ID: 1144926816

View in Genome Browser
Species Human (GRCh38)
Location 17:18818464-18818486
Sequence ATTGAGTGCCATTAGGTGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144926816_1144926819 -9 Left 1144926816 17:18818464-18818486 CCGGGCACCTAATGGCACTCAAT No data
Right 1144926819 17:18818478-18818500 GCACTCAATAAACATTTATTGGG No data
1144926816_1144926818 -10 Left 1144926816 17:18818464-18818486 CCGGGCACCTAATGGCACTCAAT No data
Right 1144926818 17:18818477-18818499 GGCACTCAATAAACATTTATTGG No data
1144926816_1144926820 18 Left 1144926816 17:18818464-18818486 CCGGGCACCTAATGGCACTCAAT No data
Right 1144926820 17:18818505-18818527 TGCCCGCCTTTTAACAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144926816 Original CRISPR ATTGAGTGCCATTAGGTGCC CGG (reversed) Intergenic