ID: 1144918002

View in Genome Browser
Species Human (GRCh38)
Location 17:18740409-18740431
Sequence TGCCCCCAATATGTCCATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144917999_1144918002 4 Left 1144917999 17:18740382-18740404 CCCTTGCAGGGCAACCTGCTGTT No data
Right 1144918002 17:18740409-18740431 TGCCCCCAATATGTCCATGCAGG No data
1144918000_1144918002 3 Left 1144918000 17:18740383-18740405 CCTTGCAGGGCAACCTGCTGTTG No data
Right 1144918002 17:18740409-18740431 TGCCCCCAATATGTCCATGCAGG No data
1144918001_1144918002 -10 Left 1144918001 17:18740396-18740418 CCTGCTGTTGATATGCCCCCAAT No data
Right 1144918002 17:18740409-18740431 TGCCCCCAATATGTCCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144918002 Original CRISPR TGCCCCCAATATGTCCATGC AGG Intergenic