ID: 1144938155 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:18916812-18916834 |
| Sequence | CTGTGTCCTCAGATGGTGGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 5195 | |||
| Summary | {0: 7, 1: 285, 2: 807, 3: 1675, 4: 2421} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1144938151_1144938155 | -3 | Left | 1144938151 | 17:18916792-18916814 | CCTGAGGTGGCACCTTGTTACTG | 0: 1 1: 0 2: 3 3: 11 4: 110 |
||
| Right | 1144938155 | 17:18916812-18916834 | CTGTGTCCTCAGATGGTGGAAGG | 0: 7 1: 285 2: 807 3: 1675 4: 2421 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1144938155 | Original CRISPR | CTGTGTCCTCAGATGGTGGA AGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||