ID: 1144926820

View in Genome Browser
Species Human (GRCh38)
Location 17:18818505-18818527
Sequence TGCCCGCCTTTTAACAGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144926814_1144926820 25 Left 1144926814 17:18818457-18818479 CCCAGTGCCGGGCACCTAATGGC No data
Right 1144926820 17:18818505-18818527 TGCCCGCCTTTTAACAGTGTAGG No data
1144926816_1144926820 18 Left 1144926816 17:18818464-18818486 CCGGGCACCTAATGGCACTCAAT No data
Right 1144926820 17:18818505-18818527 TGCCCGCCTTTTAACAGTGTAGG No data
1144926817_1144926820 11 Left 1144926817 17:18818471-18818493 CCTAATGGCACTCAATAAACATT No data
Right 1144926820 17:18818505-18818527 TGCCCGCCTTTTAACAGTGTAGG No data
1144926815_1144926820 24 Left 1144926815 17:18818458-18818480 CCAGTGCCGGGCACCTAATGGCA No data
Right 1144926820 17:18818505-18818527 TGCCCGCCTTTTAACAGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144926820 Original CRISPR TGCCCGCCTTTTAACAGTGT AGG Intergenic