ID: 1144921478

View in Genome Browser
Species Human (GRCh38)
Location 17:18767870-18767892
Sequence TGGGACAGACACTACCTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144921478_1144921479 -6 Left 1144921478 17:18767870-18767892 CCAAGAAGGTAGTGTCTGTCCCA 0: 1
1: 1
2: 0
3: 11
4: 155
Right 1144921479 17:18767887-18767909 GTCCCAAACACAGACCCACCAGG 0: 1
1: 1
2: 0
3: 22
4: 177
1144921478_1144921482 1 Left 1144921478 17:18767870-18767892 CCAAGAAGGTAGTGTCTGTCCCA 0: 1
1: 1
2: 0
3: 11
4: 155
Right 1144921482 17:18767894-18767916 ACACAGACCCACCAGGAGCAAGG 0: 2
1: 0
2: 1
3: 31
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144921478 Original CRISPR TGGGACAGACACTACCTTCT TGG (reversed) Intronic
902269092 1:15290219-15290241 TGGGACACACACAACCTTCAGGG + Intronic
902954143 1:19913344-19913366 AGGCACAGACAGTACCATCTGGG + Intergenic
905051210 1:35052676-35052698 TGGCACAGACAGAACCTTTTAGG - Intergenic
906449320 1:45931439-45931461 TGGCACAGTCACTACCTCCTGGG + Intronic
907184772 1:52601503-52601525 TAGGACAGACACCAGCTGCTAGG + Intergenic
910867811 1:91804098-91804120 TGAGACAGACAGTCCCTTATTGG - Intronic
911092663 1:94030238-94030260 AGGGACATTCACTACCTCCTAGG - Intronic
916693070 1:167209620-167209642 TTGGACAGCCACTAGCTTTTTGG - Intergenic
919861760 1:201743614-201743636 TGGGAGAGACTCTTGCTTCTGGG - Intronic
922417673 1:225436327-225436349 TGGAACAGAAAGTACCATCTAGG + Intergenic
922975593 1:229781007-229781029 TGGGACCGTCACTTCCTTCATGG - Intergenic
923062376 1:230487654-230487676 AGGGACAGACACAAGCTTGTGGG + Intergenic
924714466 1:246559839-246559861 TTGGACATACTCTACCTTCAGGG - Intronic
1064259872 10:13776822-13776844 TGGGTCTAACACTACCCTCTGGG + Intronic
1066189445 10:33042412-33042434 TGGGACAGAAACTAGATCCTAGG + Intergenic
1066209475 10:33223106-33223128 TGGGTCAGACACCTCCTTTTAGG + Intronic
1070409427 10:76125833-76125855 TAGGACAGACAAAACATTCTGGG - Intronic
1072956772 10:99893795-99893817 TGGGAGATACACTAGCATCTTGG - Intronic
1073104991 10:101027403-101027425 TGGCTCAGACACCACTTTCTTGG + Intronic
1073119929 10:101115351-101115373 TGGGACAGACACTATTCTGTGGG + Intronic
1076772141 10:132671521-132671543 TTGGAAGGACACAACCTTCTTGG + Intronic
1077657946 11:4040155-4040177 GGAGAAAAACACTACCTTCTAGG - Intronic
1079351884 11:19698635-19698657 TGGCACAGACACAACCTTTCTGG + Intronic
1079743283 11:24091987-24092009 TGGTAAACAAACTACCTTCTAGG - Intergenic
1081085299 11:38792108-38792130 AGGGACAGACAACACCATCTAGG + Intergenic
1084084600 11:66849215-66849237 TGGGGGAGACAATACCTTCATGG + Exonic
1084110700 11:67012541-67012563 TGAGACAGACCCTACCCTCTTGG - Intronic
1085326907 11:75613265-75613287 TGGGGCACACACTTGCTTCTCGG + Intronic
1088561000 11:111116212-111116234 GGAGACAGACATTTCCTTCTAGG - Intergenic
1090583273 11:128182845-128182867 TTGGACAAACACTACCTATTTGG + Intergenic
1091399010 12:171631-171653 TGGGGCAGACCCTGCCCTCTTGG + Intronic
1091400145 12:176370-176392 TGGGACAGACACATCCTGATAGG - Exonic
1092154501 12:6273708-6273730 TGGGACACCCACTCCCTGCTGGG - Intergenic
1092241122 12:6837190-6837212 TGGGACCGAGACTACCTGATAGG + Intronic
1093503793 12:19841247-19841269 TGGGAGAGACATTAGCTTCTAGG + Intergenic
1093930299 12:24949185-24949207 TGGGAGAGACTCCACCATCTGGG - Intronic
1094308826 12:29054383-29054405 TGGAACTGCCACTACCATCTTGG + Intergenic
1094348266 12:29496015-29496037 TGGGACAGACACACATTTCTGGG + Intronic
1096056873 12:48660453-48660475 TGGCACAGACAGTACCTGCTCGG + Exonic
1098392720 12:69986187-69986209 TGGGACACCTACTACCTGCTAGG + Intergenic
1099217840 12:79875309-79875331 TGGCACAGACTTTACATTCTTGG - Intronic
1102004155 12:109578175-109578197 TGGGAGACATACTATCTTCTAGG + Intronic
1102200700 12:111055756-111055778 TGGGCCAGCCCCAACCTTCTAGG - Intronic
1102680753 12:114688712-114688734 CAGGGCAGACACTAGCTTCTTGG + Intergenic
1108493696 13:51004836-51004858 TGGGACACACACGACTTTTTTGG - Intergenic
1113355457 13:109575932-109575954 TAGGAAAAGCACTACCTTCTGGG - Intergenic
1118995827 14:70835182-70835204 TGGGAAAGAGACTAAATTCTTGG + Intergenic
1119884346 14:78127958-78127980 TAGGACAGACACTGACTTCACGG + Intergenic
1120735184 14:88044795-88044817 TGGAACAAAGACTACCTTGTTGG + Intergenic
1121242279 14:92439528-92439550 TGGGGCAGACACTAAGTGCTCGG - Intronic
1122793079 14:104192624-104192646 TGGGACAGGCTCTGGCTTCTGGG + Intergenic
1124712146 15:32022515-32022537 TGGGATTGACTCTACCCTCTTGG - Intergenic
1126671214 15:51116666-51116688 TGTGACAGAGGCCACCTTCTGGG - Intergenic
1128186163 15:65645001-65645023 TGGGACAGCCACTGCCATGTGGG + Intronic
1132930669 16:2457516-2457538 TGGGGCACCCACTTCCTTCTGGG + Exonic
1136540889 16:30927240-30927262 GGGGAAAGACCCTTCCTTCTAGG - Intronic
1137892371 16:52176019-52176041 AGGGACAGAGCCTACCTACTCGG + Intergenic
1144476765 17:15595479-15595501 TGGGGCAGACACTACCTTCTTGG + Intronic
1144921478 17:18767870-18767892 TGGGACAGACACTACCTTCTTGG - Intronic
1146307770 17:31743849-31743871 TGAGACCGACACTCCCTTTTAGG + Intergenic
1148641524 17:49191844-49191866 TGGAAAAGACACTCCCCTCTGGG - Intergenic
1150125400 17:62631676-62631698 TGGGTCAGCCACTTCCTTGTGGG + Intronic
1153605130 18:6825572-6825594 TGGGTCAAAAACTACCTACTGGG - Intronic
1155565429 18:27128834-27128856 TGGTGTAGTCACTACCTTCTAGG - Intronic
1157862027 18:51150478-51150500 TGGAACAGAGACTATTTTCTAGG - Intergenic
1162057754 19:8074923-8074945 TGGGGAACTCACTACCTTCTGGG + Intronic
1163440317 19:17319482-17319504 TCGGACAGCCTCAACCTTCTGGG - Intronic
1164901841 19:31934148-31934170 GGGGGCAGAAACTTCCTTCTTGG + Intergenic
1165712830 19:38024352-38024374 TTTGACAGACACTTCCTTGTAGG + Intronic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
926428194 2:12759109-12759131 TGGGACAGACATTTCCTTAGAGG + Intergenic
933845910 2:86327092-86327114 TGTGAAAAACACTACCTTCTTGG + Intronic
935579791 2:104746542-104746564 TGGGGCTGACACTGCCTGCTGGG - Intergenic
936170792 2:110171278-110171300 TGTGACAGACACTATGTGCTTGG + Intronic
936543499 2:113371214-113371236 AGTCACAGACACTGCCTTCTAGG + Intergenic
936765440 2:115842153-115842175 TGCGAGAGACAATAGCTTCTTGG + Intronic
937053780 2:118914046-118914068 AGGGACAGACACTACCAGTTGGG - Intergenic
937758098 2:125565286-125565308 TTGGACCGACACTACTTTCATGG + Intergenic
939337262 2:140846380-140846402 TGAGACAAACACTAGCTCCTTGG - Intronic
946058021 2:216918384-216918406 TGGGGCAGCCACTCCCTTCCAGG + Intergenic
947501943 2:230677258-230677280 TGGGCCAGTCACTTTCTTCTTGG + Intergenic
1169041421 20:2498664-2498686 TGTGCCAGGCACTACCTTATAGG + Intronic
1169071500 20:2735132-2735154 TGGGAAAGACCCTATCTTCAGGG - Intronic
1170531395 20:17296072-17296094 TCGGACAGACACCAGATTCTGGG - Intronic
1171038702 20:21739755-21739777 TGGGAGAGAGACTAGCTTTTTGG - Intergenic
1172577574 20:36021095-36021117 TGGGGCACACAGTACCTCCTGGG - Intronic
1174046807 20:47739531-47739553 TTGATCAGACACCACCTTCTTGG + Intronic
1174688231 20:52476235-52476257 TGGGACAGTCCCTGCCTTCCAGG - Intergenic
1175081736 20:56426448-56426470 TGCGACAGACACTCCTTTCAGGG + Intronic
1175669655 20:60890949-60890971 GGGGACAGACACCTCCTTCAGGG + Intergenic
1182423205 22:30258344-30258366 TGGCACAGACACGACGTTATTGG - Intergenic
1182452436 22:30429432-30429454 TGGGGCTGACACCACCATCTTGG - Intergenic
1184990342 22:48164058-48164080 TGGGATAGAAAATACCTTCAAGG + Intergenic
949947223 3:9200130-9200152 TGGGACACAGTTTACCTTCTTGG - Intronic
950191632 3:10980701-10980723 TGGGACAGCCACTCCATGCTAGG + Intergenic
951734350 3:25848093-25848115 TGGGAGATACAGGACCTTCTTGG + Intergenic
957634552 3:82763179-82763201 TGGGACCGAGACTGCCTTCCTGG + Intergenic
957706003 3:83785055-83785077 TAGGAAAGACATTTCCTTCTTGG - Intergenic
958083684 3:88779539-88779561 TGGAAAAGAAACTACTTTCTTGG - Intergenic
959892597 3:111572892-111572914 TGGGACAGACTCTGCATTTTGGG + Intronic
970275548 4:14396106-14396128 TGAGACTGACACTTCCTTGTTGG + Intergenic
972762005 4:42115663-42115685 TAAGACAGACACTGACTTCTCGG + Exonic
973986555 4:56360075-56360097 TGGGACAGTAAGTACCTACTGGG - Intronic
977882145 4:102217299-102217321 TGGGAAAAATACTACCTTATGGG - Intergenic
984470949 4:180172776-180172798 TAGGACAGAAACTACCTCTTGGG + Intergenic
984520003 4:180790083-180790105 TGAGCCAGACTCTACCATCTGGG + Intergenic
991363021 5:65840788-65840810 TGGGACAGGCAATACATTTTTGG + Intronic
994057238 5:95431588-95431610 TGGGAAGCACACTACATTCTTGG - Intronic
995079994 5:108039348-108039370 TGGAACAGCCTCTAGCTTCTAGG - Intronic
996275843 5:121665081-121665103 TGGCAAAGATACTACCATCTGGG + Intergenic
996515794 5:124367940-124367962 TGGGCCAAAAAGTACCTTCTTGG - Intergenic
997014129 5:129911499-129911521 TGTGACAGACACTACATTAAGGG - Intronic
997704608 5:135936229-135936251 TGGGACATACACTGCTTCCTTGG + Intronic
998523075 5:142818065-142818087 TGGAACAGAAACTACATTCCTGG - Intronic
999311179 5:150553280-150553302 TGGGCCAGACACTTCCCACTTGG + Exonic
1004880663 6:20004166-20004188 TGGAACAGACCCTTCCCTCTTGG + Intergenic
1006055996 6:31384912-31384934 TGGGACAGAAACTTCCTCCATGG - Intergenic
1006129006 6:31857530-31857552 AGAGACAGACACTACCTTCCTGG - Intergenic
1006736967 6:36280607-36280629 AGGGACAGGGACTACGTTCTTGG - Intronic
1015374665 6:132496070-132496092 TTGGAAAGACAGAACCTTCTAGG - Intronic
1019340252 7:505500-505522 TGGGACAGCCACTCCCTGCGGGG + Intronic
1021803203 7:24328758-24328780 TGGGACAGAGTATACCTTCAAGG + Intergenic
1022404017 7:30069765-30069787 TGGGAAAGTCACTACCTTTCTGG + Intronic
1026869171 7:73840399-73840421 TGGGAGAGAAAGTACCTTCCGGG + Exonic
1026972050 7:74474412-74474434 TGGGAGAGCCACTCCCATCTTGG + Intronic
1029073007 7:97915176-97915198 TGGTCCTGACACCACCTTCTAGG + Intergenic
1029573389 7:101386572-101386594 CGTGACAGACATAACCTTCTGGG - Intronic
1032524271 7:132567847-132567869 AGGGGCTGACCCTACCTTCTGGG + Intronic
1032661967 7:133994014-133994036 TGGAGCAGACACTGCCTTTTTGG - Intronic
1033260771 7:139842352-139842374 TGGGAGAGTCACTTCCTTCCCGG - Intronic
1035218512 7:157390121-157390143 TGGGACAGCAACCACCATCTGGG - Intronic
1035855449 8:2971256-2971278 AGGGTCAGACTCTACCATCTCGG + Intronic
1047350198 8:124066543-124066565 TAGGGGAGACTCTACCTTCTGGG - Exonic
1049101005 8:140578862-140578884 CGGGGCAGACACTTGCTTCTCGG - Intronic
1049428247 8:142547109-142547131 TGGCACAGACATGGCCTTCTGGG - Intergenic
1050438397 9:5633411-5633433 TATCACAGACACTCCCTTCTTGG + Intronic
1055027176 9:71734758-71734780 TGGGAAACACACTATTTTCTTGG - Intronic
1055917880 9:81425400-81425422 TGGGACAGACATCAGCTACTGGG + Intergenic
1057132403 9:92663361-92663383 TGGGGCAGGCTCTACCATCTAGG + Intronic
1057878986 9:98778920-98778942 GAGGACAGGCACTACCTCCTGGG + Intronic
1058803002 9:108562966-108562988 TGGGATAGACTTTACATTCTGGG - Intergenic
1060721881 9:125984917-125984939 TGGGGAAGTCAATACCTTCTTGG - Intergenic
1060937498 9:127524168-127524190 AGGGTCAAGCACTACCTTCTTGG + Intronic
1061782042 9:133001908-133001930 TTGGTCAGACACTGCCCTCTGGG + Intergenic
1061807778 9:133146034-133146056 GGGGAAAGTCACTCCCTTCTTGG + Intronic
1185619203 X:1443017-1443039 TTGGAGAGACACCACCATCTTGG + Intronic
1185619250 X:1443340-1443362 TTGGACAGACACCGCCATCTTGG + Intronic
1185619265 X:1443435-1443457 TTGGACAGACACCGCCATCTTGG + Intronic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185619344 X:1443919-1443941 TTGGACAGACACCCCCGTCTTGG + Intronic
1185619349 X:1443938-1443960 TTGGACAGACACTGCCATGTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1188216029 X:27478093-27478115 TGGGAGAGAAACTGCTTTCTTGG - Intergenic
1191214394 X:57920371-57920393 AGGAACAGACCCTTCCTTCTTGG - Intergenic
1192347267 X:70321249-70321271 GGGGGCACACACTACATTCTGGG - Intronic
1192588620 X:72340856-72340878 TGTGACACACCCTACCTTCAGGG - Intronic
1195215664 X:102698951-102698973 AGGGACAGAGAGTATCTTCTTGG + Intergenic
1195311574 X:103636632-103636654 TGGGACAGATACTTCATACTTGG + Intergenic
1195592146 X:106641784-106641806 TGGGAGTGAGACTACCTCCTTGG - Intronic
1199685060 X:150258279-150258301 TGAGACAGACACAGCCTTCTTGG + Intergenic
1199718539 X:150525177-150525199 TGGGACAAATAAAACCTTCTGGG - Intergenic