ID: 1144909814 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:18672021-18672043 |
| Sequence | CTCATCACTGCTGCGTGACG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 81 | |||
| Summary | {0: 2, 1: 0, 2: 0, 3: 4, 4: 75} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1144909811_1144909814 | -7 | Left | 1144909811 | 17:18672005-18672027 | CCGTCCACGCATCCAGCTCATCA | 0: 2 1: 0 2: 2 3: 11 4: 272 |
||
| Right | 1144909814 | 17:18672021-18672043 | CTCATCACTGCTGCGTGACGTGG | 0: 2 1: 0 2: 0 3: 4 4: 75 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1144909814 | Original CRISPR | CTCATCACTGCTGCGTGACG TGG | Intronic | ||