ID: 1144923421

View in Genome Browser
Species Human (GRCh38)
Location 17:18782966-18782988
Sequence CTCCATCTTCAATAGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2375
Summary {0: 5, 1: 323, 2: 745, 3: 735, 4: 567}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144923421_1144923426 25 Left 1144923421 17:18782966-18782988 CCCAGCTCCTATTGAAGATGGAG 0: 5
1: 323
2: 745
3: 735
4: 567
Right 1144923426 17:18783014-18783036 ATTTGAACCTGCGCCCAGGCCGG 0: 2
1: 0
2: 0
3: 8
4: 109
1144923421_1144923425 21 Left 1144923421 17:18782966-18782988 CCCAGCTCCTATTGAAGATGGAG 0: 5
1: 323
2: 745
3: 735
4: 567
Right 1144923425 17:18783010-18783032 TGACATTTGAACCTGCGCCCAGG 0: 2
1: 0
2: 1
3: 3
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144923421 Original CRISPR CTCCATCTTCAATAGGAGCT GGG (reversed) Intronic
Too many off-targets to display for this crispr