ID: 1144929377

View in Genome Browser
Species Human (GRCh38)
Location 17:18846607-18846629
Sequence CAAGTGGCCCACATTGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 2, 1: 1, 2: 2, 3: 17, 4: 62}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144929372_1144929377 30 Left 1144929372 17:18846554-18846576 CCCAGGCTTGTGGATTGGAGCGA 0: 3
1: 1
2: 1
3: 11
4: 115
Right 1144929377 17:18846607-18846629 CAAGTGGCCCACATTGATATTGG 0: 2
1: 1
2: 2
3: 17
4: 62
1144929373_1144929377 29 Left 1144929373 17:18846555-18846577 CCAGGCTTGTGGATTGGAGCGAG 0: 3
1: 1
2: 0
3: 5
4: 86
Right 1144929377 17:18846607-18846629 CAAGTGGCCCACATTGATATTGG 0: 2
1: 1
2: 2
3: 17
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144929377 Original CRISPR CAAGTGGCCCACATTGATAT TGG Intronic
900468117 1:2835617-2835639 CAAGTGGCCCCCACTGAGAATGG + Intergenic
908249326 1:62252700-62252722 CAGGTGACCCACCTTGATCTTGG - Intronic
908995439 1:70147107-70147129 GAAGTGCCACACATTGATTTGGG - Intronic
917250808 1:173058544-173058566 CAACTGTCCCACATTTGTATAGG - Intergenic
920714781 1:208329554-208329576 CAATTAGCCTACATTGACATAGG + Intergenic
1074330328 10:112500687-112500709 CAAGAGTCCAACATTGATCTAGG - Intronic
1074549669 10:114430730-114430752 AAAGTGGCCCACACTCATAGTGG + Intergenic
1075653649 10:124147005-124147027 CAAGTGGCTGACATTGCTAGTGG + Intergenic
1091521701 12:1251629-1251651 AAAGTGGCCCAGTTTGAGATAGG - Intronic
1091819072 12:3460964-3460986 CAAGTTGCCCACATTTTTCTGGG + Intronic
1100156655 12:91807098-91807120 CAAGTGGACCTGATAGATATTGG + Intergenic
1100809556 12:98324993-98325015 CAAGTGGTCCACATTGGTGTTGG + Intergenic
1102299375 12:111759827-111759849 CAAATGGCCCAAATTCAAATGGG + Intronic
1104266006 12:127233026-127233048 TGTGTGGCTCACATTGATATAGG + Intergenic
1104973476 12:132541784-132541806 CAAGGGGCCCACCTTCATTTGGG - Intronic
1108863144 13:54887603-54887625 CAATAAGCCCACATTGACATAGG - Intergenic
1109466257 13:62736058-62736080 CAAGTGGCCCACATAGAACATGG + Intergenic
1109548521 13:63860694-63860716 AAAGTGGTCCATATTGATTTTGG - Intergenic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123554523 15:21414585-21414607 TAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1126879443 15:53078682-53078704 CAAGGAGCCCACATTCTTATGGG + Intergenic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1139160850 16:64507199-64507221 CAAGTGGCCCACACTGGTGCTGG + Intergenic
1144611042 17:16715910-16715932 CAAGTGGCGCACGTTGATATTGG + Intronic
1144901695 17:18599453-18599475 CAAGTGGCCCACATTGATATTGG - Intergenic
1144929377 17:18846607-18846629 CAAGTGGCCCACATTGATATTGG + Intronic
1145130809 17:20346614-20346636 CAAGTGGTCCACATTGATATTGG + Intergenic
1148067965 17:44886966-44886988 CCAGTGGCCCACATTCAGAAAGG - Intronic
1153376825 18:4390315-4390337 CAAGTGTACCACTGTGATATGGG - Intronic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1156635461 18:39022823-39022845 CAAGGGGCCCACATTAAAATGGG - Intergenic
1157602101 18:48900167-48900189 TAAGTGTACCACATTGATATGGG + Intergenic
1165473598 19:36017103-36017125 CAAGAGGCCCAGATGGGTATTGG - Intronic
926845498 2:17133223-17133245 CAAGTGGCCCACCTTTATCACGG + Intergenic
926932246 2:18052348-18052370 CAAGTTCTCCACATTGCTATAGG - Intronic
933456078 2:82521192-82521214 GAAGTGGCCTACATTCAAATTGG - Intergenic
935414061 2:102796676-102796698 CAAGTGGCCAGCACTGGTATGGG + Intronic
937176178 2:119938013-119938035 CAAATGCCCAACATTCATATTGG - Intronic
938283045 2:130080844-130080866 CAAGCTGCTCACACTGATATTGG - Intronic
938356141 2:130651273-130651295 CAAGCTGCTCACACTGATATTGG + Intronic
938432565 2:131258055-131258077 CAAGCTGCTCACACTGATATTGG + Intronic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
943843083 2:192604373-192604395 CAAGTAGTGCCCATTGATATAGG + Intergenic
944679141 2:202061013-202061035 CCAGTGTCCCACATTGCTTTGGG + Intergenic
1170039532 20:12025470-12025492 CAAGTGCCCCACATAAATCTTGG + Intergenic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1177575787 21:22953700-22953722 CAATTAGCCCACTTTCATATTGG + Intergenic
1179231061 21:39504247-39504269 CAAGGGGCAAACATTGATGTAGG + Intronic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
950847384 3:16027934-16027956 CGAGTGAGCCACATGGATATCGG - Intergenic
952146957 3:30543426-30543448 AAAGAGGCCCACATTATTATGGG + Intergenic
955424983 3:58778495-58778517 CAAGTGGTCCACACTGGTGTTGG - Intronic
963579824 3:147111277-147111299 CATGTGGCCCACAAGAATATGGG - Intergenic
967842342 3:194016669-194016691 CAAGTGCCCCATATTTCTATTGG - Intergenic
969288888 4:6226128-6226150 CAAGTGGCTCACAGTGCCATGGG - Intergenic
971297525 4:25410958-25410980 CAAGTGGCAGAAATTGCTATAGG - Intronic
971708616 4:30081772-30081794 CACTTGGCACACTTTGATATTGG - Intergenic
973207019 4:47572183-47572205 CAAGTGGCAGACATTGGGATAGG + Exonic
973547142 4:51993289-51993311 CTAGTTGCCCAAATTCATATAGG - Intergenic
976065320 4:81180657-81180679 CAAGTGTCCCACATTGATTCTGG + Intronic
976442561 4:85092263-85092285 CATGTTGCCCACGTTGATCTTGG + Intergenic
981118260 4:141017453-141017475 CAAATGTACCACATTAATATGGG - Intronic
985142464 4:186856267-186856289 CATTTGGCCAAGATTGATATAGG + Intergenic
991947789 5:71916448-71916470 CAAGTGGTCCACATTGGTATTGG - Intergenic
1003128507 6:3375496-3375518 CCACTGGCCCACATTGATTCTGG - Intronic
1003383949 6:5650235-5650257 AATGTGGCCCACTTTGACATCGG - Intronic
1006216409 6:32447078-32447100 CAAGTGTACCACATTAATACAGG - Intergenic
1020781647 7:12523662-12523684 CAAGTGGCCAACTCTGAGATAGG + Intergenic
1021725351 7:23543255-23543277 GAAGTGGCCCACATTGTGTTTGG - Intergenic
1022021719 7:26406096-26406118 CATCTGTCCCACATTGATATTGG + Intergenic
1022870327 7:34471562-34471584 CAAGTGGTCCACACTGGTGTTGG + Intergenic
1031125372 7:117767954-117767976 CAAGTGGTAAACATTGATACAGG - Intronic
1039427336 8:37496468-37496490 AAAGTGGACCACATTGACAAAGG + Intergenic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1047345341 8:124022463-124022485 CAAGTGGCCCATTATGTTATGGG - Intronic
1048552955 8:135450631-135450653 CATGTGGCTCACATTAATTTTGG + Intergenic
1053019258 9:34683673-34683695 GAAGAGGCCCATAATGATATTGG + Intergenic
1062138108 9:134940315-134940337 TAAGGGGCCCACATTGAAATAGG + Intergenic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1188033495 X:25290986-25291008 CATTTTGCCCACATTGATTTGGG - Intergenic
1192216398 X:69162336-69162358 CGAGTGGCCCTCATTGTCATTGG + Exonic