ID: 1144926808

View in Genome Browser
Species Human (GRCh38)
Location 17:18818435-18818457
Sequence GTCATGCACTGACAATGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144926808_1144926819 20 Left 1144926808 17:18818435-18818457 CCTTCCCATTGTCAGTGCATGAC No data
Right 1144926819 17:18818478-18818500 GCACTCAATAAACATTTATTGGG No data
1144926808_1144926813 -2 Left 1144926808 17:18818435-18818457 CCTTCCCATTGTCAGTGCATGAC No data
Right 1144926813 17:18818456-18818478 ACCCAGTGCCGGGCACCTAATGG No data
1144926808_1144926818 19 Left 1144926808 17:18818435-18818457 CCTTCCCATTGTCAGTGCATGAC No data
Right 1144926818 17:18818477-18818499 GGCACTCAATAAACATTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144926808 Original CRISPR GTCATGCACTGACAATGGGA AGG (reversed) Intergenic