ID: 1144913025

View in Genome Browser
Species Human (GRCh38)
Location 17:18698629-18698651
Sequence CACAACCACCACTTAAAAGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144913025_1144913029 18 Left 1144913025 17:18698629-18698651 CCTACTTTTAAGTGGTGGTTGTG 0: 1
1: 1
2: 0
3: 12
4: 164
Right 1144913029 17:18698670-18698692 GACATGCAACAGTTGACACAGGG 0: 2
1: 0
2: 1
3: 5
4: 110
1144913025_1144913028 17 Left 1144913025 17:18698629-18698651 CCTACTTTTAAGTGGTGGTTGTG 0: 1
1: 1
2: 0
3: 12
4: 164
Right 1144913028 17:18698669-18698691 TGACATGCAACAGTTGACACAGG 0: 2
1: 0
2: 1
3: 9
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144913025 Original CRISPR CACAACCACCACTTAAAAGT AGG (reversed) Exonic
902450602 1:16494515-16494537 CACAAGAACCACTTGAAACTGGG + Intergenic
904644830 1:31957860-31957882 CACAGGCACAGCTTAAAAGTGGG - Intergenic
908416126 1:63915063-63915085 CACAACAACCATTTGAAGGTAGG + Intronic
908522155 1:64954714-64954736 CAGAACCATCAATTAAAAGAAGG + Intronic
908909000 1:69050596-69050618 CAAAACCAGCATTTAAAAATAGG - Intergenic
909305009 1:74062824-74062846 CACACCCACCACCTTCAAGTAGG - Intronic
910359725 1:86403675-86403697 GAGAGCCACCACTGAAAAGTTGG + Intergenic
912244923 1:107951632-107951654 CACAAACACCATTAAAAAGTGGG + Intronic
912604211 1:110971859-110971881 CATAACTCCCACTTAAAAGTGGG - Intergenic
913397728 1:118390641-118390663 CACTATCACCACTAAAAAGAGGG + Intergenic
916861354 1:168809198-168809220 CAGAGCCAACACTTAAAATTGGG - Intergenic
917695043 1:177513703-177513725 CACCATCACCAGTTGAAAGTTGG + Intergenic
920637109 1:207714284-207714306 CAAAGCCACCACTCAAAGGTGGG + Intronic
924245276 1:242077774-242077796 AACCACCACCATTAAAAAGTAGG - Intergenic
924312317 1:242756920-242756942 AACAACAACAACATAAAAGTGGG + Intergenic
1063338605 10:5241755-5241777 CACAACCAACACTTCAAAAATGG + Intergenic
1065711524 10:28522620-28522642 CAAAGCCATCACTGAAAAGTTGG + Intergenic
1072022050 10:91411309-91411331 CACAACCACCAGTAAAAATAGGG - Intronic
1072199322 10:93144509-93144531 CAAAAACACCACTCAAAGGTGGG - Intergenic
1073931743 10:108584682-108584704 CAAAAGCACCACTCAAAGGTGGG - Intergenic
1075475369 10:122729386-122729408 CCCAACCCCCACTTAAGTGTTGG - Intergenic
1078240367 11:9525774-9525796 CACAGCCCCCATTTTAAAGTGGG + Intronic
1079670084 11:23158370-23158392 AATAACCACCACTTATATGTGGG + Intergenic
1082680284 11:56159568-56159590 CACAACCACCACTGTCAAATGGG + Exonic
1083106239 11:60361061-60361083 CAAAGACACCACTCAAAAGTGGG + Intronic
1087285190 11:96257675-96257697 CACAAGGACAACTTAAAACTTGG + Intronic
1088150750 11:106742201-106742223 CACATCCTGCACATAAAAGTTGG - Intronic
1090526090 11:127538826-127538848 TAGAACTATCACTTAAAAGTTGG + Intergenic
1091939485 12:4464746-4464768 CAACACCACCACAAAAAAGTTGG + Intergenic
1091982510 12:4877728-4877750 GACAACTACCACTGAAAAGGTGG - Intergenic
1092010127 12:5102856-5102878 GACATCCACCTATTAAAAGTAGG + Intergenic
1092837587 12:12505515-12505537 CATGACCACCATTTACAAGTTGG + Intronic
1093046447 12:14451336-14451358 CAAAAACAAAACTTAAAAGTTGG - Intronic
1096334690 12:50744604-50744626 CACAACCACCACAAGCAAGTTGG - Exonic
1097750052 12:63342168-63342190 AACAACCACCATCAAAAAGTGGG + Intergenic
1098084867 12:66831554-66831576 CACAAGCAACACTTCAAAGCCGG + Intergenic
1101049084 12:100842284-100842306 CAAAACAACCACATAAAAGATGG - Intronic
1101487364 12:105178722-105178744 CATAACCACCTCTTGGAAGTGGG - Intronic
1103262402 12:119598800-119598822 CACAACCCCCATTTACAAGGTGG - Intronic
1104831263 12:131753346-131753368 CACAACCACCACCACAAGGTAGG + Exonic
1109492870 13:63126587-63126609 CAAAGGCACCACTCAAAAGTGGG - Intergenic
1109510680 13:63368040-63368062 CAAAAGCACCACTGAAAGGTGGG + Intergenic
1110057102 13:70986894-70986916 CAAAGGCACCACTTAAAGGTGGG - Intergenic
1111310005 13:86472143-86472165 CAAAGCCACCACTCAAAGGTGGG + Intergenic
1111997258 13:95176998-95177020 CAGAAACACCACGTAAGAGTTGG + Intronic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112829060 13:103426366-103426388 CAAACCAACTACTTAAAAGTTGG + Intergenic
1113478650 13:110604076-110604098 CACAACCAACACTTCAAAAGTGG - Intergenic
1113557012 13:111245048-111245070 CACAACCAACACTTCAAAAGTGG - Intronic
1118928958 14:70222133-70222155 CACATCCATCACTGAAAACTGGG + Intergenic
1118964965 14:70572752-70572774 AAAAACCACCATTGAAAAGTAGG + Intergenic
1119221227 14:72909362-72909384 AACAGCCTCCACTTAAAACTAGG + Intergenic
1120614784 14:86690001-86690023 CAGAACTACCTGTTAAAAGTAGG - Intergenic
1123814434 15:23962275-23962297 TACAACACACACTTAAAAGTGGG + Intergenic
1129051105 15:72782707-72782729 TATAACCACCACATAAAAGCAGG - Intronic
1130167603 15:81479544-81479566 GACAACCACAAATCAAAAGTGGG + Intergenic
1132047185 15:98574053-98574075 CAGAACCACCAAGCAAAAGTAGG - Intergenic
1133737039 16:8623769-8623791 CACAGCAACCACTTAAATGTAGG + Intronic
1133898013 16:9947816-9947838 CACAACAACCTCTTTAAGGTAGG - Intronic
1135613015 16:23885040-23885062 CACAATAACTACTTAAAAGTAGG - Intronic
1135891359 16:26360287-26360309 CACAACCACCCGTTAAAAGAAGG + Intergenic
1137881362 16:52051869-52051891 CACAAACAGCACTTAAAATCTGG + Intronic
1139088085 16:63613281-63613303 CACAACCTCCACTCATAAGATGG - Intergenic
1139501139 16:67366816-67366838 CACCACCACCAATAAAATGTGGG - Intronic
1140300135 16:73749351-73749373 CACCACCACCACTTCCAGGTAGG + Intergenic
1141597005 16:85103519-85103541 CAGAAGCACAGCTTAAAAGTGGG - Intronic
1142578358 17:924535-924557 CACAACAACAAATTAAAAATCGG - Intronic
1144187053 17:12806526-12806548 CACAACCATGTCTTATAAGTAGG - Intronic
1144299120 17:13906633-13906655 CACAAACACTTCTTAAAGGTAGG - Intergenic
1144487995 17:15683660-15683682 CACAACCACCACTTAATAGTAGG + Intronic
1144913025 17:18698629-18698651 CACAACCACCACTTAAAAGTAGG - Exonic
1145824940 17:27869812-27869834 CAAAAACACCACTCAAAGGTGGG - Intronic
1146889924 17:36500189-36500211 CACAAACACACCTTAAAAGGAGG + Intronic
1152455571 17:80414325-80414347 CCCAACCACCGGTTTAAAGTCGG + Intergenic
1153764881 18:8365845-8365867 CAAAACAATCACTTAATAGTCGG + Intronic
1155857766 18:30855112-30855134 CACAAGCAATACTTTAAAGTAGG - Intergenic
1155877858 18:31108886-31108908 CACAATCACCAAATAAAAGGAGG + Intergenic
1156615242 18:38775405-38775427 TACAATGACAACTTAAAAGTTGG - Intergenic
1158721243 18:59926871-59926893 CAAATCCACCACTTAATAGCTGG + Intergenic
1159485165 18:69046425-69046447 AACAAACACCATTAAAAAGTGGG - Intronic
1166181560 19:41112775-41112797 TACACCCTCCCCTTAAAAGTAGG + Intergenic
925074397 2:1002407-1002429 AAAAGCAACCACTTAAAAGTAGG + Intronic
926001433 2:9336452-9336474 CACAACCAACACTCAAAAAGAGG - Intronic
929132856 2:38595532-38595554 CACAGTCATCACTTAAAAGCTGG + Intronic
929422321 2:41805528-41805550 AACAACCCCCATTAAAAAGTAGG + Intergenic
930749484 2:54919294-54919316 CAGAAACTACACTTAAAAGTTGG + Intronic
932444709 2:71771198-71771220 CACAACCACCATTGAAAAGATGG + Intergenic
933524765 2:83422073-83422095 CAACACCACCATTAAAAAGTGGG + Intergenic
935541793 2:104356957-104356979 CACAACCAACGCTTCAAATTTGG + Intergenic
940569837 2:155417170-155417192 CAAAAGCACCACTCAAAGGTGGG + Intergenic
941418908 2:165257962-165257984 CAAAACCACCATTAAAATGTGGG - Intronic
941662954 2:168214267-168214289 CACAAGGTCCACTAAAAAGTGGG + Intronic
943592644 2:189817411-189817433 CACCACTACCACATAAAATTAGG - Intronic
944163870 2:196696103-196696125 CACAGCCAAAACTCAAAAGTAGG - Intronic
1170344163 20:15364799-15364821 CACAACCTCCACTTCATAGAAGG - Intronic
1170975612 20:21161162-21161184 GACAAACAGCCCTTAAAAGTGGG - Intronic
1172040794 20:32043932-32043954 AAAATCCACAACTTAAAAGTGGG - Intergenic
1172696019 20:36823473-36823495 CACAAACACCTCTGAGAAGTAGG + Intronic
1172937674 20:38632054-38632076 CACAACAATCACTTGAACGTCGG - Intronic
1177228567 21:18289092-18289114 CATAATTACCACTTAAAATTTGG - Intronic
1177308844 21:19359375-19359397 CACACTCACCACATCAAAGTCGG - Intergenic
1177900897 21:26913942-26913964 CAAAAACACCACTCAAAGGTGGG - Intergenic
1178445619 21:32638950-32638972 CACAACCACCACCTCGAAGCAGG - Exonic
1178467410 21:32860363-32860385 CAAAAGCACCACTCAAAGGTGGG + Intergenic
1179472049 21:41617502-41617524 AACAACCATCACTCAAAAGAGGG - Intergenic
1180743638 22:18071812-18071834 CAGATGCAACACTTAAAAGTCGG - Intergenic
1181178186 22:21049518-21049540 CCCAGCCACCTCTTTAAAGTAGG - Intronic
1182530528 22:30952442-30952464 CACAATCATCACTTAACAGTGGG + Intronic
949170609 3:991747-991769 CACAACCACCTTTTTAAAGTAGG - Intergenic
958577222 3:95966568-95966590 CAAAAACATCACTTAAAAGCAGG + Intergenic
958955909 3:100465938-100465960 CAAAGACACCACTTAAAAATGGG - Intergenic
960711058 3:120528373-120528395 AACAACCACCACAACAAAGTAGG - Intergenic
960959584 3:123060539-123060561 CACACACACCATTTAAAAATAGG - Intergenic
964621064 3:158720560-158720582 GACAGCCACCACCTAAAACTAGG - Intronic
964778660 3:160310577-160310599 CACAACCCCCAATGAAAAATAGG + Intronic
965686497 3:171308716-171308738 AAACACCACCACTTAAAAGTGGG + Intronic
966770003 3:183495274-183495296 CACCACCACCAACAAAAAGTGGG - Intronic
968704259 4:2070726-2070748 CACAGCCGCCACTTGAAAGAGGG + Intergenic
971639168 4:29106814-29106836 CAAATCCACCACTAAAAATTTGG - Intergenic
973279018 4:48341007-48341029 GACAATCTCCAATTAAAAGTCGG + Intergenic
974305391 4:60131363-60131385 AATAACCACCACTTCAAAGATGG + Intergenic
975026801 4:69559116-69559138 CACCACCACCAGTTTACAGTGGG - Intergenic
975985161 4:80196268-80196290 CACCACCACTACTTTGAAGTGGG - Intronic
978879776 4:113687697-113687719 CCCAACCACCAGTTGAAAATGGG + Intronic
982425131 4:155249250-155249272 CACAGCCACCACTCACAATTAGG + Intergenic
985756504 5:1722460-1722482 CAAAACCAGGACATAAAAGTTGG - Intergenic
986152635 5:5140871-5140893 CACAACAGCATCTTAAAAGTAGG - Intronic
989585428 5:43070917-43070939 CAAAAGCACCACTCAAAGGTGGG - Intronic
993341943 5:86735625-86735647 CCCAAATACCACTTATAAGTGGG + Intergenic
993405202 5:87503186-87503208 GATAACCACCAGTTATAAGTGGG + Intergenic
993570940 5:89538165-89538187 CACAACAATCATTTAAAAGTTGG - Intergenic
994619043 5:102141092-102141114 AACAAACACCATTAAAAAGTGGG - Intergenic
994879654 5:105472986-105473008 CAAAACATCCACTTAAAAGCGGG - Intergenic
996854023 5:127984535-127984557 CCCAAACCCTACTTAAAAGTAGG + Intergenic
1000748797 5:165069162-165069184 AACAACCCCCATTAAAAAGTGGG - Intergenic
1000824205 5:166023963-166023985 CACAGCCACCACTTAAGTTTAGG - Intergenic
1002185533 5:177453121-177453143 CACAACCACCACAGACAAGGTGG + Intronic
1002717533 5:181237292-181237314 CATAACCACCACTTACAAGCTGG - Intronic
1003935535 6:10971582-10971604 GACAACCACCTCTTGATAGTTGG + Intronic
1006451865 6:34110024-34110046 CACAACCGCCACTTAAACCATGG + Intronic
1006557803 6:34883741-34883763 TTCAAACCCCACTTAAAAGTAGG + Intronic
1007570627 6:42887937-42887959 CAAAGCCATCACTGAAAAGTTGG - Exonic
1008815954 6:55566791-55566813 CACCACCAGGATTTAAAAGTAGG + Intronic
1009509038 6:64524838-64524860 TGGTACCACCACTTAAAAGTGGG + Intronic
1016424647 6:143921409-143921431 CACAAACAACTCTAAAAAGTAGG - Intronic
1017044030 6:150330580-150330602 CGCAGGCACCACTTGAAAGTGGG - Intergenic
1018531159 6:164764668-164764690 CAAAATCATCACTTAAAGGTTGG + Intergenic
1022032006 7:26500316-26500338 AACAACCTCCATTTAAAAATGGG - Intergenic
1024568578 7:50705250-50705272 CACATCTACCACTTAGAAGGAGG + Intronic
1026270903 7:68835963-68835985 CTCAATCACCACGGAAAAGTGGG + Intergenic
1027484861 7:78749018-78749040 CACAACCATGCCTTAAAAATAGG - Intronic
1028999631 7:97139422-97139444 CAAAGGCACCACTCAAAAGTAGG + Intronic
1029106036 7:98176897-98176919 CAGCACTACCACTTAAGAGTTGG - Intronic
1033928223 7:146489911-146489933 CAAAAGCACCACTTAAAGGTGGG + Intronic
1034672909 7:152871315-152871337 GAGAACCTCCACTTAAAAGCTGG - Intergenic
1034903582 7:154923836-154923858 CAAAACCAGAACATAAAAGTTGG - Intergenic
1037301941 8:17461079-17461101 CAAAGACACCACTCAAAAGTGGG + Intergenic
1037425012 8:18746199-18746221 CAAAAACACCACTCAAAGGTGGG - Intronic
1038085021 8:24186668-24186690 CACCACCACCACTGAAAGATAGG - Intergenic
1044769330 8:95613450-95613472 CTCAACCAGCACTGAAAAGAAGG - Intergenic
1048096664 8:131302901-131302923 AAAAAGCACCATTTAAAAGTGGG - Intergenic
1048398888 8:134044442-134044464 GACAGCCACCACTTAAATGCAGG + Intergenic
1050939682 9:11443161-11443183 CAAAGACACCACTCAAAAGTCGG - Intergenic
1051042574 9:12830367-12830389 CACAACCAACACTTCAAAAGTGG - Intergenic
1052282274 9:26747023-26747045 GACAACCACCACCTGAAAATAGG + Intergenic
1053106311 9:35411831-35411853 CAGAAAGACCACTTAAAAGACGG - Intergenic
1057763713 9:97897536-97897558 CCTAACCACCACTTAGAAGAGGG - Intergenic
1058096293 9:100863911-100863933 CATAACCACCATTTTAAAGATGG + Intergenic
1061615431 9:131775853-131775875 AACACCCACCACTTACATGTTGG + Intergenic
1061629219 9:131861043-131861065 CACAGCCACCTCTTAGTAGTGGG - Intronic
1187998261 X:24952786-24952808 ATCAGCCATCACTTAAAAGTTGG + Intronic
1189168292 X:38883534-38883556 CAAAACCACGACTTAAACCTAGG - Intergenic
1189673012 X:43432023-43432045 CACATCCCACACCTAAAAGTAGG + Intergenic
1191010868 X:55757290-55757312 CACAACCATCACATAAGTGTTGG - Exonic
1193629203 X:83861014-83861036 CACATCCACAATTTAAAAATAGG + Intergenic
1194237916 X:91407772-91407794 CACAACAAACACTTAAACCTGGG - Intergenic
1196240396 X:113337300-113337322 CTAAACCACCACTATAAAGTAGG - Intergenic
1199190703 X:144966355-144966377 CACACACACCAATTAAAAGATGG + Intergenic