ID: 1144926817

View in Genome Browser
Species Human (GRCh38)
Location 17:18818471-18818493
Sequence AATGTTTATTGAGTGCCATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144926817_1144926820 11 Left 1144926817 17:18818471-18818493 CCTAATGGCACTCAATAAACATT No data
Right 1144926820 17:18818505-18818527 TGCCCGCCTTTTAACAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144926817 Original CRISPR AATGTTTATTGAGTGCCATT AGG (reversed) Intergenic