ID: 1144914034

View in Genome Browser
Species Human (GRCh38)
Location 17:18707476-18707498
Sequence GGGGGGTGATCACAAAACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144914034_1144914044 3 Left 1144914034 17:18707476-18707498 CCACTGTTTTGTGATCACCCCCC 0: 2
1: 0
2: 0
3: 5
4: 92
Right 1144914044 17:18707502-18707524 AGATGAGGGACCCAGTTAATAGG 0: 1
1: 1
2: 0
3: 5
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144914034 Original CRISPR GGGGGGTGATCACAAAACAG TGG (reversed) Intronic