ID: 1144911054

View in Genome Browser
Species Human (GRCh38)
Location 17:18682090-18682112
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 2, 1: 0, 2: 0, 3: 0, 4: 52}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144911054_1144911059 -1 Left 1144911054 17:18682090-18682112 CCCTCGAGGCCCCTTTAACAAAC 0: 2
1: 0
2: 0
3: 0
4: 52
Right 1144911059 17:18682112-18682134 CGCGCACTCTAGCCCCGACTCGG 0: 2
1: 0
2: 0
3: 2
4: 28
1144911054_1144911064 15 Left 1144911054 17:18682090-18682112 CCCTCGAGGCCCCTTTAACAAAC 0: 2
1: 0
2: 0
3: 0
4: 52
Right 1144911064 17:18682128-18682150 GACTCGGCACAGAACGACCCGGG 0: 2
1: 0
2: 0
3: 2
4: 44
1144911054_1144911066 30 Left 1144911054 17:18682090-18682112 CCCTCGAGGCCCCTTTAACAAAC 0: 2
1: 0
2: 0
3: 0
4: 52
Right 1144911066 17:18682143-18682165 GACCCGGGGAACTACCGCCGAGG 0: 1
1: 1
2: 0
3: 0
4: 21
1144911054_1144911063 14 Left 1144911054 17:18682090-18682112 CCCTCGAGGCCCCTTTAACAAAC 0: 2
1: 0
2: 0
3: 0
4: 52
Right 1144911063 17:18682127-18682149 CGACTCGGCACAGAACGACCCGG 0: 2
1: 0
2: 0
3: 1
4: 18
1144911054_1144911065 16 Left 1144911054 17:18682090-18682112 CCCTCGAGGCCCCTTTAACAAAC 0: 2
1: 0
2: 0
3: 0
4: 52
Right 1144911065 17:18682129-18682151 ACTCGGCACAGAACGACCCGGGG 0: 2
1: 0
2: 0
3: 0
4: 10

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144911054 Original CRISPR GTTTGTTAAAGGGGCCTCGA GGG (reversed) Intronic
911749759 1:101482621-101482643 GTCTTTTAAAGGGGGCTGGAGGG - Intergenic
918480495 1:184973116-184973138 GTTTGTTAAAGGGGAAAAGACGG - Intronic
922961812 1:229653647-229653669 GTTTGTTAAGAGGCCCTGGACGG + Intronic
1069800012 10:71076191-71076213 GTCTGCAAAATGGGCCTCGAAGG + Intergenic
1071148687 10:82606962-82606984 GGTTTTTTAAGGGGCCTAGATGG - Intronic
1078464508 11:11540268-11540290 CTTTGTTGAAGGGCCCTGGAAGG + Intronic
1078892930 11:15573587-15573609 GTTTGTGAAAAGGGCCTCATGGG + Intergenic
1087685090 11:101253434-101253456 GTTAGTTAAAGGGTACTGGAAGG + Intergenic
1089639795 11:119840075-119840097 GTCTGTAAAAGGGCCCTTGAGGG - Intergenic
1098605595 12:72386226-72386248 GTATTTTAAAGAGGCCTCCAAGG + Intronic
1101418112 12:104526578-104526600 GCTTGTTAGAGGGGGCTTGATGG + Intronic
1106269262 13:28138394-28138416 TTTTCTTAAAGGGGCCGCGCGGG - Intergenic
1106438164 13:29742052-29742074 GTTTGTTAAAGTAGCATCCATGG + Intergenic
1117243758 14:53862613-53862635 GTGTGTTTAAGGGGCCTCCTTGG + Intergenic
1117299883 14:54414313-54414335 GTTAGTTATAGGTTCCTCGAAGG - Intronic
1138088036 16:54151780-54151802 GTTTCTCAAAGTGGGCTCGAAGG - Intergenic
1140567122 16:76056569-76056591 GTTTGTTAAATATGCCTTGAGGG + Intergenic
1144489908 17:15699869-15699891 GTTTGTTAAAGGGGCCTCGAGGG + Exonic
1144911054 17:18682090-18682112 GTTTGTTAAAGGGGCCTCGAGGG - Intronic
1149339230 17:55668909-55668931 GTCTGTTTAAGGGGCTTAGAGGG + Intergenic
1153060699 18:991901-991923 GTTTGTTAATGTGTCCTCTAGGG + Intergenic
1155515087 18:26616414-26616436 GTGTCTTAGATGGGCCTCGAGGG - Intronic
1158545713 18:58394738-58394760 GGTTGTTAAACGGCCCTCTACGG + Intronic
1163712363 19:18854316-18854338 GTCTCTGAAAGGGGCCTAGATGG + Intronic
1163783581 19:19262876-19262898 GTGTATTAAAGGGGCCGCGGGGG + Intergenic
1168025940 19:53643629-53643651 GCATGTTAAAGGTGCCTCAAGGG + Intergenic
929811232 2:45190749-45190771 CTTTGATGAAGGGGCCTCGCAGG + Intergenic
933975089 2:87503096-87503118 GTTTATTAAAAGTGCCTGGAAGG + Intergenic
935242861 2:101193360-101193382 ATTTGATAAAGGGGCCACGTAGG - Intronic
936318737 2:111447718-111447740 GTTTATTAAAAGTGCCTGGAAGG - Intergenic
938824877 2:134994747-134994769 GCTTGTTGAATGGGCCTCAAAGG - Intronic
946298355 2:218805066-218805088 ATTTGTTGATGGGGCCTCTAAGG - Intronic
1179151452 21:38812341-38812363 GTTTGGTAAAGGGGTCTCTGAGG + Intronic
950828069 3:15846454-15846476 GTTTGTGAAAGCAGCCTCGGGGG - Intronic
954822927 3:53347317-53347339 GTCTCTTAAAGGGGCCGCGCGGG - Intronic
959159264 3:102704071-102704093 GTTTGTTATAGAAGCCTCAATGG + Intergenic
967717668 3:192781605-192781627 GTTTCTGAAAGGGACCTCAATGG + Intergenic
981790252 4:148528148-148528170 GTTTCTTAATGGTGCCTGGAGGG + Intergenic
983129446 4:163997239-163997261 GTTGGTTACAGGGGGCTTGAAGG + Intronic
986163317 5:5250767-5250789 GTGTTTTAAAGGGGCTTCTAAGG + Intronic
990152931 5:52840842-52840864 GTTTGTTAAATGGGACAGGATGG - Intronic
990371102 5:55119229-55119251 GAATGTTAAAGGGGGCTCAAGGG - Intronic
992187812 5:74260834-74260856 GTTTCTTAGAGGGTCCTCGTGGG - Intergenic
1003382836 6:5640466-5640488 GTCTGTTATAGGGACCTAGAAGG - Intronic
1010915073 6:81605889-81605911 ATTTCTTAAAGTGGCCTCAAGGG - Intronic
1014121973 6:117736332-117736354 TTTTGTTATAGCAGCCTCGATGG + Intergenic
1015758022 6:136627810-136627832 TTTTGTTATAGCGGCCTGGATGG + Intronic
1045320509 8:101078634-101078656 GTTTATTAAAGGAGTCTCAATGG + Intergenic
1048209560 8:132443448-132443470 GTTTTAAAAAGGGGCCTGGATGG + Intronic
1055939685 9:81637555-81637577 GTTTGTTCAGGGGACCTAGAAGG - Intronic
1186461348 X:9750903-9750925 GTTTGTTATAGCAGCCTGGACGG + Intronic
1189709857 X:43798239-43798261 TTTTGTTAAAGGGGACACTATGG - Intronic
1192049390 X:67709902-67709924 GTTTTTAAAAGTGGCCTTGAAGG - Intronic
1198024607 X:132692940-132692962 GTTTGTTGAATGAGCCTGGATGG + Intronic