ID: 1144926818

View in Genome Browser
Species Human (GRCh38)
Location 17:18818477-18818499
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144926810_1144926818 14 Left 1144926810 17:18818440-18818462 CCATTGTCAGTGCATGACCCAGT No data
Right 1144926818 17:18818477-18818499 GGCACTCAATAAACATTTATTGG No data
1144926808_1144926818 19 Left 1144926808 17:18818435-18818457 CCTTCCCATTGTCAGTGCATGAC No data
Right 1144926818 17:18818477-18818499 GGCACTCAATAAACATTTATTGG No data
1144926815_1144926818 -4 Left 1144926815 17:18818458-18818480 CCAGTGCCGGGCACCTAATGGCA No data
Right 1144926818 17:18818477-18818499 GGCACTCAATAAACATTTATTGG No data
1144926814_1144926818 -3 Left 1144926814 17:18818457-18818479 CCCAGTGCCGGGCACCTAATGGC No data
Right 1144926818 17:18818477-18818499 GGCACTCAATAAACATTTATTGG No data
1144926816_1144926818 -10 Left 1144926816 17:18818464-18818486 CCGGGCACCTAATGGCACTCAAT No data
Right 1144926818 17:18818477-18818499 GGCACTCAATAAACATTTATTGG No data
1144926809_1144926818 15 Left 1144926809 17:18818439-18818461 CCCATTGTCAGTGCATGACCCAG No data
Right 1144926818 17:18818477-18818499 GGCACTCAATAAACATTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144926818 Original CRISPR GGCACTCAATAAACATTTAT TGG Intergenic
No off target data available for this crispr