ID: 1144938155

View in Genome Browser
Species Human (GRCh38)
Location 17:18916812-18916834
Sequence CTGTGTCCTCAGATGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5195
Summary {0: 7, 1: 285, 2: 807, 3: 1675, 4: 2421}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144938151_1144938155 -3 Left 1144938151 17:18916792-18916814 CCTGAGGTGGCACCTTGTTACTG 0: 1
1: 0
2: 3
3: 11
4: 110
Right 1144938155 17:18916812-18916834 CTGTGTCCTCAGATGGTGGAAGG 0: 7
1: 285
2: 807
3: 1675
4: 2421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144938155 Original CRISPR CTGTGTCCTCAGATGGTGGA AGG Intronic
Too many off-targets to display for this crispr