ID: 1144923421 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:18782966-18782988 |
| Sequence | CTCCATCTTCAATAGGAGCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2375 | |||
| Summary | {0: 5, 1: 323, 2: 745, 3: 735, 4: 567} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1144923421_1144923426 | 25 | Left | 1144923421 | 17:18782966-18782988 | CCCAGCTCCTATTGAAGATGGAG | 0: 5 1: 323 2: 745 3: 735 4: 567 |
||
| Right | 1144923426 | 17:18783014-18783036 | ATTTGAACCTGCGCCCAGGCCGG | 0: 2 1: 0 2: 0 3: 8 4: 109 |
||||
| 1144923421_1144923425 | 21 | Left | 1144923421 | 17:18782966-18782988 | CCCAGCTCCTATTGAAGATGGAG | 0: 5 1: 323 2: 745 3: 735 4: 567 |
||
| Right | 1144923425 | 17:18783010-18783032 | TGACATTTGAACCTGCGCCCAGG | 0: 2 1: 0 2: 1 3: 3 4: 80 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1144923421 | Original CRISPR | CTCCATCTTCAATAGGAGCT GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||