ID: 1144923231

View in Genome Browser
Species Human (GRCh38)
Location 17:18781603-18781625
Sequence AGTTGAGGAGGAGCGGCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 2, 1: 0, 2: 1, 3: 24, 4: 278}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144923219_1144923231 26 Left 1144923219 17:18781554-18781576 CCAGCGCGAGTGGGGGTCTCTCT 0: 2
1: 0
2: 0
3: 4
4: 57
Right 1144923231 17:18781603-18781625 AGTTGAGGAGGAGCGGCCTGCGG 0: 2
1: 0
2: 1
3: 24
4: 278
1144923226_1144923231 -6 Left 1144923226 17:18781586-18781608 CCTTATTGCCGGGGTGGAGTTGA 0: 2
1: 0
2: 0
3: 2
4: 84
Right 1144923231 17:18781603-18781625 AGTTGAGGAGGAGCGGCCTGCGG 0: 2
1: 0
2: 1
3: 24
4: 278
1144923225_1144923231 -5 Left 1144923225 17:18781585-18781607 CCCTTATTGCCGGGGTGGAGTTG 0: 2
1: 0
2: 0
3: 6
4: 61
Right 1144923231 17:18781603-18781625 AGTTGAGGAGGAGCGGCCTGCGG 0: 2
1: 0
2: 1
3: 24
4: 278
1144923223_1144923231 1 Left 1144923223 17:18781579-18781601 CCTCAACCCTTATTGCCGGGGTG 0: 2
1: 0
2: 0
3: 4
4: 46
Right 1144923231 17:18781603-18781625 AGTTGAGGAGGAGCGGCCTGCGG 0: 2
1: 0
2: 1
3: 24
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144923231 Original CRISPR AGTTGAGGAGGAGCGGCCTG CGG Intronic
900087134 1:904105-904127 AGTGGAGGATGGGAGGCCTGGGG + Intergenic
901790391 1:11650757-11650779 TGCTGAGGAGGAGCGGCCGGAGG - Exonic
902086715 1:13868506-13868528 AATCCAGGAGGAGCGGGCTGTGG + Intergenic
902392728 1:16115753-16115775 GGGTGAGGAGGAGAGCCCTGGGG - Intergenic
902555840 1:17246115-17246137 AGCTGAGCAGGGGCCGCCTGTGG - Intergenic
902623998 1:17666428-17666450 TTTTGAGGAGCAGGGGCCTGGGG + Intronic
903044284 1:20553860-20553882 AGCTGAGGACGTGCAGCCTGCGG + Exonic
903743149 1:25570014-25570036 AGCTGAGGGGCAGAGGCCTGGGG - Intergenic
905477527 1:38239419-38239441 GGGTGAGGAGGAGAGGCCTCGGG - Intergenic
905895393 1:41542544-41542566 AGTAGAAGAGGAGCAGCATGAGG + Intronic
907325329 1:53634401-53634423 AGTTGAGGAAGAGTAGCCAGAGG + Intronic
907461134 1:54606318-54606340 ATTTGTGGGGGAGTGGCCTGAGG + Intronic
907805721 1:57817498-57817520 CTTTCAGGAGGAGCTGCCTGGGG + Intronic
908001473 1:59684467-59684489 AGATGAGGAGCATAGGCCTGGGG - Intronic
908273965 1:62449809-62449831 GGCTGAGGAGGAGGAGCCTGAGG + Intronic
909729294 1:78873561-78873583 ACCTGAGGAGGAGCAGTCTGGGG - Intergenic
909895746 1:81066810-81066832 TGTTGATGATGAGAGGCCTGAGG - Intergenic
913680603 1:121185263-121185285 GGTGGAGGAGGGGCGGTCTGAGG - Intronic
914032434 1:143972905-143972927 GGTGGAGGAGGGGCGGTCTGAGG - Intergenic
914157011 1:145095062-145095084 GGTGGAGGAGGGGCGGTCTGAGG + Intronic
915893381 1:159792005-159792027 TGCTGAGGAGGGGAGGCCTGGGG + Intergenic
916941698 1:169684487-169684509 ACCTGAGGAGGAGCAGTCTGGGG - Intronic
920496774 1:206460472-206460494 AGTTGGGGAGGAGGGGCGGGGGG + Intronic
922845549 1:228681375-228681397 AGCTGAGGAGGAGCAGTCTGGGG + Intergenic
923511811 1:234659591-234659613 AATTGAGGAGGAGCCTCCTCAGG - Intergenic
924003030 1:239574743-239574765 AGAGGAGGAGGAGCAGCATGAGG - Intronic
1062989222 10:1800031-1800053 GGTTCTGGAGGAGAGGCCTGTGG + Intergenic
1067066024 10:43104820-43104842 AGCGGAGGAGGGGAGGCCTGGGG + Intronic
1067096478 10:43304741-43304763 AGCTGAGGAGGCGGGTCCTGGGG + Intergenic
1067457986 10:46437108-46437130 AGTGTTGGAGGAGAGGCCTGGGG - Intergenic
1067556825 10:47278613-47278635 GGTGGAGGAGGAGCTGGCTGTGG - Intergenic
1067629211 10:47947526-47947548 AGTGTTGGAGGAGAGGCCTGGGG + Intergenic
1069153852 10:65000360-65000382 AGATAGGGAGGAGCAGCCTGAGG - Intergenic
1069504889 10:68988997-68989019 GGACGAGGATGAGCGGCCTGAGG + Exonic
1069799838 10:71075278-71075300 AGTAGAGCAGCAGGGGCCTGGGG - Intergenic
1070956134 10:80464772-80464794 AGCTGAGGAGGCGGGACCTGGGG + Intronic
1070981191 10:80649559-80649581 AGCTGAGGAGGAGGAGGCTGGGG + Intergenic
1073125632 10:101147062-101147084 CGTTGAGGAGAAGCACCCTGGGG + Intergenic
1073683442 10:105728992-105729014 ACTTGAGGAGGAGCAGTCTGGGG - Intergenic
1075608746 10:123834963-123834985 ACTTGAGTGGGAGCAGCCTGAGG + Intronic
1076130957 10:128013598-128013620 GGTTGAGGAGGCGGGGCCTTGGG + Intronic
1077086726 11:756270-756292 AGGAGGGGAGGAGGGGCCTGTGG - Intronic
1078053997 11:7992167-7992189 AGTTGGGGAGGTGGGGGCTGGGG + Intronic
1078355517 11:10629134-10629156 AGTCGAGAAGGAGCAGCCTCTGG - Intronic
1080612924 11:33920615-33920637 AGTGGAAGAGGAGCAGCATGAGG + Intergenic
1081159563 11:39735670-39735692 ACCTGAGGAGGAGCAGTCTGGGG - Intergenic
1081856501 11:46307654-46307676 AGGTGAGGAGGAGTTGTCTGGGG - Intronic
1082992198 11:59216882-59216904 ACTTGAGGAGTAATGGCCTGTGG + Intergenic
1083623777 11:64061492-64061514 AGCCGGGGAGGAGCTGCCTGGGG - Intronic
1084146253 11:67266811-67266833 AGGTGAGGAGAAGCTGCCCGCGG + Exonic
1084885392 11:72202382-72202404 AGTAGAGTAGTAGCTGCCTGGGG + Intergenic
1085274128 11:75287374-75287396 AGCTGAGGAGGAGAGGCATAGGG + Exonic
1091390941 12:125750-125772 GGAGGAGGAGGAGCGGCCGGGGG + Exonic
1092062591 12:5563597-5563619 AGTTGGAGAGGCCCGGCCTGGGG + Intronic
1092280728 12:7096160-7096182 GGGTGAGGAGGAGCGGTCTGTGG + Exonic
1093607377 12:21109005-21109027 AGTTTGGGAGTAGCGGTCTGGGG + Intronic
1094334726 12:29336136-29336158 AGTTGAAGAGTCACGGCCTGAGG + Intronic
1095521628 12:43073778-43073800 AGTGGAAGAGGAGAGGCCTTAGG - Intergenic
1095980803 12:47973707-47973729 AGTTGAAGTGGAGAGGCCTTTGG - Intronic
1095999178 12:48114546-48114568 ACCTGAGGAGGAGCAGTCTGGGG + Intronic
1096105212 12:48993630-48993652 AGTTGAGGAAGGGCGGGGTGTGG - Intergenic
1096907274 12:54946991-54947013 ACCTGAGGAGGAGCAGTCTGGGG + Intergenic
1096911634 12:54990063-54990085 AGTGGAGGAGGAGAGATCTGAGG + Intergenic
1097694093 12:62760405-62760427 ACCGGAGGAGGAGCAGCCTGGGG - Intronic
1103743431 12:123106725-123106747 AGCTGAGGAGGAGCTCTCTGTGG + Intronic
1104464821 12:128981840-128981862 AGTTGAGGAGCTGAGGCTTGGGG + Intronic
1106526062 13:30542355-30542377 CGGTGAGGAGGGGCGCCCTGGGG - Intronic
1107558929 13:41543472-41543494 ATTTCAGGAGGGTCGGCCTGAGG + Intergenic
1107966880 13:45605089-45605111 AGTTGAGGGGGAGGGGCCTCGGG - Intronic
1108321402 13:49294313-49294335 AGGTGATGAGGTGGGGCCTGAGG + Intergenic
1108396763 13:49997311-49997333 GCCTGGGGAGGAGCGGCCTGCGG + Intronic
1110222749 13:73090590-73090612 AGAAGGGGAGGAGAGGCCTGTGG - Intergenic
1114488468 14:23079757-23079779 AGATGAGGAGGACCGGCTAGAGG + Exonic
1114647888 14:24265701-24265723 GGTTGAGGAGGACCAGCCTGGGG + Exonic
1116998072 14:51345198-51345220 AGTTGTTGAGGAGTGGCCTTTGG - Intergenic
1120230677 14:81837340-81837362 AGTGTAGGAAGAGGGGCCTGTGG + Intergenic
1121684932 14:95828896-95828918 AGAAGAGGAGGAGAGGCATGTGG - Intergenic
1122146079 14:99689571-99689593 AGATGAGGAGGAGCTGGTTGGGG - Intronic
1124553910 15:30708433-30708455 GGGTGAGGAGGGGCCGCCTGGGG + Intronic
1124677339 15:31697238-31697260 GGGTGAGGAGGGGCCGCCTGGGG - Intronic
1128008559 15:64269208-64269230 AGTTGAGGAGGAGTGACCTATGG - Intronic
1128074554 15:64818141-64818163 AGGTGAGGAGCAGGGGCCTTTGG + Intronic
1128349273 15:66878188-66878210 AGAGGAGAAGGAGGGGCCTGAGG + Intergenic
1129261097 15:74367746-74367768 AGTAGGGGAGGAGCTGTCTGCGG - Intergenic
1129356474 15:74995444-74995466 AGCTCAGGAGGAGCAGCCTTAGG + Intronic
1129525003 15:76208257-76208279 AGTTGCAGAGGAGCAGCCAGAGG + Intronic
1131116607 15:89799905-89799927 GGGAGAGGAGGAGCTGCCTGTGG - Intronic
1131200229 15:90389293-90389315 AGGTAAGGAGAAGGGGCCTGGGG + Intronic
1132785921 16:1656929-1656951 AGCTGAGGAGGCGCTGCTTGTGG - Exonic
1134572604 16:15304087-15304109 AGTGTTGGAGGAGGGGCCTGGGG + Intergenic
1134605040 16:15563803-15563825 AGTGTTGGAGGAGGGGCCTGGGG - Intronic
1134729778 16:16451936-16451958 AGTGTTGGAGGAGGGGCCTGGGG - Intergenic
1134937653 16:18259960-18259982 AGTGTTGGAGGAGGGGCCTGGGG + Intergenic
1136145477 16:28313855-28313877 AGAGGAGGAGGAGAGGCTTGGGG + Intronic
1136510759 16:30737114-30737136 AGAGGAGGAGGAGGGGCCGGGGG + Exonic
1141445435 16:84055013-84055035 AGGGGAGAAGGAGGGGCCTGTGG + Intronic
1141824693 16:86470954-86470976 AGCTGAAGAAGAGCTGCCTGGGG + Intergenic
1142515077 17:422485-422507 AGAAGGGGAGGAGGGGCCTGGGG + Intronic
1142985371 17:3691892-3691914 AGTTGAGGTGGAGCAGGCTCAGG + Intronic
1143614493 17:8041757-8041779 AGTTTAGGGGGAGCCGCCCGAGG - Intronic
1144473251 17:15563117-15563139 AGTTGAGGAGGAGCGGCCTGCGG - Intronic
1144923231 17:18781603-18781625 AGTTGAGGAGGAGCGGCCTGCGG + Intronic
1147019783 17:37521941-37521963 AGCTGAGCTGGAGCTGCCTGTGG + Intronic
1148582251 17:48752249-48752271 AGGTGAGGAGGGGCTGCCTGGGG + Intergenic
1149441305 17:56676741-56676763 AGATGAGGAGCAGAGGACTGGGG - Intergenic
1149997249 17:61411742-61411764 AGTGGAGGAGGAAGGGCTTGAGG - Exonic
1151201234 17:72469481-72469503 AGGTGAGGCGGAGAGGCCAGGGG - Intergenic
1151849630 17:76682782-76682804 AATTGAGAAGGAGGGGCCGGAGG - Intronic
1152020886 17:77779695-77779717 AGATGAGGGGGATCCGCCTGGGG + Intergenic
1152153226 17:78615987-78616009 ATCTGAGGTGGAGTGGCCTGAGG + Intergenic
1152453806 17:80401196-80401218 AGCTGAGGAGGAGCAGCCTGGGG - Intergenic
1154313702 18:13286825-13286847 AGCTGTGGAGAAGAGGCCTGGGG + Intronic
1159068800 18:63599410-63599432 AGTTGGGGAAGAGAGGCATGGGG - Intronic
1159928748 18:74291721-74291743 AGTTGGGGATGAGCGGCTTGGGG - Intronic
1161166592 19:2791150-2791172 AGAGGAGGAGGATCGGGCTGAGG - Intronic
1161661895 19:5551680-5551702 AGTTGTGGAGGAACGGATTGAGG - Intergenic
1163617962 19:18340874-18340896 AGTGGAGGAGGAGGAGCCTTGGG + Intronic
1164541051 19:29121861-29121883 ACATGAGGAGGAGTGGCCGGAGG + Intergenic
1166219064 19:41353735-41353757 AGTCGCCGAGGAGCAGCCTGAGG - Exonic
1166251028 19:41570883-41570905 AGTTCAGGTGGAGGGGACTGAGG + Intronic
1166371166 19:42302103-42302125 AGTTGAGGAGGCGCTGCCTAAGG - Intronic
1166592445 19:44012191-44012213 AGTTGAGGACTTGAGGCCTGAGG - Exonic
1166790510 19:45396147-45396169 AGGTGAGGAGGCGACGCCTGGGG - Exonic
1167374483 19:49103622-49103644 ATTTGGGGGGGAGCGGGCTGGGG + Intronic
1167494230 19:49808622-49808644 GGTGGAGGAGCAGCAGCCTGTGG + Exonic
1167593138 19:50415103-50415125 ATCTGAGGAGGAGGGGGCTGGGG - Intronic
1167690008 19:50979657-50979679 AGCTGAGGAGGCCAGGCCTGGGG + Intronic
1167775751 19:51553515-51553537 AGTTAAGGAGGGGCCGACTGTGG + Intergenic
1168248042 19:55124182-55124204 ACCTGAGGAGGAGCAGCCTGGGG - Intergenic
1168339013 19:55613390-55613412 AGGTGAGTAGGAGAGTCCTGGGG + Intronic
1168374382 19:55863593-55863615 AGTGTTGGAGGAGGGGCCTGGGG - Intronic
925084707 2:1099172-1099194 AGCAGGGGAGGAGTGGCCTGAGG - Intronic
925288647 2:2731668-2731690 AGTGGAGGAGGTGCTGGCTGTGG + Intergenic
925872950 2:8286391-8286413 AGATGGGAAGGAGAGGCCTGTGG - Intergenic
930099212 2:47590096-47590118 ACCTGAGGAGGAGCAGTCTGGGG + Intergenic
931666553 2:64613348-64613370 AGTGGAGGAGGAGAGAGCTGGGG - Intergenic
932412326 2:71554760-71554782 AGGTGAGGAGGAGCCTTCTGGGG + Intronic
932566807 2:72916067-72916089 AGGTGGGGAGGGGCGGCCAGGGG - Intergenic
932572507 2:72945469-72945491 AGTTGAGGTGGAGCAGCCCTGGG - Intronic
935605616 2:104969845-104969867 TGTTGAGGAGGTGTGGGCTGGGG - Intergenic
936092442 2:109510180-109510202 AGGTGTGGAGGAGAGGGCTGAGG + Intergenic
937867785 2:126767041-126767063 AGGGGAGGAGTAGCGGGCTGGGG - Intergenic
938104277 2:128519683-128519705 AGTGGAGCAGGTGGGGCCTGTGG - Intergenic
938406865 2:131037607-131037629 AGGAGAGGAGGAGTGGGCTGGGG - Intronic
939740027 2:145894625-145894647 AGTTGAGGAGAAAAGGACTGTGG + Intergenic
944250937 2:197579760-197579782 ACCTGAGGAGGAGCAGTCTGGGG - Intronic
944258320 2:197648154-197648176 AGATGAGGAGGAAGGGCCAGAGG + Intronic
944312749 2:198252612-198252634 AGTTGAGGACAGGCTGCCTGTGG + Intronic
946037500 2:216755599-216755621 GGTTGAGGAGGAGAGGCCGTGGG + Intergenic
946307719 2:218865674-218865696 AGGGGAGCAGGAGAGGCCTGTGG - Intronic
946879249 2:224160948-224160970 GGGTGAGGAGGAGAGGACTGTGG + Intergenic
948538875 2:238670939-238670961 AGATGAGTAGGAGGGGCATGAGG - Intergenic
948581657 2:238991298-238991320 AGGGGAGGAGGACTGGCCTGAGG - Intergenic
1168810999 20:704542-704564 AGTTGGGGAGGATGGGGCTGGGG - Intergenic
1170441667 20:16385687-16385709 AGTGGGGAAGGAGGGGCCTGGGG + Intronic
1172704914 20:36876067-36876089 AGATGAGAGGGAGAGGCCTGGGG - Intergenic
1172766072 20:37351553-37351575 AATTGAGCTGGAGTGGCCTGGGG + Intronic
1173865506 20:46309822-46309844 AGTTTAGTAGGAGGGGCCAGAGG - Intergenic
1173870322 20:46337750-46337772 AGTTGGGGAGGGGTGACCTGTGG + Intergenic
1175460069 20:59145872-59145894 AGTTGAGGAGGAGGAGGGTGAGG - Intergenic
1175881646 20:62262819-62262841 AGTTCAGCAGGAGAGCCCTGGGG + Intronic
1175892300 20:62321220-62321242 AGTGGAGGAGGCGGGGCCTGTGG + Intronic
1175892336 20:62321323-62321345 AGTGGAGGAGGTGCAGCCAGTGG + Intronic
1176023361 20:62973625-62973647 AGGTGAGTAGGAGAGCCCTGGGG - Intergenic
1177199971 21:17943321-17943343 CTTTGAGGAGGAGCAGGCTGGGG - Intronic
1178047705 21:28713562-28713584 AGTAAAGAAGGAGGGGCCTGGGG - Intergenic
1178582458 21:33848093-33848115 AGTCGAGGAGGCGCTGGCTGCGG - Intronic
1179906797 21:44426838-44426860 AGGTGAGCAGGAGGGGCCCGTGG + Intronic
1179923997 21:44522485-44522507 AGTTGAGAGGGAGGGGCCTCCGG - Intronic
1180079677 21:45480954-45480976 AGGTGAGGAGGCGGGGACTGGGG - Intronic
1180113828 21:45682722-45682744 AGATGAGGAGGAGCAGGCTAGGG + Intronic
1182261877 22:29078978-29079000 AGTCTAGGAGGAGCAGTCTGAGG + Intronic
1183752446 22:39729360-39729382 AGTAGAGGAGAGGCTGCCTGTGG + Intergenic
1184230270 22:43154963-43154985 AGGTGGGGTGGAGTGGCCTGCGG + Intronic
1184242246 22:43217357-43217379 ATTTGAGGAAGAGTGGGCTGGGG - Intronic
1185018207 22:48358062-48358084 AGCTGAGGAGAAGAGCCCTGGGG - Intergenic
1185381046 22:50507735-50507757 CGGTGAGGAGGCGGGGCCTGGGG - Intergenic
1185381119 22:50507915-50507937 CGGTGAGGAGGCGGGGCCTGGGG - Intergenic
1185415073 22:50705322-50705344 ATCTGAGGAGGGGCAGCCTGAGG - Intergenic
952296728 3:32068881-32068903 ACCTGAGGAGGAGCAGTCTGGGG - Intronic
953429844 3:42830139-42830161 ATTGGAGGAGGAGAGGCCTTGGG - Intronic
954842474 3:53524075-53524097 AGTTTAGAAGTAGCGACCTGAGG + Intronic
956129050 3:66037865-66037887 AGTTGAGGCCGTGCGCCCTGTGG - Intronic
956233590 3:67042768-67042790 ACCTGAGGAGGAGCAGTCTGGGG + Intergenic
957054794 3:75435227-75435249 GGGTCAGGAGGAGCGTCCTGGGG + Intergenic
957985606 3:87570999-87571021 ACCTGAGGAGGAGCAGTCTGGGG - Intergenic
958841447 3:99209873-99209895 ATTTGAGGAGCAGTGTCCTGAGG + Intergenic
960664143 3:120094145-120094167 AGTCGAGGAGCCGCTGCCTGGGG - Intronic
961343922 3:126248696-126248718 ACTTGAGGAGGAGCAGTCTGGGG - Intergenic
961553963 3:127685120-127685142 AGGTGAGCAGGAGCGGGCCGGGG - Intergenic
961888445 3:130111589-130111611 GGGTCAGGAGGAGCGTCCTGGGG + Intronic
962196006 3:133364236-133364258 AGTTGAGCAGGAAAGGCTTGTGG - Intronic
963108156 3:141664194-141664216 AGATGTGGAGGAGGGGCCGGTGG - Intergenic
963646160 3:147917443-147917465 ATTTGAGGAGGGGTGGTCTGAGG - Intergenic
964667622 3:159191307-159191329 AGATGAGGAGGAGGAGGCTGGGG + Intronic
966828808 3:183988444-183988466 AGTGGAGGGCGGGCGGCCTGGGG - Intronic
968622057 4:1608281-1608303 GGTTCAGGAGGGGCCGCCTGGGG - Intergenic
968939849 4:3632066-3632088 AGCTGGAGAGGAGGGGCCTGTGG - Intergenic
969343640 4:6557955-6557977 AGGGGAGGAGGAGAGGTCTGGGG - Intronic
969940273 4:10725012-10725034 GGGTGAGGAGGAGAGGCCTGTGG + Intergenic
971354904 4:25886611-25886633 AGTTGAGCTGGAGATGCCTGGGG - Intronic
974173514 4:58295387-58295409 ACCTGAGGAGGAGCAGTCTGGGG + Intergenic
976461618 4:85319354-85319376 ATCTGAGGAGGAGTGTCCTGTGG + Intergenic
977961204 4:103087459-103087481 AGCTGAGGAGGAGAGGGCTGAGG + Intronic
981056918 4:140373068-140373090 AGTTTCGGAGGAGGGGCGTGAGG + Intronic
981657944 4:147133381-147133403 AGGTGAGGATGAGGGGGCTGAGG - Intergenic
984934576 4:184879023-184879045 AGGTGAGGAGGAGCTGGCTGCGG - Intergenic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
986369064 5:7062345-7062367 ACCTGAGGAGGAGCAGTCTGGGG + Intergenic
986737480 5:10678791-10678813 ATTTGAGTGGGAGGGGCCTGAGG - Intergenic
987855327 5:23413078-23413100 AGATAAGGAGGAACTGCCTGGGG - Intergenic
987872029 5:23631659-23631681 ATTTTAGGAGGAGTGGCCTTTGG - Intergenic
990335173 5:54765273-54765295 AGTCAAGGAGGAGAAGCCTGAGG + Intergenic
990456557 5:55994783-55994805 GGTCGAGGCGGCGCGGCCTGAGG - Exonic
990496921 5:56357605-56357627 AGCTGAGGAGGAGGAGTCTGAGG + Intergenic
997437393 5:133885300-133885322 GGATGAGGAGGAGAGGCCTTGGG - Intergenic
1000393644 5:160750364-160750386 AGTGATGGAGGAGCGGGCTGGGG - Intronic
1002374741 5:178780693-178780715 TGTTCACGAGGAGCGGCATGTGG - Intergenic
1002531105 5:179845990-179846012 AATAGAGGAGGAGCGGTCTTTGG + Intronic
1002664685 5:180814427-180814449 TGCTGAGGAGGAGCAGCCAGAGG - Intronic
1004850997 6:19699104-19699126 AGAAGGGGAGGAGAGGCCTGAGG - Intergenic
1006457563 6:34140680-34140702 GGATGGGGAGGAGAGGCCTGGGG - Intronic
1006844802 6:37054801-37054823 AGTTGAGGAGAGGAGCCCTGTGG - Intergenic
1006950736 6:37819672-37819694 AGCCGAGGAGGAGGGGCGTGCGG - Exonic
1007576708 6:42929720-42929742 AGGTGAGGAGGCGGGGCCCGTGG + Exonic
1009288292 6:61851027-61851049 AGTTCAGGAGGAAGAGCCTGAGG - Intronic
1010011270 6:71051048-71051070 GGTAGAGGAGGAGCAGCCAGAGG - Intergenic
1011037016 6:82989160-82989182 AGTTAAGCAGGAGAGGCCTGTGG - Intronic
1013718188 6:112989463-112989485 ACTTGAGGAGGAGCAGGTTGGGG - Intergenic
1013808229 6:114016745-114016767 ACCTGAGGAGGAGCAGCCTGGGG + Intergenic
1013958215 6:115865800-115865822 ATTTGAGGAGGAGCTGCCCTGGG - Intergenic
1014303369 6:119711256-119711278 AGCTGAGGAGGAGGGGTTTGGGG - Intergenic
1014783657 6:125593136-125593158 AGAAGAGGAGGAGAGACCTGAGG + Intergenic
1017484437 6:154889865-154889887 AGTTGAGGAGGGCAGGTCTGAGG - Intronic
1017922995 6:158887456-158887478 AGCTGAGGAGGAGCAGTCTGGGG + Intronic
1018067373 6:160133558-160133580 CGTTGGGGAGGAGAGGCCAGTGG + Intronic
1018429904 6:163714137-163714159 AGTTGAGGTGGTGTGGGCTGAGG + Intergenic
1018651604 6:165996707-165996729 AGTGTTGGAGGAGGGGCCTGAGG - Intergenic
1019155233 6:170034112-170034134 ACTAGAGGAGGAGGGGCCAGTGG - Intergenic
1019595513 7:1856624-1856646 AGTTCAGGAGGAGCTGCTCGCGG + Intronic
1019600672 7:1882128-1882150 AGATGAGGAGGGGCAGCCTTGGG + Intronic
1020929541 7:14375590-14375612 AGGTGAGGAGGAAAGGCATGTGG - Intronic
1021824310 7:24532829-24532851 AGAAGAGGAGGAGAGACCTGAGG - Intergenic
1022536522 7:31101976-31101998 GGGGGAGGAGGAGCAGCCTGAGG - Intronic
1025004212 7:55342662-55342684 GGCTGAGGGGGGGCGGCCTGCGG + Intergenic
1028327998 7:89550288-89550310 AGATGAGAAGGAGTGGCATGGGG - Intergenic
1029172705 7:98642073-98642095 TGGTGAGGAGGGGCGCCCTGCGG - Intergenic
1029191048 7:98772591-98772613 TGTTGAGTAGGAGGGGCCTGTGG - Intergenic
1029503826 7:100950174-100950196 AGCTGGGGAGGAGCCGCCGGGGG - Intronic
1029986421 7:104927262-104927284 GGTAGAGCAGGAGCGGGCTGTGG + Intergenic
1032192914 7:129774621-129774643 CCTTGAGGAGGAGCAGGCTGGGG + Intergenic
1035467412 7:159088845-159088867 AGATGAGGAGCTGAGGCCTGAGG - Intronic
1035467422 7:159088883-159088905 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467430 7:159088921-159088943 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467438 7:159088959-159088981 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467446 7:159088997-159089019 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467454 7:159089035-159089057 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467462 7:159089073-159089095 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467470 7:159089111-159089133 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467478 7:159089149-159089171 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467486 7:159089187-159089209 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467494 7:159089225-159089247 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467502 7:159089263-159089285 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467510 7:159089301-159089323 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467518 7:159089339-159089361 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467526 7:159089377-159089399 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467534 7:159089415-159089437 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1035467542 7:159089453-159089475 AGATGAGGAGCCGAGGCCTGAGG - Intronic
1036177077 8:6549452-6549474 TATTGACGAGGAGGGGCCTGAGG + Intronic
1036379654 8:8228466-8228488 GGGTCAGGAGGAGCGTCCTGGGG - Intergenic
1036541569 8:9718389-9718411 AGTTTAGGAGAAGTGGCCTCAGG + Intronic
1036658137 8:10690827-10690849 AGTGGAGGAGGAGAGGAATGAGG - Intronic
1038779455 8:30557678-30557700 AGTGGAGAAGGTGAGGCCTGTGG - Intronic
1039468978 8:37802117-37802139 AGTTGAGGAAGATGGGCCTCAGG + Intronic
1040647928 8:49421117-49421139 ACCTGAGGAGGAGCAGTCTGGGG - Intergenic
1041651940 8:60310593-60310615 ACCTGAGGAGGAGCAGCCTGGGG + Intergenic
1043597548 8:81902583-81902605 ACCTGATGAGGAGCAGCCTGGGG + Intergenic
1045059984 8:98402946-98402968 AGAAGAGGAGGAGCAGCCTCTGG + Intronic
1046826335 8:118695863-118695885 AGTGTTGGAGGAGTGGCCTGGGG - Intergenic
1049595875 8:143483127-143483149 AGCAGAAGAGGAGCGGCCGGGGG + Intronic
1052370981 9:27664213-27664235 AATTGAGGAGGAGGGGGATGGGG - Intergenic
1053134060 9:35638313-35638335 ACCTGAGGAGGAGCAGTCTGGGG - Intronic
1053141402 9:35684972-35684994 AGCTGAGAAAGAGCAGCCTGCGG + Intronic
1054784788 9:69200324-69200346 AACTGAGGATGAGAGGCCTGGGG - Intronic
1055654718 9:78440861-78440883 GGTTGAGGAGGAGTGGGCTCAGG + Intergenic
1056655089 9:88502638-88502660 AGGGGAGGAGGTGTGGCCTGGGG - Intergenic
1057294861 9:93828922-93828944 AATGGAGAAGGAGCTGCCTGAGG + Intergenic
1057810500 9:98253519-98253541 AGTTGAAGAGCAGAGGCCCGAGG - Intronic
1061059876 9:128245013-128245035 GGCTGAGAAGGAGGGGCCTGAGG + Intronic
1061096063 9:128457155-128457177 AGTAGAGGCTGAGCGACCTGGGG - Intronic
1061297856 9:129686783-129686805 GGTGGAGGAGGGGCGGCCGGTGG - Intronic
1061626320 9:131842678-131842700 AATTGATGGGGAGTGGCCTGGGG + Intergenic
1061958852 9:133977872-133977894 AGCTGAGGGGCAGAGGCCTGAGG - Intronic
1062444874 9:136589381-136589403 AGTGGAGGAGGCACGGTCTGAGG + Intergenic
1062534112 9:137014099-137014121 GGTTGCGGGGGAGCGGCATGAGG - Intronic
1062568853 9:137175326-137175348 CATTGAGGAGGAGCGGCCTCAGG - Exonic
1062618614 9:137409185-137409207 AGAGGAGGAGGAGAGGCCTGAGG + Intronic
1185457654 X:318825-318847 ACGTGATGAGGAGCGGCCTGTGG - Intergenic
1185710931 X:2303302-2303324 AGTGTTGGAGGAGTGGCCTGGGG + Intronic
1189031908 X:37459876-37459898 ACCTGAGGAGGAGCAGTCTGGGG + Intronic
1189275092 X:39779643-39779665 GCTGGAGGAGGAGCGGGCTGGGG - Intergenic
1192536425 X:71932350-71932372 AGATGAGGGCGAGCTGCCTGAGG + Intergenic
1192565370 X:72158913-72158935 ATGTGAGGAGCAGCGTCCTGAGG + Intergenic
1200216543 X:154370593-154370615 AGCCGCGGAGGCGCGGCCTGCGG + Intronic
1201234344 Y:11895224-11895246 ACCTGAGGAGGAGCAGTCTGGGG + Intergenic