCTGCTGTGTGACCGGG - Intronic
1176081532 20:63275832-63275854 CTCATCAGTGCTGGCTGTCGGGG + Intronic
1176369131 21:6052048-6052070 CTCATGTCTGCTGGGTGACTTGG + Intergenic
1179754388 21:43486493-43486515 CTCATGTCTGCTGGGTGACTTGG - Intergenic
1184694701 22:46132953-46132975 CTCCTCACTCCTGTGCGACGTGG + Intergenic
951610162 3:24482663-24482685 CTCTTCCCTGCTCCGTGACAGGG + Intronic
966872446 3:184299601-184299623 CTCACCACCGCCGCGTGAAGTGG + Intronic
967448938 3:189600203-189600225 CTCATCACTGTTGGGAGAGGGGG + Intergenic
969671941 4:8594472-8594494 CTCAACTCTGCTGTGTGACCTGG + Intronic
977640686 4:99355195-99355217 CTCATCACTGCTGAGAAAGGAGG + Intergenic
977779862 4:100968545-100968567 CTCATCAGTGCTACTTGACAGGG - Intergenic
985127803 4:186712785-186712807 GTCATCACAGCTGGGTGATGAGG - Intronic
986049988 5:4081151-4081173 CTCATAACTGCTGGGCGTCGAGG + Intergenic
986923794 5:12720740-12720762 CTCTTAACTGCTGTGTGACATGG + Intergenic
1001304292 5:170560533-170560555 CACAACACTGCTGTGTGACAGGG - Intronic
1003806053 6:9727085-9727107 CTCCTCACTGCTGAGTAAGGAGG + Intronic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1018747123 6:166771244-166771266 CTCGTCACTGATGCGTGGCTTGG - Intronic
1019515285 7:1437272-1437294 CTCACAACAGCTGCGTGAGGTGG + Intronic
1019614662 7:1953813-1953835 CCCATCACTGCTGGGTGACACGG + Intronic
1019626763 7:2019740-2019762 CTCAGCACTGTGGCGTGGCGAGG - Intronic
1020577176 7:9947706-9947728 TTCATCACTGCTGAGTAAAGTGG + Intergenic
1031743845 7:125468638-125468660 CTCCTGACTGCTCCGTGAAGTGG + Intergenic
1033715876 7:144001743-144001765 CTCATAATTGCTGCGTGAGTGGG - Intergenic
1033851540 7:145502238-145502260 CTCATTACTGCTGCGGGAGGGGG + Intergenic
1035557521 8:577988-578010 CTCACCCCTGCTGCATGAGGTGG - Intergenic
1036807862 8:11847600-11847622 CTCTTCGCTGCAGCGTGAGGAGG + Intronic
1039998989 8:42560720-42560742 CTCTTCACTGCTGAGAGAGGAGG - Intergenic
1049776230 8:144406664-144406686 CTCTGCACTGCTGCCTGATGTGG + Intronic
1056366421 9:85909441-85909463 CTCACCACTGCTGCTAGAGGAGG - Intergenic
1060782529 9:126423402-126423424 CTCATCAAAGCTGCGGGGCGAGG - Intronic
1060826987 9:126693257-126693279 CTCTTCGCTGCTGCGTGGTGAGG - Exonic
1192218385 X:69179786-69179808 CTCACCTCTGCTGAGTGGCGTGG + Intergenic
1201311359 Y:12600786-12600808 CTCCTCACTGCTGAGAGAGGAGG - Intergenic
1202074374 Y:21023524-21023546 CTCCTCACTGCTGAGAAACGAGG - Intergenic