ID: 1144915333

View in Genome Browser
Species Human (GRCh38)
Location 17:18719623-18719645
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 2, 1: 0, 2: 1, 3: 12, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144915325_1144915333 8 Left 1144915325 17:18719592-18719614 CCAGGAGGCAAGATTGAAGCTGG 0: 2
1: 0
2: 2
3: 17
4: 232
Right 1144915333 17:18719623-18719645 CAGGCAAACCTGAGGTTTTTGGG 0: 2
1: 0
2: 1
3: 12
4: 159
1144915324_1144915333 9 Left 1144915324 17:18719591-18719613 CCCAGGAGGCAAGATTGAAGCTG 0: 2
1: 0
2: 5
3: 41
4: 281
Right 1144915333 17:18719623-18719645 CAGGCAAACCTGAGGTTTTTGGG 0: 2
1: 0
2: 1
3: 12
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901287890 1:8096007-8096029 CAAGCAAATCTGAGATTTTCAGG + Intergenic
903995181 1:27301005-27301027 CAGGAAACCCTGAGGTCTTGAGG - Intronic
904968589 1:34400772-34400794 CAGTCACTCCTGAGATTTTTTGG - Intergenic
908048373 1:60198178-60198200 CATGTAAGCCTGAGGATTTTTGG + Intergenic
908568872 1:65387814-65387836 CAGCCATTGCTGAGGTTTTTAGG + Intronic
912634013 1:111274256-111274278 CAGGGTAACCTGAGATTTTGGGG + Intergenic
916311935 1:163407462-163407484 CAGGGAACCCAGAGGGTTTTAGG - Intergenic
917183124 1:172321064-172321086 CAGTCATAACTGATGTTTTTAGG + Intronic
917623707 1:176824624-176824646 CAGGCAAACATGAGGACATTGGG - Intronic
917927282 1:179799881-179799903 TAGGCAAAACTGAGGTTCTCAGG + Intronic
919725526 1:200880320-200880342 CAGGCAACCCTGGGGTTTGTGGG - Intergenic
920812987 1:209304513-209304535 CAGGGAAACGTGTGGTTTCTAGG + Intergenic
922080344 1:222289694-222289716 CAGACTAACCTGATGTTTTGTGG - Intergenic
922109576 1:222543896-222543918 CAGGCAGCCCTGAGGATCTTGGG + Exonic
922900399 1:229132037-229132059 CAGGCAAATGTGATGTTATTTGG - Intergenic
1065039146 10:21673004-21673026 CAGGCATACATGAGGTGTTTGGG + Intronic
1067932071 10:50572263-50572285 CTGGAAAACCTGTGGTGTTTGGG - Intronic
1070664359 10:78332926-78332948 CAGGCCAACCTGAGGTGTGGTGG + Intergenic
1072570147 10:96651474-96651496 CAAGGAAACCTGAGATTTCTGGG - Intronic
1074298821 10:112214979-112215001 AAGGCAAAACTGAGGTGCTTGGG - Intronic
1075870811 10:125771846-125771868 CAGGCTAAGCTCAGTTTTTTGGG + Intronic
1076695706 10:132246331-132246353 CAGGCAGGCCTGGGGTTTTGGGG + Intronic
1077058208 11:606201-606223 CAGGGAAACCAGGCGTTTTTGGG - Intronic
1081046053 11:38274440-38274462 CAAGCAAACCTGAGGTTAGAAGG + Intergenic
1089531336 11:119131779-119131801 TAGGCAAAACTGGGGTTTTGTGG + Intronic
1089667771 11:120031267-120031289 CAGGAAAACCTAAGGGTTGTTGG + Intergenic
1091238001 11:134034420-134034442 CAGGGAGCCCTGAGGTTTTGCGG + Intergenic
1092505102 12:9090661-9090683 CAGGTAAATCTGAGTTATTTTGG + Intronic
1094320801 12:29180827-29180849 CAGGCAATCTGGAGGTTTTCAGG - Intronic
1097086491 12:56472187-56472209 AAGGCAAACCTGAGGGTAGTGGG + Exonic
1097619130 12:61918844-61918866 CAGGTAATTCTGAGGTTCTTTGG + Intronic
1098520434 12:71430023-71430045 CAAGCAAACCTGAAGCTTATGGG - Intronic
1099485565 12:83225387-83225409 CAGCCAAACCTGAGAGCTTTTGG + Intergenic
1102057565 12:109908065-109908087 GAGGCATAACTGAGGGTTTTTGG + Intronic
1102452067 12:113049355-113049377 CAGCCAGACCTGGGGTTTTCAGG + Intergenic
1106593442 13:31117406-31117428 CAGAGAAACCTGACATTTTTAGG - Intergenic
1108769378 13:53680106-53680128 AAGGCAAACCTGGGTTTTTAAGG - Intergenic
1110378930 13:74827173-74827195 GATGCAAATCAGAGGTTTTTGGG - Intergenic
1112085143 13:96022763-96022785 CATGCAAAACTGAGTTTATTTGG - Intronic
1112611745 13:100962091-100962113 CAGGTAAACCTGAGCTGGTTGGG + Intergenic
1116597417 14:46868479-46868501 CAGTCATACTTGAAGTTTTTCGG - Intronic
1118082836 14:62381704-62381726 CCTGCAAACCTCAGGTGTTTGGG + Intergenic
1118089771 14:62460902-62460924 CAGGCAAACTTGAGGAGTATTGG + Intergenic
1121259295 14:92554281-92554303 AAGGCAAACATGAGGGTCTTGGG + Intronic
1121696543 14:95917572-95917594 TAGGAAAAACTGATGTTTTTAGG + Intergenic
1122107682 14:99470855-99470877 CATGAAAACCTGATGTTTTAGGG - Intronic
1123138531 14:106053005-106053027 CAGGAAAACATGGGGTTCTTGGG + Intergenic
1124650842 15:31472759-31472781 CAGGCAGACCTCAGGTTGTTGGG - Intergenic
1126524184 15:49631799-49631821 TAGGCAAACCTAAAGTTTATAGG + Intronic
1128542040 15:68543060-68543082 CAGTCTAACCTGATGCTTTTTGG - Intergenic
1129695310 15:77737646-77737668 TTGGCAAAACTGAGGTTTCTGGG - Intronic
1132608356 16:802793-802815 CAGGGCAAGCTGAGGGTTTTGGG + Intergenic
1135065439 16:19305803-19305825 TAGTCAGACCTGAGTTTTTTTGG + Intronic
1135829819 16:25763207-25763229 CAGGAAAACTTCAGGTTTATAGG + Intronic
1137576203 16:49601955-49601977 CAGCCAAAGCTGAGGTTTATAGG - Intronic
1137941553 16:52693137-52693159 TAGGTAAAACTGAGGTTTTAGGG + Intergenic
1139285528 16:65809937-65809959 AAGGCAAACATGACGTATTTTGG + Intergenic
1141978598 16:87535083-87535105 CAGGGAATTCTGAGGATTTTAGG + Intergenic
1142052147 16:87965646-87965668 CAGGCGCACCTGAGGTTGATTGG + Intronic
1144483355 17:15645403-15645425 CAGGCAAACCTGAGGTTTTTGGG - Intronic
1144523027 17:15967010-15967032 CATGCAGACCTGAGGGTGTTCGG + Intronic
1144915333 17:18719623-18719645 CAGGCAAACCTGAGGTTTTTGGG + Intronic
1146283756 17:31560737-31560759 CAGGCAAACCCGAGGTTTCAGGG - Intergenic
1149286493 17:55171216-55171238 GAGGCACACCTGATGTTTTGTGG - Intergenic
1150520822 17:65865661-65865683 CAAGCAAACCTGATGCTCTTGGG - Intronic
1153237750 18:3004848-3004870 AAGGTAAACCTGATGTTCTTTGG - Intronic
1153242316 18:3042274-3042296 GAGGAAATCCTTAGGTTTTTTGG + Intergenic
1162090485 19:8276568-8276590 CAGCCAAACCTTAGATGTTTTGG - Intronic
1162092718 19:8291396-8291418 CAGCCAAACCTTAGATGTTTTGG - Intronic
1164444201 19:28303242-28303264 CAGCCATACCTCAGTTTTTTTGG + Intergenic
925791879 2:7497523-7497545 CAGGGGAACCTGAGGCTTTCTGG - Intergenic
926296424 2:11572340-11572362 GAGGCATCCCTGAGGTTTTGTGG + Intronic
928375804 2:30772296-30772318 CAGGGAAACCAGAGTGTTTTAGG + Intronic
931339018 2:61380472-61380494 GAGGAAAACCAGAGGTTTGTGGG - Intronic
931659353 2:64544082-64544104 CAGGAAAATCAGAGGGTTTTGGG - Intronic
932386946 2:71343788-71343810 CAGGAAAACGTGAGTTTTTTTGG - Intronic
933565431 2:83944714-83944736 CAAGCAAAACAGAGGTTTTGAGG - Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
934818113 2:97348000-97348022 CAGGGAAACCTGTGCTTATTGGG - Intergenic
938290798 2:130149147-130149169 CATGCCCATCTGAGGTTTTTGGG + Intergenic
939016219 2:136906499-136906521 CAAATAAACCTGAGATTTTTAGG + Intronic
941111371 2:161421961-161421983 CACACAAACCTGAGATTTTTAGG + Intronic
942120104 2:172768328-172768350 CAAGCAAAATTAAGGTTTTTTGG - Intronic
944072255 2:195685185-195685207 CAGACAAACCTTAGGGTTTGTGG - Intronic
945056968 2:205877844-205877866 CTGGCAAACTTGAGATTTGTAGG + Intergenic
948750388 2:240128969-240128991 CAGGCAAACCTGAAATTCTACGG + Intronic
949000339 2:241609809-241609831 TTTGCAAACCTCAGGTTTTTGGG + Intronic
1169778935 20:9288035-9288057 CAAGCTCACCTGAGGTTTCTTGG + Intronic
1170694391 20:18645562-18645584 CAGGCAAACCTGGGAATTCTAGG - Intronic
1171494602 20:25547099-25547121 CAGGAAATTCTGAGGGTTTTGGG - Intronic
1176038019 20:63049766-63049788 CAGGAAAAGCTGAAGTTTTATGG - Intergenic
1176264060 20:64199401-64199423 CAGGCACACCTGAGATGCTTGGG - Intronic
1177893595 21:26835566-26835588 CAGGAATACCTGAGGGGTTTTGG - Intergenic
1178594123 21:33937358-33937380 CAGACAAAGCTGGGGGTTTTGGG + Intergenic
952030776 3:29140088-29140110 CAGTGAAACCTGAGATTTTAAGG + Intergenic
952901351 3:38113974-38113996 CTGGCAAGCCTGAGGCTCTTCGG - Intronic
955339937 3:58117478-58117500 CAGGCTAACCAGAGGTCTTGGGG - Intronic
955613390 3:60780778-60780800 CAGGCTGACTGGAGGTTTTTCGG - Intronic
956637433 3:71380252-71380274 CTGGCCAACCTGATGTTCTTGGG - Intronic
957347596 3:78982151-78982173 CAGGCAATCCTGTGTTCTTTCGG + Intronic
957356646 3:79096549-79096571 CAGGCAAACTGAAGGTTTTGGGG + Intronic
959646793 3:108712545-108712567 AATGCAAACATCAGGTTTTTTGG - Intergenic
959841088 3:110976142-110976164 CAAGAAAACCTTAGGTTATTAGG - Intergenic
959854029 3:111127141-111127163 CATACAAACCTGAGTTTCTTAGG - Intronic
959976351 3:112464611-112464633 AAGACAAAACTGAGGTTTTGTGG - Exonic
960155791 3:114295861-114295883 CAGGAATACCTGAGCTTTCTAGG - Exonic
961855709 3:129868979-129869001 GAGGAAAACCTAAGGGTTTTAGG - Intronic
962665396 3:137649211-137649233 TAGTCTAACCTCAGGTTTTTGGG + Intergenic
963155011 3:142086905-142086927 CAGGAAATCCTGAGGGATTTAGG + Intronic
972037953 4:34550792-34550814 CAGCCATACTTGAGTTTTTTTGG + Intergenic
972141778 4:35969523-35969545 CTGGCAATCCTGTGGTTTTCAGG - Intronic
973084179 4:46033357-46033379 AAGGCAAACCCCAGGTTTTAAGG - Intergenic
974165591 4:58197362-58197384 GAGTAAAACCTGAGATTTTTAGG - Intergenic
977521238 4:98087280-98087302 CAGGAAAACGTGAAGTTTTTAGG - Intronic
978151296 4:105438733-105438755 CAGGCAATTCTGAGGCTTTTTGG - Intronic
978574917 4:110180193-110180215 CAGGCAAACCCGAGATTTTTAGG - Intronic
978876598 4:113646984-113647006 AAGGCTATCATGAGGTTTTTCGG - Intronic
979774121 4:124566210-124566232 CTGGCATACCTGAAGTGTTTGGG - Intergenic
980590148 4:134875973-134875995 CAGGCAAATCAGAGGTACTTAGG - Intergenic
980989735 4:139728932-139728954 CAGGCACACCTGAGATTTCCTGG + Intronic
981893579 4:149768845-149768867 CTGACAAACTTGAGTTTTTTGGG + Intergenic
982665709 4:158259657-158259679 CAACCAAACCTGGTGTTTTTGGG - Intergenic
984739621 4:183148180-183148202 TTGGCAAAACTGAGTTTTTTTGG + Intronic
984819160 4:183864881-183864903 TAGAGAAACCTGAAGTTTTTTGG - Intronic
989431603 5:41361348-41361370 CAGGCAGACCCGCAGTTTTTTGG + Intronic
990622148 5:57571365-57571387 CATGCAAAACAGAGGTTCTTGGG - Intergenic
993120578 5:83769178-83769200 CAGGAAAACCTGCAGTTTCTAGG - Intergenic
996947439 5:129087521-129087543 CAGTCAAACGTGATATTTTTAGG - Intergenic
1003041051 6:2687578-2687600 CATGGAAGCCTGAGGTATTTGGG - Intronic
1007146609 6:39640734-39640756 CAGTCAAACCTGTGTGTTTTAGG - Intronic
1008676458 6:53824636-53824658 AAAGCAAACCTCAGGTTTTCTGG - Intronic
1011111615 6:83843453-83843475 CACATAAACCTGAGGTTTGTGGG + Intergenic
1011733305 6:90288568-90288590 CCTGCAAACCTGAGGTAATTGGG + Intronic
1013643091 6:112107245-112107267 CAGGCAAGCCAGAGATTTCTGGG + Intergenic
1014073259 6:117207344-117207366 AAGGAAGACCAGAGGTTTTTGGG + Intergenic
1019300666 7:302008-302030 CAGGGAAGCCTGAGGTTTCTGGG - Intergenic
1020649944 7:10862004-10862026 CAGGCAAGTCTGAGATTTCTAGG + Intergenic
1020977393 7:15023892-15023914 CAAACAAATCTGAGGTTTTGAGG - Intergenic
1021774832 7:24042735-24042757 CAGGAAGAAGTGAGGTTTTTAGG - Intergenic
1022958413 7:35402173-35402195 AAGGCAAACCTGAGGGCTTCTGG - Intergenic
1023051134 7:36252237-36252259 CAGTCAGACCTGAAGGTTTTGGG + Intronic
1030025074 7:105315540-105315562 CAGGCAAACATGAGAATTCTGGG + Intronic
1035134504 7:156688010-156688032 TAGGTAATCCTGAGGTTTATGGG - Exonic
1038418131 8:27412537-27412559 GGGGCAAACCTGAAGTTCTTGGG - Intronic
1039797768 8:40929782-40929804 CGAGCAAAGCTGAGGTCTTTGGG - Intergenic
1040323855 8:46331384-46331406 CAGACAACCCTGTGGTTTTCTGG - Intergenic
1040868464 8:52075015-52075037 CAGGGAAAAATAAGGTTTTTAGG - Intergenic
1043598578 8:81913699-81913721 AAGGCAAAACTAAGGGTTTTAGG - Intergenic
1046337603 8:112810381-112810403 CAGACAAATCTGACGTTTATAGG + Intronic
1046699683 8:117386062-117386084 AAGGCAATAATGAGGTTTTTAGG - Intergenic
1048048646 8:130796656-130796678 CAGGCAAAACTGAGAGTGTTTGG + Intronic
1048603883 8:135947521-135947543 TAGGCAGACCTGAAGTTTCTTGG + Intergenic
1050599327 9:7234662-7234684 CAGGAAAACCCAAGGGTTTTAGG + Intergenic
1051099906 9:13509040-13509062 CAGTCAAAACTGAGGATTTTTGG - Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1055760071 9:79597705-79597727 CAGTCAAACATGAGGTCTTCTGG + Intronic
1056695261 9:88844367-88844389 CAAGAAAACAGGAGGTTTTTTGG - Intergenic
1056966820 9:91169684-91169706 AAGGCAAACATGTGGTCTTTGGG - Intergenic
1056984168 9:91346058-91346080 CAGGAAATTCTGAGGGTTTTAGG - Intronic
1059092449 9:111374346-111374368 CAGGCACACCTGAAGATATTTGG - Intronic
1062040848 9:134403623-134403645 CAGGCATCCCTGAGGATTCTGGG - Intronic
1186781773 X:12919454-12919476 CTGGCAAACCAGAGGGTATTTGG - Exonic
1193617848 X:83712107-83712129 CATGCAAACTTGAGCATTTTAGG - Intergenic
1196395929 X:115261653-115261675 CAGCTGAACCTGAGGTTTTTAGG + Intergenic
1197734421 X:129840182-129840204 CAGTCAAACCAGAGGTTTCCTGG + Intronic
1198370387 X:135983931-135983953 CAGGCAGCCATGAGGTTTCTTGG + Intergenic
1198494971 X:137183141-137183163 CTTGCAAACCTAAGGTATTTTGG + Intergenic
1198968742 X:142255662-142255684 CAGGCAAGTCTGAAGTGTTTGGG - Intergenic