ID: 1144928690

View in Genome Browser
Species Human (GRCh38)
Location 17:18837439-18837461
Sequence CCCCAGGTAAACAGGTATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144928690_1144928696 -6 Left 1144928690 17:18837439-18837461 CCTAGATACCTGTTTACCTGGGG No data
Right 1144928696 17:18837456-18837478 CTGGGGAAAGATGAGGATGAGGG No data
1144928690_1144928695 -7 Left 1144928690 17:18837439-18837461 CCTAGATACCTGTTTACCTGGGG No data
Right 1144928695 17:18837455-18837477 CCTGGGGAAAGATGAGGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144928690 Original CRISPR CCCCAGGTAAACAGGTATCT AGG (reversed) Intergenic
No off target data available for this crispr