ID: 1144938151

View in Genome Browser
Species Human (GRCh38)
Location 17:18916792-18916814
Sequence CAGTAACAAGGTGCCACCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 110}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144938151_1144938153 -10 Left 1144938151 17:18916792-18916814 CCTGAGGTGGCACCTTGTTACTG 0: 1
1: 0
2: 3
3: 11
4: 110
Right 1144938153 17:18916805-18916827 CTTGTTACTGTGTCCTCAGATGG 0: 1
1: 4
2: 128
3: 1178
4: 3072
1144938151_1144938158 19 Left 1144938151 17:18916792-18916814 CCTGAGGTGGCACCTTGTTACTG 0: 1
1: 0
2: 3
3: 11
4: 110
Right 1144938158 17:18916834-18916856 GAGCAAGGCAGCTCTCTGTAAGG 0: 1
1: 0
2: 1
3: 15
4: 166
1144938151_1144938154 -7 Left 1144938151 17:18916792-18916814 CCTGAGGTGGCACCTTGTTACTG 0: 1
1: 0
2: 3
3: 11
4: 110
Right 1144938154 17:18916808-18916830 GTTACTGTGTCCTCAGATGGTGG 0: 1
1: 3
2: 40
3: 425
4: 1274
1144938151_1144938157 4 Left 1144938151 17:18916792-18916814 CCTGAGGTGGCACCTTGTTACTG 0: 1
1: 0
2: 3
3: 11
4: 110
Right 1144938157 17:18916819-18916841 CTCAGATGGTGGAAGGAGCAAGG 0: 2
1: 11
2: 137
3: 387
4: 1188
1144938151_1144938159 20 Left 1144938151 17:18916792-18916814 CCTGAGGTGGCACCTTGTTACTG 0: 1
1: 0
2: 3
3: 11
4: 110
Right 1144938159 17:18916835-18916857 AGCAAGGCAGCTCTCTGTAAGGG 0: 1
1: 0
2: 1
3: 19
4: 421
1144938151_1144938155 -3 Left 1144938151 17:18916792-18916814 CCTGAGGTGGCACCTTGTTACTG 0: 1
1: 0
2: 3
3: 11
4: 110
Right 1144938155 17:18916812-18916834 CTGTGTCCTCAGATGGTGGAAGG 0: 7
1: 285
2: 807
3: 1675
4: 2421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144938151 Original CRISPR CAGTAACAAGGTGCCACCTC AGG (reversed) Intronic
900579418 1:3401157-3401179 CAGCAAGGAGGTGCCACTTCTGG + Intronic
900737616 1:4308994-4309016 CAGGAACAAGAAGCCATCTCTGG - Intergenic
902220253 1:14959997-14960019 CAGTGACAAGGTGACACCGTGGG - Intronic
902533372 1:17104865-17104887 CAGTGACAAGGTACCACGGCGGG - Exonic
902790038 1:18761632-18761654 CATTCACATGGTGCCACCTTTGG + Intergenic
903078015 1:20787041-20787063 CAGACAAAAGGCGCCACCTCCGG + Intronic
907598654 1:55744956-55744978 CAGCAACAAGCTGCCATCTTGGG - Intergenic
907918887 1:58895189-58895211 TATTAACAAGGTGTCACTTCTGG - Intergenic
908279382 1:62515572-62515594 CAGTAACACAGTGACATCTCTGG + Intronic
909114959 1:71521846-71521868 CAGTCACTAGGTGGCACCTCTGG - Intronic
909535024 1:76726742-76726764 CAAGAACAAAGTGCCACCTGGGG - Intergenic
909554570 1:76939243-76939265 CATTAACAAGGAGCCAGTTCTGG + Intronic
910246882 1:85148581-85148603 CAGTGGCCATGTGCCACCTCTGG - Intergenic
912706633 1:111919806-111919828 CAGTCCCAAGATGCCATCTCAGG - Intronic
913169725 1:116221462-116221484 CTGTAACAAGGAGGCTCCTCAGG - Intergenic
920918367 1:210276961-210276983 CAGCAAGAAGGTGCCATCTATGG + Intergenic
1063099413 10:2936277-2936299 GAATAACAAGGAGCCACCGCGGG + Intergenic
1065173320 10:23053303-23053325 GAGTCACAAGGTTCCACCCCTGG + Intergenic
1076398088 10:130156223-130156245 CGGCAACAAGGTGCCATCTTGGG - Intronic
1076498899 10:130919421-130919443 CAGTAGGAAGGAGCCACTTCAGG - Intergenic
1077047528 11:553004-553026 CAGAAAGAAGGAGCCACCCCAGG + Intronic
1085358639 11:75864475-75864497 CAGTAACAACGTGCCATCTCTGG - Intronic
1087212321 11:95456803-95456825 AAATGACAATGTGCCACCTCTGG + Intergenic
1088236606 11:107731849-107731871 CAGACACAAGGTTCAACCTCAGG + Intergenic
1089701027 11:120243825-120243847 GATCAACAAGGTGCCACTTCAGG - Intronic
1090302933 11:125662257-125662279 CAGTAAAAAGGTGACATCTATGG - Intronic
1091712477 12:2751893-2751915 CAGAAGAAAGGTGCCCCCTCTGG + Intergenic
1091727273 12:2854875-2854897 AAGTAAGACGGTGCCTCCTCAGG - Intronic
1092141238 12:6184942-6184964 CAGTAGCAAGGTGCTTCTTCTGG + Intergenic
1094809388 12:34123037-34123059 CAGTTACAAGGTGGCAGGTCAGG - Intergenic
1095190510 12:39252484-39252506 CAGTAACAAGGTCATACTTCTGG - Intergenic
1096055900 12:48651680-48651702 CAGTAACATGGTGCAGCCTGAGG + Intergenic
1098547213 12:71724970-71724992 AAGTAAGAAGGAGCCACATCAGG + Intergenic
1098896871 12:76072964-76072986 GAGAAACAAGGTGAAACCTCAGG + Intronic
1103217894 12:119217375-119217397 CAGGAACAAGATGACACCACAGG + Intronic
1103933922 12:124465398-124465420 CAGACACAAGGTTCCACCTTGGG + Intronic
1104026237 12:125028597-125028619 CAGTTAGTAGGTGTCACCTCAGG + Exonic
1104107741 12:125680171-125680193 CAGAAGCCAGGTGCTACCTCTGG - Intergenic
1109682789 13:65774572-65774594 CAGCAACAAGGTACCATCTATGG + Intergenic
1113911782 13:113845100-113845122 CAGTAGCCAGGTGCCACGTAGGG - Intronic
1114260004 14:21029776-21029798 CAGCAAGAAGGTGCCATCTATGG + Intronic
1114990390 14:28279380-28279402 CAGTAACAAGTTTCCACATTTGG - Intergenic
1120483634 14:85083427-85083449 CAATCACAAGGTGCCACAACAGG - Intergenic
1129275339 15:74441762-74441784 CAGCAACAAGAAGCCACCTCAGG + Intergenic
1131448326 15:92518291-92518313 TTGTAACAAGGTTCCACCTCAGG + Intergenic
1133817991 16:9212795-9212817 CAATAACCAGGTGCCATCACCGG - Intergenic
1135933718 16:26761380-26761402 CAATATCAAGGTGCCACCTGTGG - Intergenic
1137674743 16:50298754-50298776 CAGTCACCAGGAGCCACTTCTGG - Intronic
1140639710 16:76957964-76957986 CAGTAACTGGCTGCCACATCTGG - Intergenic
1143210425 17:5182825-5182847 GTGTAACAAGGTGTGACCTCTGG + Exonic
1143823631 17:9586160-9586182 CAGTCACAAGCTGCAACCTCGGG - Intronic
1144938151 17:18916792-18916814 CAGTAACAAGGTGCCACCTCAGG - Intronic
1152790741 17:82277735-82277757 CTGTAACAAGCTGTCATCTCGGG + Intergenic
1153319890 18:3762027-3762049 TAGCAACAAAGTGCCTCCTCAGG - Intronic
1156761289 18:40594307-40594329 CAGTAAGAAAGTGCCATCTATGG + Intergenic
1158400347 18:57116166-57116188 CAGCAACAAGGTGTCATCTATGG - Intergenic
926926927 2:17996379-17996401 CCTTGACAGGGTGCCACCTCTGG - Intronic
927264509 2:21129881-21129903 CAGGGTCAAGGGGCCACCTCTGG + Intronic
931201096 2:60097916-60097938 CATTTACAAGGTGTCACCTTTGG + Intergenic
933405224 2:81849624-81849646 AATTGACAAGGTGCCACCTCAGG + Intergenic
937236298 2:120433584-120433606 CAGGGACACGGTGCCACCTCGGG - Intergenic
937916540 2:127101947-127101969 CAGGAAGAAGGTGCCACATGTGG + Intronic
946794764 2:223338457-223338479 CAGCAATAAGTTGCAACCTCAGG + Intergenic
1174484340 20:50851804-50851826 CAGTCACACGGTCCCACCCCTGG + Intronic
1179450984 21:41468278-41468300 CAGTGACACGGAGCCAGCTCGGG - Intronic
1179895962 21:44363904-44363926 CAGTAACAAGAAGCCTCCCCAGG - Intronic
1180571196 22:16721768-16721790 AAGCAAGAAGGTGCCACCTTGGG + Intergenic
1182071190 22:27464913-27464935 CAGTAAGGAGGAGCCACCACAGG + Intergenic
1182095054 22:27620449-27620471 CAGGAACAAGGTGCAGCCCCGGG - Intergenic
1184175090 22:42784545-42784567 CAGTAGCATGGCGGCACCTCAGG + Intergenic
950561234 3:13728087-13728109 CAGTAACAAACTGTCAGCTCTGG - Intergenic
950640814 3:14346987-14347009 CAGTGAGCAGGTGCCCCCTCAGG + Intergenic
950964800 3:17138763-17138785 CAGGCACAAGGGGCCCCCTCAGG - Intergenic
952712399 3:36444560-36444582 AAGTCACAGTGTGCCACCTCCGG - Intronic
952717372 3:36493848-36493870 CATTAAGAAAGAGCCACCTCTGG + Intronic
953101234 3:39830357-39830379 CAGCAACAAGGATCCACCTGAGG - Intronic
954443787 3:50535821-50535843 CACAGACAAGGTGCCATCTCTGG + Intergenic
955028922 3:55197824-55197846 CAGTCACTAGATGTCACCTCAGG - Intergenic
955768970 3:62371371-62371393 CAGTAAGGAGAGGCCACCTCGGG + Intronic
956349638 3:68320636-68320658 CAGTAACAGGGAGCCACCTCTGG - Intronic
957106994 3:75902643-75902665 AAGCAAGAAGGTGCCACCTCAGG - Intergenic
960092072 3:113650897-113650919 TAGAAAAAAGGTGCCATCTCTGG + Exonic
963019347 3:140857566-140857588 CAGTGACAAGGTGCCATCTTTGG - Intergenic
963894241 3:150668329-150668351 GAGTATCAAGGAGCCATCTCAGG + Intronic
968516712 4:1018604-1018626 CAGCAGCACTGTGCCACCTCCGG - Intronic
970058292 4:12000290-12000312 CAGAATCAAGGTACTACCTCAGG - Intergenic
970253080 4:14137058-14137080 CAGAAACAAGGAGGGACCTCTGG + Intergenic
970318165 4:14849105-14849127 CAGTGACAGTGTGCCAGCTCTGG + Intergenic
977886057 4:102252763-102252785 CAGTAATAAAGTGCCACAACTGG + Intronic
979771474 4:124530407-124530429 AAGTAACCCGGTGTCACCTCTGG - Intergenic
981552967 4:145960391-145960413 CAGCAAGAAGGTGCCATCTATGG - Intergenic
986036706 5:3947746-3947768 CAGTCACAAGCTGCCACATTAGG + Intergenic
986589434 5:9353438-9353460 AAGTAAGAAGGAACCACCTCTGG + Intronic
988675734 5:33431006-33431028 AAGTAACTATGTGCCACTTCTGG + Intergenic
989330984 5:40257933-40257955 CATAAAGAAGGTGCCACCTGAGG - Intergenic
997870545 5:137501759-137501781 CACTAACAATGTGTCAACTCTGG - Intronic
1000013608 5:157257466-157257488 CAGCAACAAGGTGTCATCTATGG + Intergenic
1001819407 5:174698346-174698368 CAGTAACAAGCAGCTACCGCTGG - Intergenic
1002338926 5:178501773-178501795 CAGTGACAAGGCCCCACCTGGGG + Intronic
1003304311 6:4912699-4912721 CAGGATCAAGGGGCCCCCTCTGG + Intronic
1005640454 6:27791552-27791574 CAGAAACTTGGTGCCCCCTCGGG + Intergenic
1005692862 6:28323917-28323939 CAGGAACAAGGTCCCAGCTGAGG - Intergenic
1010234706 6:73565710-73565732 CAGGAACAAGGGGCAACCTCTGG + Intergenic
1018571507 6:165216098-165216120 CAATATCAAGGTACCAGCTCTGG + Intergenic
1023349503 7:39306525-39306547 CACTAACAAGGTGCCAGTTGGGG + Intronic
1029479644 7:100804834-100804856 CGGTAACAATGTGTCAACTCGGG - Intronic
1030721971 7:112881654-112881676 CAGAAACAAGTTACCAACTCTGG + Intronic
1034401639 7:150865268-150865290 CAGGAAATAGCTGCCACCTCAGG - Intergenic
1037490264 8:19391066-19391088 CAGAAACAAGGAGCCACGACCGG - Intronic
1041535652 8:58922857-58922879 CAGGAGCAAGGTGCCACTTACGG + Intronic
1044764988 8:95561737-95561759 CAGAAACAAGGTACTACCTTAGG + Intergenic
1046359908 8:113137598-113137620 CAGTAACAAGGTGCCATCTTTGG - Intronic
1047862992 8:128989504-128989526 CTGTAACAAAGTGCCACAACTGG + Intergenic
1047895599 8:129363110-129363132 AAGTAACAATATGCCACATCTGG + Intergenic
1049654080 8:143790131-143790153 CAATAACAAGAGGCCACCTGGGG - Intergenic
1051493848 9:17697014-17697036 CAGTATCAAGGTTCCAACACTGG - Intronic
1051689090 9:19690347-19690369 CAGTAAGTAGGCCCCACCTCTGG + Intronic
1052352372 9:27470698-27470720 CAAACACAAGCTGCCACCTCTGG + Intronic
1056215799 9:84404869-84404891 AGGTGACAAGGTGCCACCTTGGG + Intergenic
1056429867 9:86516600-86516622 CCCCAACAGGGTGCCACCTCAGG + Intergenic
1058140663 9:101354273-101354295 CAGCAACAAGGTGCCATCTGTGG - Intergenic
1059839734 9:118200495-118200517 CAGTAATAAGGAGCCAGCCCTGG - Intergenic
1060190398 9:121588812-121588834 CAGGAAGGAGGTGTCACCTCTGG + Intronic
1199286742 X:146062487-146062509 CAGCAATAAGGTGCCATCTTGGG + Intergenic
1200120987 X:153790409-153790431 CCGTCACAAGGTGCCAACTTGGG + Intronic