ID: 1144926813

View in Genome Browser
Species Human (GRCh38)
Location 17:18818456-18818478
Sequence ACCCAGTGCCGGGCACCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144926810_1144926813 -7 Left 1144926810 17:18818440-18818462 CCATTGTCAGTGCATGACCCAGT No data
Right 1144926813 17:18818456-18818478 ACCCAGTGCCGGGCACCTAATGG No data
1144926809_1144926813 -6 Left 1144926809 17:18818439-18818461 CCCATTGTCAGTGCATGACCCAG No data
Right 1144926813 17:18818456-18818478 ACCCAGTGCCGGGCACCTAATGG No data
1144926807_1144926813 15 Left 1144926807 17:18818418-18818440 CCTATCTTTGTCATTCGCCTTCC No data
Right 1144926813 17:18818456-18818478 ACCCAGTGCCGGGCACCTAATGG No data
1144926808_1144926813 -2 Left 1144926808 17:18818435-18818457 CCTTCCCATTGTCAGTGCATGAC No data
Right 1144926813 17:18818456-18818478 ACCCAGTGCCGGGCACCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144926813 Original CRISPR ACCCAGTGCCGGGCACCTAA TGG Intergenic