ID: 1144909814

View in Genome Browser
Species Human (GRCh38)
Location 17:18672021-18672043
Sequence CTCATCACTGCTGCGTGACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144909811_1144909814 -7 Left 1144909811 17:18672005-18672027 CCGTCCACGCATCCAGCTCATCA 0: 2
1: 0
2: 2
3: 11
4: 272
Right 1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG 0: 2
1: 0
2: 0
3: 4
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144909814 Original CRISPR CTCATCACTGCTGCGTGACG TGG Intronic