ID: 1144926809

View in Genome Browser
Species Human (GRCh38)
Location 17:18818439-18818461
Sequence CTGGGTCATGCACTGACAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144926809_1144926819 16 Left 1144926809 17:18818439-18818461 CCCATTGTCAGTGCATGACCCAG No data
Right 1144926819 17:18818478-18818500 GCACTCAATAAACATTTATTGGG No data
1144926809_1144926818 15 Left 1144926809 17:18818439-18818461 CCCATTGTCAGTGCATGACCCAG No data
Right 1144926818 17:18818477-18818499 GGCACTCAATAAACATTTATTGG No data
1144926809_1144926813 -6 Left 1144926809 17:18818439-18818461 CCCATTGTCAGTGCATGACCCAG No data
Right 1144926813 17:18818456-18818478 ACCCAGTGCCGGGCACCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144926809 Original CRISPR CTGGGTCATGCACTGACAAT GGG (reversed) Intergenic