ID: 1144918002 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:18740409-18740431 |
Sequence | TGCCCCCAATATGTCCATGC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1144917999_1144918002 | 4 | Left | 1144917999 | 17:18740382-18740404 | CCCTTGCAGGGCAACCTGCTGTT | No data | ||
Right | 1144918002 | 17:18740409-18740431 | TGCCCCCAATATGTCCATGCAGG | No data | ||||
1144918000_1144918002 | 3 | Left | 1144918000 | 17:18740383-18740405 | CCTTGCAGGGCAACCTGCTGTTG | No data | ||
Right | 1144918002 | 17:18740409-18740431 | TGCCCCCAATATGTCCATGCAGG | No data | ||||
1144918001_1144918002 | -10 | Left | 1144918001 | 17:18740396-18740418 | CCTGCTGTTGATATGCCCCCAAT | No data | ||
Right | 1144918002 | 17:18740409-18740431 | TGCCCCCAATATGTCCATGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1144918002 | Original CRISPR | TGCCCCCAATATGTCCATGC AGG | Intergenic | ||