ID: 1144938473

View in Genome Browser
Species Human (GRCh38)
Location 17:18919086-18919108
Sequence AAGGAGTGCGCCAAAGTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 417}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144938473_1144938482 27 Left 1144938473 17:18919086-18919108 CCAGGTACTTTGGCGCACTCCTT 0: 1
1: 0
2: 0
3: 13
4: 417
Right 1144938482 17:18919136-18919158 TGGAAGGTTTGCTTGAGCCCAGG 0: 7
1: 619
2: 8143
3: 27029
4: 58150
1144938473_1144938480 7 Left 1144938473 17:18919086-18919108 CCAGGTACTTTGGCGCACTCCTT 0: 1
1: 0
2: 0
3: 13
4: 417
Right 1144938480 17:18919116-18919138 AGCACTGTGGAAGGCTAAGGTGG 0: 1
1: 188
2: 7999
3: 133417
4: 208134
1144938473_1144938478 4 Left 1144938473 17:18919086-18919108 CCAGGTACTTTGGCGCACTCCTT 0: 1
1: 0
2: 0
3: 13
4: 417
Right 1144938478 17:18919113-18919135 CCCAGCACTGTGGAAGGCTAAGG 0: 6
1: 278
2: 11900
3: 190070
4: 298380
1144938473_1144938474 -6 Left 1144938473 17:18919086-18919108 CCAGGTACTTTGGCGCACTCCTT 0: 1
1: 0
2: 0
3: 13
4: 417
Right 1144938474 17:18919103-18919125 CTCCTTTAATCCCAGCACTGTGG 0: 2
1: 107
2: 9337
3: 228877
4: 289792
1144938473_1144938476 -2 Left 1144938473 17:18919086-18919108 CCAGGTACTTTGGCGCACTCCTT 0: 1
1: 0
2: 0
3: 13
4: 417
Right 1144938476 17:18919107-18919129 TTTAATCCCAGCACTGTGGAAGG 0: 2
1: 192
2: 16603
3: 347089
4: 261746
1144938473_1144938481 11 Left 1144938473 17:18919086-18919108 CCAGGTACTTTGGCGCACTCCTT 0: 1
1: 0
2: 0
3: 13
4: 417
Right 1144938481 17:18919120-18919142 CTGTGGAAGGCTAAGGTGGAAGG 0: 1
1: 9
2: 315
3: 6756
4: 63561

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144938473 Original CRISPR AAGGAGTGCGCCAAAGTACC TGG (reversed) Intronic
901295204 1:8156029-8156051 CAGGTGTGCGCCACAGCACCTGG + Intergenic
901500679 1:9651120-9651142 CAGGAGTGAGCCACAGTGCCAGG + Intergenic
901582561 1:10257203-10257225 AAGGAGTGAGCCACCGTGCCTGG + Intronic
901724037 1:11226511-11226533 CAGGAGTGAGCCACTGTACCCGG - Intronic
904238050 1:29126468-29126490 TAGGCATGCGCCACAGTACCTGG - Intergenic
904523883 1:31117380-31117402 CAGGTGTGCACCACAGTACCTGG - Intergenic
904549149 1:31300656-31300678 TAGGAGTGAGCCACAGCACCCGG - Intronic
904690329 1:32288947-32288969 CAGGAGTGAGCCACAGTGCCCGG + Intergenic
904731529 1:32595933-32595955 CAGGCGTGAGCCACAGTACCTGG + Intronic
905016076 1:34779832-34779854 AAGGAGTGCCCCATTGTCCCAGG + Intronic
905717061 1:40161308-40161330 AAGGAGTGCGTCACAGTGCGCGG + Intergenic
905929910 1:41779772-41779794 AAGGCGTGTGCCACCGTACCTGG + Intronic
907142329 1:52199338-52199360 CAGGAGTGAGCCACCGTACCTGG + Intronic
907434294 1:54434337-54434359 CAGGAGTGAGCCACAGTGCCTGG - Intergenic
908198903 1:61773841-61773863 CAGGCGTGAGCCAAAGTGCCCGG - Intronic
908275505 1:62466652-62466674 CAGGCGTGAGCCACAGTACCTGG - Intronic
908473330 1:64465930-64465952 AATGAGTGTGTCAATGTACCAGG + Intergenic
908847116 1:68335983-68336005 CAGGAGTGAGCCACTGTACCCGG + Intergenic
909141132 1:71867073-71867095 CAGGCGTGAGCCACAGTACCCGG - Intronic
909630589 1:77766014-77766036 CAGGTGTGAGCCACAGTACCTGG + Intergenic
909985835 1:82159783-82159805 CAGGCGTGAGCCAACGTACCTGG - Intergenic
910397929 1:86810340-86810362 CAGGAGTGAGCCACAGTGCCCGG - Intergenic
911191918 1:94956898-94956920 TAGGAGTGAGCCACAGCACCCGG + Intergenic
911679839 1:100702662-100702684 AAGGTGTGAGCCACAGTGCCCGG - Intergenic
912913404 1:113786691-113786713 CAGGTGTGTGCCACAGTACCTGG - Intronic
913032297 1:114921399-114921421 CAGGAGTGAGCCACCGTACCTGG - Intronic
914045667 1:144089873-144089895 CAGGGGTGAGCCAATGTACCTGG - Intergenic
914132443 1:144870813-144870835 CAGGGGTGAGCCAATGTACCTGG + Intergenic
914736250 1:150419903-150419925 CAGGAGTGAGCCAACGCACCTGG + Intronic
915400799 1:155620268-155620290 CAGGTGTGAGCCAAAATACCCGG + Intergenic
915449157 1:155992712-155992734 CAGGAGTGAGCCACCGTACCCGG - Intronic
915536316 1:156538032-156538054 CAGGAGTGCGCCACAACACCCGG + Intronic
916065765 1:161134244-161134266 CAGGAGTGAGCCACAGCACCCGG - Intergenic
916674995 1:167057919-167057941 CAGGCGTGAGCCAATGTACCCGG - Intronic
918096382 1:181338360-181338382 CAGGAGTGAGCCACAGCACCTGG + Intergenic
918934170 1:190898900-190898922 AAGAAGTGCCCCAAAGTGCTGGG - Intergenic
919084524 1:192906077-192906099 CAGGAGTGAGCCACCGTACCCGG + Intergenic
920386453 1:205573131-205573153 TAGGAGTGAGCCAATGTGCCCGG - Intronic
920580744 1:207105278-207105300 CAGGAGTGAGCCACCGTACCTGG - Intronic
920722983 1:208405674-208405696 CAGGAGTGAGCCACAGTGCCCGG - Intergenic
922531108 1:226345977-226345999 CAGGAGTGAGCCACCGTACCTGG - Intergenic
922531899 1:226351211-226351233 CAGGAGTGAGCCACAGCACCTGG + Intergenic
923309740 1:232724948-232724970 AAGGAGTGAGCCACCGTGCCTGG - Intergenic
923366139 1:233263731-233263753 AAGGTGTGAGCCACTGTACCCGG + Intronic
923727529 1:236520232-236520254 CAGGAGTGAGCCAACGTGCCTGG + Intronic
924226073 1:241922709-241922731 TAGGAGTGAGCCACAGTGCCAGG + Intergenic
924352378 1:243128842-243128864 TAGGCGTGAGCCACAGTACCCGG + Intronic
924536717 1:244941585-244941607 CAGGAGTGAGCCACCGTACCCGG - Intergenic
924571858 1:245244232-245244254 TAGGAGTGAGCCACTGTACCTGG + Intronic
1062948762 10:1479884-1479906 ATGGAGGGCCCCAAAGAACCTGG - Intronic
1063971173 10:11382243-11382265 CAGGTGTGCGCCACCGTACCTGG + Intergenic
1064267409 10:13836273-13836295 CAGGTGTGAGCCAAAGCACCGGG + Intronic
1064368126 10:14726658-14726680 AAGTATTGCCCGAAAGTACCAGG + Intronic
1064550979 10:16500527-16500549 CAGGAGTGAGCCAATGTGCCCGG + Intronic
1065429340 10:25637947-25637969 GAGGAGTGAGCCACAGTGCCCGG - Intergenic
1066320372 10:34297158-34297180 CAGGCGTGCGCCACCGTACCCGG - Intronic
1066666388 10:37787000-37787022 AAGGCATGAGCCAAAGTGCCTGG - Intronic
1067677587 10:48397866-48397888 CAGGAGTGAGCCACTGTACCAGG + Intronic
1068579214 10:58720235-58720257 AAAGAGTACACCAAAGTAACTGG - Intronic
1069347667 10:67488646-67488668 CAGGTGTGAGCCAAAGTGCCCGG + Intronic
1069459093 10:68577528-68577550 TAGGAGTGAGCCAATGCACCCGG - Intronic
1069708440 10:70473928-70473950 CAGGTGTGAGCCACAGTACCCGG + Intergenic
1071599114 10:86947954-86947976 CAGGCGTGCGCCACTGTACCTGG - Intronic
1072210225 10:93239603-93239625 AAGGCGTGCGCCACCATACCTGG + Intergenic
1073219180 10:101855430-101855452 TAGGAGTGAGCCACTGTACCTGG - Intronic
1073573044 10:104597039-104597061 CAGGAGTGAGCCACAGCACCTGG - Intergenic
1077099764 11:817127-817149 CAGGAGTGAGCCACTGTACCCGG + Intergenic
1078017859 11:7630587-7630609 CAGGCGTGAGCCAAAGCACCTGG + Intronic
1079230138 11:18642657-18642679 CAGGAGTGAGCCACTGTACCTGG - Intergenic
1079714053 11:23722063-23722085 CAGGCGTGAGCCAATGTACCTGG + Intergenic
1079832260 11:25282898-25282920 CAGGTGTGAGCCACAGTACCTGG - Intergenic
1081171025 11:39870369-39870391 CAGGTGTGAGCCACAGTACCCGG + Intergenic
1081511014 11:43773514-43773536 CAGGAGTGAGCCACTGTACCTGG + Intronic
1081511824 11:43782401-43782423 CAGGAGTGAGCCACCGTACCCGG - Intronic
1081946925 11:47004454-47004476 CAGGTGTGCGCCACTGTACCTGG + Intronic
1082676603 11:56112741-56112763 AAGGCGTGAGCCACCGTACCCGG - Intergenic
1083409372 11:62481382-62481404 CAGGAGTGAGCCACTGTACCTGG + Intronic
1084162877 11:67359821-67359843 TAGGTGTGCGCCACTGTACCTGG + Intronic
1085104436 11:73830037-73830059 CAGGAGTGAGCCACCGTACCTGG + Intronic
1087761208 11:102106088-102106110 CAGGTGTGAGCCACAGTACCCGG + Intergenic
1088463174 11:110104339-110104361 AAGGAGTGAGCCACCGCACCTGG + Intronic
1089823392 11:121248741-121248763 AAGGAATGTGCCACAGCACCTGG + Intergenic
1090286202 11:125501660-125501682 CAGGCGTGAGCCACAGTACCTGG - Intergenic
1090682786 11:129078768-129078790 AAGGCGTGAGCCACCGTACCCGG + Intronic
1093409749 12:18850326-18850348 CAGGAGTGAGCCACAGCACCTGG - Intergenic
1093866938 12:24238632-24238654 CAGGAGTGAGCCACAGTGCCCGG + Intergenic
1093881619 12:24410273-24410295 CAGGAGTGTGCCACAGTACCTGG + Intergenic
1094585970 12:31777618-31777640 TAGGAGTGAGCCACTGTACCTGG + Intergenic
1096112217 12:49035835-49035857 AAGGCGTGAGCCACAGCACCTGG + Intronic
1096286940 12:50308484-50308506 AAGGTGTGAGCCACTGTACCTGG + Intergenic
1097848099 12:64386671-64386693 CAGGAGTGAGCCACCGTACCTGG + Intronic
1098346112 12:69505134-69505156 CAGGTGTGAGCCAATGTACCTGG + Intronic
1098476834 12:70914678-70914700 CAGGTGTGAGCCACAGTACCTGG - Intronic
1098544454 12:71696037-71696059 CAGGAGTGAGCCACAGCACCTGG - Intronic
1098647427 12:72920563-72920585 CAGGCGTGAGCCAAAGTGCCCGG + Intergenic
1098896629 12:76070263-76070285 CAGGAGTGCGCCACTGCACCTGG + Intronic
1098909121 12:76191425-76191447 CAGGAGTGAGCCAACGTCCCCGG + Intergenic
1098979407 12:76938759-76938781 CAGGAGTGTGCCAAAACACCCGG - Intergenic
1099531916 12:83792978-83793000 CAGGAGTGAGCCAAGGCACCAGG - Intergenic
1099809698 12:87565552-87565574 AAGGAGTGAGCCACTGTGCCTGG - Intergenic
1100020099 12:90058400-90058422 CAGGAGTGAGCCAGGGTACCCGG + Intergenic
1100084024 12:90885547-90885569 CAGGAGTGAGCCACAGCACCCGG + Intergenic
1100245332 12:92751743-92751765 CAGGTGTGAGCCATAGTACCTGG - Intronic
1100659620 12:96682648-96682670 CAGGAGTGAGCCACTGTACCCGG + Intronic
1100827624 12:98489706-98489728 CAGGAGTGGGCCACAGCACCAGG + Intronic
1101153481 12:101906063-101906085 CAGGCGTGAGCCACAGTACCTGG + Intronic
1102310165 12:111838390-111838412 CAGGAGTGAGCCACAGTACTCGG + Intergenic
1102934631 12:116886006-116886028 CAGGCGTGAGCCACAGTACCCGG + Intergenic
1103143302 12:118571157-118571179 AAGGAATGGGCCAAAGTAAAGGG - Intergenic
1103655691 12:122468652-122468674 CAGGCGTGAGCCAAAGCACCCGG + Intergenic
1103664582 12:122552873-122552895 AAGGAGTGAGCCACCGCACCTGG - Intronic
1103751729 12:123168617-123168639 CAGGTGTGCGCCAACGCACCCGG + Intronic
1104075740 12:125388148-125388170 TAGGAGTGAGCCACAGCACCCGG - Intronic
1105494573 13:20919316-20919338 CAGGAGTGCGCCACCATACCCGG + Intergenic
1107148018 13:37080307-37080329 CAGGAGTGAGCCAATGCACCTGG + Intergenic
1107860413 13:44655190-44655212 AAGGCGTGAGCCACAGCACCCGG - Intergenic
1107871772 13:44753226-44753248 CAGGTGTGGGCCACAGTACCTGG + Intergenic
1108369636 13:49755517-49755539 CAGGAGTGAGCCACAGCACCTGG - Intronic
1110097162 13:71541968-71541990 CAGGAGTGAGCCATCGTACCCGG - Intronic
1110965356 13:81688305-81688327 CAGGCGTGAGCCACAGTACCCGG + Intergenic
1111875052 13:93882420-93882442 AAGGAGTGAGCCACCGTGCCTGG + Intronic
1112180080 13:97069768-97069790 TAGGTGTGAGCCAAAGTGCCTGG - Intergenic
1114267273 14:21080396-21080418 AGGGAGTGGGTCAAAGTTCCAGG - Intronic
1114440745 14:22745305-22745327 CAGGCGTGAGCCACAGTACCTGG - Intergenic
1117289459 14:54318533-54318555 CAGGGGTGAGCCAAAGCACCTGG - Intergenic
1118206809 14:63730139-63730161 AAGGAGTGAGCCACTGCACCTGG - Intergenic
1119567765 14:75643137-75643159 CAGGAGTGAGCCACTGTACCTGG + Intronic
1120786886 14:88546278-88546300 CAGGAGTGAGCCAACGTGCCCGG - Intronic
1121084084 14:91132068-91132090 CAGGCGTGCGCCACTGTACCTGG + Intronic
1121242058 14:92438324-92438346 CAGGAGTGAGCCAAAGCACCTGG - Intronic
1121356463 14:93219694-93219716 CAGGCGTGAGCCAAAGCACCTGG - Intronic
1121646483 14:95521041-95521063 CAGGAGTGAGCCACTGTACCTGG - Intergenic
1122586622 14:102812038-102812060 CAGGAGTGAGCCAGAGCACCTGG + Intronic
1123683485 15:22781033-22781055 AAGGAGTGAGCCACTGCACCGGG + Intronic
1124880430 15:33637407-33637429 AAACAGTGCGGCAAAGCACCAGG - Intronic
1125571323 15:40720902-40720924 CAGGTGTGCACCACAGTACCTGG - Intronic
1126113903 15:45191510-45191532 AAGCAGTTCGCCATAGTATCAGG + Intronic
1126834279 15:52643558-52643580 CAGGTGTGAGCCACAGTACCTGG + Intronic
1127496228 15:59514965-59514987 CAGGAGTGAGCCACAGTGCCCGG - Intronic
1128161853 15:65428084-65428106 CAGGAGTGTGCCACTGTACCTGG + Intergenic
1128262961 15:66245348-66245370 CAGGAGTGCGCCACTGTGCCTGG - Intronic
1128332140 15:66762915-66762937 AAGGAGTTCACCAATATACCTGG + Intronic
1128877941 15:71217338-71217360 CAGGAGTGAGCCAACGCACCTGG - Intronic
1129277420 15:74455845-74455867 AAGGCGTGAGCCACTGTACCCGG - Intronic
1130427784 15:83818993-83819015 AAGGCGTGAGCCACAGTGCCCGG - Intronic
1131979490 15:97981181-97981203 CAGGAGTGAGCCACAGCACCCGG + Intergenic
1132614271 16:832415-832437 AAGGCGTGAGCCACAGTGCCCGG + Intergenic
1133252324 16:4491370-4491392 CAGGAGTGGGCCATAGTGCCCGG - Intronic
1133404600 16:5513187-5513209 CAGGTGTGAGCCAAGGTACCCGG + Intergenic
1135084612 16:19465254-19465276 CAGGAGTGAGCCACCGTACCCGG - Intronic
1135522339 16:23187077-23187099 CAGGTGTGAGCCACAGTACCTGG + Intronic
1137420349 16:48328133-48328155 CAGGAGTGAGCCACTGTACCTGG - Intronic
1138783811 16:59821899-59821921 AAGGCGTGAGCCACAGCACCCGG - Intergenic
1141797205 16:86283176-86283198 AACGAGTGCCCCAGAGGACCAGG - Intergenic
1143033003 17:3978107-3978129 CAGGTGTGAGCCACAGTACCCGG - Intergenic
1143467172 17:7145270-7145292 AAGGAGTGCGCCACTGTGCCTGG - Intergenic
1143699304 17:8646394-8646416 CAGGAGTGCGCCATGGCACCTGG + Intergenic
1144555054 17:16274752-16274774 CAGGAGTGAGCCATAGTGCCCGG - Intronic
1144938473 17:18919086-18919108 AAGGAGTGCGCCAAAGTACCTGG - Intronic
1145741389 17:27277778-27277800 AAGGCGTGAGCCACAGCACCTGG - Intergenic
1146607784 17:34276327-34276349 CAGGAGTGAGACACAGTACCTGG - Intergenic
1147115737 17:38297953-38297975 AAGGAGTGCGCCATCGCATCTGG - Intronic
1147295462 17:39478561-39478583 TAGGAGTGAGCCACAGCACCTGG - Intronic
1147696291 17:42356743-42356765 CAGGCGTGAGCCACAGTACCTGG + Intronic
1148022242 17:44560989-44561011 CAGGAGTGAGCCACAGTGCCTGG + Intergenic
1148413940 17:47491667-47491689 AAGGAGTGCGCCATCGCATCCGG + Intergenic
1149000508 17:51752649-51752671 CAGGCATGAGCCAAAGTACCTGG - Intronic
1149143496 17:53461863-53461885 AAGGTGTGAGCCACTGTACCAGG - Intergenic
1149464625 17:56867458-56867480 AAGGCATGTGCCAATGTACCTGG - Exonic
1149808437 17:59641456-59641478 CAGGAGTGCGCCAACATGCCCGG - Intronic
1150182194 17:63134945-63134967 TAGGTGTGCGCCACAGTAACAGG - Intronic
1150843528 17:68632076-68632098 CAGGAGTGAGCCACAGCACCTGG - Intergenic
1154146183 18:11867980-11868002 AAGGTGTGCGCCATAACACCCGG - Intronic
1155006410 18:21733543-21733565 AAGGTGTGAGCCACAGCACCTGG + Intronic
1155148999 18:23107576-23107598 CAGGCGTGAGCCACAGTACCCGG + Intergenic
1155210724 18:23598399-23598421 AAAGAGTGCCCCCAAATACCAGG - Intergenic
1159045353 18:63364719-63364741 TAGGAGTGAGCCACTGTACCCGG + Intronic
1160007489 18:75078516-75078538 AAGGAGTGAGCCACTGCACCTGG - Intergenic
1160890522 19:1376084-1376106 CAGGCGTGAGCCAAAGTGCCTGG + Intronic
1161533881 19:4806914-4806936 CAGGAGTGAGCCACAGTGCCCGG + Intergenic
1161697004 19:5774737-5774759 CAGGCGTGAGCCACAGTACCTGG - Intronic
1161806290 19:6444942-6444964 CAGGAATGAGCCACAGTACCTGG + Intronic
1161924475 19:7290792-7290814 CAGGAGTGAGCCACCGTACCTGG - Intronic
1163532157 19:17856425-17856447 CAGGCGTGAGCCAAAGCACCCGG - Intergenic
1163723235 19:18908152-18908174 CAGGTGTGAGCCACAGTACCCGG - Intronic
1163977076 19:20862743-20862765 AAGGAGTGAGCCACTGTGCCTGG + Intronic
1164919296 19:32076963-32076985 AAGGAGAGACCCAAAGTCCCAGG + Intergenic
1165840048 19:38783323-38783345 CAGGTGTGAGCCACAGTACCTGG + Intergenic
1166913096 19:46174906-46174928 AAGGATTGATCCAAATTACCAGG + Intergenic
1167695207 19:51011173-51011195 AAGGCGTGCGCCAAGACACCTGG + Intergenic
1202685225 1_KI270712v1_random:43279-43301 CAGGGGTGAGCCAATGTACCTGG - Intergenic
926042348 2:9683621-9683643 CAGGCGTGCGCCAACGTGCCCGG + Intergenic
927583739 2:24280007-24280029 CAGGCGTGAGCCACAGTACCTGG + Intronic
927757232 2:25718663-25718685 CAGGAGTGAGCCACTGTACCTGG + Intergenic
927878665 2:26675415-26675437 AAGGAGTGGGCCACAGCGCCTGG - Intergenic
928832037 2:35499180-35499202 CAGGCGTGCGCCAATGTGCCCGG - Intergenic
929874448 2:45785211-45785233 AAGGTGTGCGCCACCGTGCCTGG - Intronic
930324280 2:49895116-49895138 CAGGTGTGAGCCAATGTACCTGG + Intergenic
930829156 2:55724844-55724866 CAGGTGTGCGCCACTGTACCTGG - Intergenic
931507953 2:62952939-62952961 CAGGAGTGAGCCATGGTACCCGG - Intronic
933312209 2:80675091-80675113 AAGGAGTGCATAAAATTACCAGG - Intergenic
933414630 2:81970455-81970477 CAGGAGTGAGCCACTGTACCTGG + Intergenic
933661789 2:84933562-84933584 CAGGCGTGAGCCACAGTACCCGG + Intergenic
933717623 2:85372975-85372997 CAGGAGTGAGCCATAGCACCCGG - Intronic
934246498 2:90311575-90311597 CAGGCGTGAGCCAATGTACCTGG + Intergenic
935728013 2:106040582-106040604 CAGGCGTGAGCCACAGTACCCGG + Intergenic
937232019 2:120403752-120403774 AAGGTGTGCACCAAGGGACCTGG - Intergenic
937386269 2:121436306-121436328 AAGGCGTGAGCCACCGTACCTGG + Intronic
938057029 2:128223517-128223539 CAGGAGTGAGCCACAGCACCCGG + Intergenic
938413247 2:131082941-131082963 CAGGAGTGCACCACCGTACCTGG - Intronic
939330868 2:140759648-140759670 AAAGGGTGCTCCAAAGTACTTGG - Intronic
939969083 2:148640290-148640312 CAGGAGTGAGCCACCGTACCTGG - Intergenic
941176695 2:162205787-162205809 AAGGTGTGAGCCACTGTACCCGG + Intronic
942648869 2:178146007-178146029 CAGGAGTGAGCCATCGTACCTGG + Intergenic
942821970 2:180125163-180125185 AAGGGGTGAGCCACTGTACCTGG - Intergenic
943585318 2:189732382-189732404 CAGGCGTGAGCCAAAGCACCTGG - Intronic
944248177 2:197554508-197554530 CAGGGGTGAGCCACAGTACCCGG + Intergenic
944724656 2:202458167-202458189 CAGGAGTGAGCCACAGTACCTGG - Intronic
948967439 2:241394239-241394261 CAGGCGTGAGCCAAAGCACCTGG - Intronic
1169841484 20:9942910-9942932 CAGGAGTGAGCCAAAATACCTGG + Intergenic
1171822748 20:29869334-29869356 AAGGAGTTCCCCACATTACCAGG + Intergenic
1172429918 20:34881312-34881334 CAGGAGTGAGCCACAGTGCCTGG + Intronic
1172580003 20:36039740-36039762 CAGGCGTGAGCCAAAGCACCTGG - Intergenic
1173545942 20:43898078-43898100 CAGGTGTGAGCCACAGTACCCGG - Intergenic
1174608808 20:51781898-51781920 CAGGAGTGAGCCACCGTACCCGG - Intergenic
1174627616 20:51928288-51928310 CAGGAGTGAGCCACAGCACCCGG - Intergenic
1175590027 20:60182078-60182100 CAGGAGTGAGCCAATGTGCCCGG + Intergenic
1175799610 20:61793859-61793881 CAGGAGTGAGCCACCGTACCTGG - Intronic
1176421134 21:6516588-6516610 CAGGCGTGAGCCACAGTACCTGG + Intergenic
1176650007 21:9536928-9536950 CAGGAGTGAGCCACAGCACCTGG + Intergenic
1176703697 21:10092495-10092517 CAGGAGTGAGCCACTGTACCCGG + Intergenic
1177462471 21:21430768-21430790 CAGGAGTGAGCCACAGTGCCTGG - Intronic
1178364385 21:31976742-31976764 TAGGCGTGAGCCAAAGCACCTGG + Intronic
1179696624 21:43124905-43124927 CAGGCGTGAGCCACAGTACCTGG + Intergenic
1182284430 22:29236546-29236568 CAGGAGTGCGCCACCATACCTGG - Intronic
1182328978 22:29536872-29536894 AAAGAGCTCACCAAAGTACCTGG - Intronic
1182345585 22:29661753-29661775 CAGGTGTGCGCCACAGCACCTGG + Intronic
1182638093 22:31745098-31745120 CAGGCGTGAGCCAAAGCACCCGG - Intronic
1183047143 22:35229287-35229309 GAGTAGTGGGCCTAAGTACCAGG - Intergenic
1183444822 22:37846580-37846602 CAGGAGTGAGCCACAGTGCCTGG + Intronic
1183660367 22:39216435-39216457 AAGGCGTGTGCCACAGCACCCGG - Intergenic
1183821733 22:40351582-40351604 CAGGAGTGAGCCAGCGTACCTGG + Intronic
949676656 3:6462534-6462556 CAGGAGTGAGCCACTGTACCCGG + Intergenic
949735116 3:7162900-7162922 CGGGAGTGCACCACAGTACCAGG + Intronic
952486443 3:33816359-33816381 AAGGCGTGCGCCACTATACCTGG - Intronic
952761819 3:36921862-36921884 AAGGTGTGAGCCACCGTACCTGG - Intronic
952841747 3:37652381-37652403 AAGGAGAGAGCCAAATTTCCAGG - Intronic
953603421 3:44390338-44390360 AAGGCGTGAGCCACTGTACCTGG - Intronic
953747233 3:45584505-45584527 CAGGTGTGAGCCAACGTACCTGG + Intronic
954786436 3:53096402-53096424 TAGGAGTGAGCCAACGTGCCCGG - Intronic
956245298 3:67175974-67175996 CAGGAGTGAGCCAACGCACCTGG + Intergenic
957695090 3:83626001-83626023 CAGGAGTGAGCCAACTTACCTGG - Intergenic
957823661 3:85412105-85412127 AAGGAGTGAGCCAACATGCCGGG + Intronic
959053791 3:101549737-101549759 CAGGAGTGAGCCAATGTGCCTGG - Intergenic
959397150 3:105854906-105854928 CAGGTGTGCGCCACCGTACCCGG + Intronic
959626185 3:108454455-108454477 ATGCAGTGTGCCAAAGTACCAGG + Intronic
960045682 3:113195221-113195243 AATGAGTGCACCAAAACACCAGG - Intergenic
960796408 3:121493022-121493044 TAGGCGTGAGCCAAAGTGCCCGG - Intronic
961245483 3:125448952-125448974 CAGGAGTGAGCCACTGTACCCGG + Intronic
961377903 3:126479110-126479132 AAGGAGTGCCCCAAATTACAAGG + Intergenic
962794328 3:138837410-138837432 CAGGAGTGAGCCACAGCACCCGG - Intergenic
963128499 3:141836683-141836705 GAGGAGTGGGCCCAAGGACCTGG + Intergenic
963895184 3:150677772-150677794 AAGGTGTGAGCCACTGTACCTGG + Intronic
965121291 3:164561189-164561211 CAGGAGTGAGCCACAGTGCCTGG - Intergenic
965255910 3:166410527-166410549 AAGGCGTGAGCCACAGCACCTGG + Intergenic
965769505 3:172167116-172167138 TAGGCGTGAGCCAATGTACCCGG - Intronic
965985704 3:174750574-174750596 AAGGTGTGCGCCACCATACCTGG + Intronic
966534798 3:181019599-181019621 CAGGCGTGAGCCACAGTACCTGG + Intergenic
966839883 3:184079882-184079904 CAGGAGTGCGCCACCGTGCCCGG - Intergenic
966844357 3:184115815-184115837 CAGGAGTGAGCCACAGTGCCTGG + Intergenic
966867833 3:184270333-184270355 CAGGGGTGAGCCAAAGTGCCTGG - Intronic
969650957 4:8467748-8467770 TAGGAGTGAGCCACCGTACCTGG + Intronic
970418284 4:15880954-15880976 AAGGAGTGGGCCATAATACAGGG - Intergenic
970467163 4:16336168-16336190 CAGGAGTGAGCCACTGTACCCGG - Intergenic
971289297 4:25321790-25321812 CAGGTGTGAGCCACAGTACCTGG + Intronic
972536208 4:40002068-40002090 CAGGTGTGAGCCAAAGCACCAGG + Intergenic
972576488 4:40356712-40356734 CAGGTGTGAGCCAAAGCACCTGG + Intergenic
972676647 4:41266197-41266219 TAGGCGTGAGCCACAGTACCTGG + Intronic
972912414 4:43833664-43833686 AAGGGGTGAGCCACAGCACCCGG + Intergenic
974846807 4:67361367-67361389 CAGGAATGCGCCACAGTGCCCGG + Intergenic
975469591 4:74749816-74749838 CAGGAGTGAGCCACTGTACCTGG - Intronic
975641448 4:76504434-76504456 CAGGCGTGCGCCAAAATGCCCGG + Intronic
979249567 4:118551668-118551690 TAGGCGTGAGCCACAGTACCCGG - Intergenic
980773757 4:137413197-137413219 TAGGAGTGAGCCACAGTGCCTGG + Intergenic
983067661 4:163229784-163229806 AAGGTGTGAGCCACAGTGCCTGG - Intergenic
983196597 4:164813480-164813502 TAGGAGTGAGCCACCGTACCTGG - Intergenic
983449997 4:167897108-167897130 CAGGTGTGAGCCAAAGTGCCCGG + Intergenic
984820564 4:183877965-183877987 CAGGTGTGAGCCACAGTACCTGG + Intronic
984968069 4:185158511-185158533 CAGGAGTGAGCCACCGTACCCGG + Intergenic
985313818 4:188632577-188632599 CAGGAGTGAGCCACAGCACCCGG - Intergenic
985518809 5:360972-360994 CAGGTGTGCGCCACCGTACCCGG - Intronic
987024690 5:13913361-13913383 ATTGAGTGCCACAAAGTACCTGG + Intronic
987894533 5:23927072-23927094 AAGGAGTGAGCCATGGAACCTGG + Intergenic
988541570 5:32114694-32114716 CAGGAGTGAGCCAACGTGCCCGG + Intergenic
988923920 5:35970111-35970133 CAGGAGTGAGCCACAGTGCCCGG - Intronic
989309168 5:39993724-39993746 AAGGAGTGAGCCATTGCACCAGG - Intergenic
989604236 5:43228545-43228567 CAGGAGTGAGCCACAGCACCTGG - Intronic
989642552 5:43597213-43597235 CAGGAGTGAGCCACAGCACCTGG + Intergenic
991341362 5:65614455-65614477 CAGGCGTGGGCCAAAGCACCTGG - Intronic
993183338 5:84583890-84583912 CAGGAGTGAGCCACAGTGCCAGG - Intergenic
994912563 5:105931375-105931397 CAGAAGTGAGCCACAGTACCTGG - Intergenic
995099317 5:108278955-108278977 GAGGAGTGCTTCAATGTACCAGG - Intronic
995201955 5:109435248-109435270 AAGGTGTGAGCCAAGGTGCCTGG - Intergenic
995497902 5:112767932-112767954 CAGGTGTGGGCCAAAGTATCTGG - Intronic
996361214 5:122649348-122649370 CAGGAGTGAGCCACAGCACCTGG - Intergenic
997547723 5:134723186-134723208 CAGGAGTGAGCCACAGTGCCCGG - Intronic
997924497 5:138016327-138016349 TAGGAGTGAGCCATTGTACCTGG - Intronic
997954985 5:138272360-138272382 AAGGTGTGCGCCACCGCACCCGG - Intronic
998245655 5:140501467-140501489 AAGGTGTGAGCCACAGTGCCCGG - Intronic
998273742 5:140731723-140731745 AAGGCGTGAGCCACTGTACCCGG + Intergenic
998447480 5:142209981-142210003 CAGGAGTGAGCCACAGTATCTGG - Intergenic
999161218 5:149500702-149500724 TAGGAGTGAGCCACAGTGCCTGG + Intronic
1000087989 5:157905250-157905272 CAGGCGTGAGCCACAGTACCTGG - Intergenic
1001258355 5:170202936-170202958 CAGGCGTGAGCCACAGTACCCGG + Intergenic
1001588878 5:172852078-172852100 AAGGAGACCGCCAAAGCATCAGG + Intronic
1002139161 5:177128228-177128250 AAGGCGTGCACCACTGTACCTGG + Intergenic
1003547761 6:7074896-7074918 AAGGTGTGCGCCACAGCATCTGG - Intergenic
1003657871 6:8030592-8030614 CAGGAGTGAGCCACTGTACCTGG - Intronic
1005460494 6:26064964-26064986 CAGGAGTGAGCCACAGTACCTGG + Intergenic
1005482530 6:26268328-26268350 CAGGAGTGAGCCAAGGCACCTGG + Intergenic
1005920830 6:30399188-30399210 CAGGAGTGAGCCACAGTACCTGG + Intergenic
1006195015 6:32234709-32234731 CAGGAGTGAGCCAATGTGCCTGG + Intergenic
1006476103 6:34255227-34255249 CAGGTGTGAGCCAACGTACCTGG - Intergenic
1006853259 6:37114751-37114773 CAGGAGTGAGCCAAGGTTCCTGG - Intergenic
1008111730 6:47502376-47502398 AAGCAGTGCTCCAAAGTAGCTGG + Intronic
1009430037 6:63555966-63555988 TAGGAGTGAGCCACCGTACCTGG + Intronic
1010270988 6:73915742-73915764 CAGGTGTGAGCCAAAGCACCCGG + Intergenic
1013037267 6:106398235-106398257 CAGGCGTGAGCCAACGTACCTGG - Intergenic
1014362198 6:120492969-120492991 CAGGCGTGAGCCAAAGTCCCTGG + Intergenic
1014365727 6:120539123-120539145 CAGGAGTGAGCCAACGTGCCTGG + Intergenic
1014673549 6:124336946-124336968 CAGGAGTGAGCCACAGCACCTGG + Intronic
1014760567 6:125352247-125352269 CAGGAATGTGCCATAGTACCTGG + Intergenic
1015647165 6:135405580-135405602 AAGGCGTGAGCCACCGTACCCGG - Intronic
1016846846 6:148576809-148576831 CAGGTGTGCGCCACTGTACCTGG - Intergenic
1017145116 6:151227763-151227785 CAGGCGTGAGCCACAGTACCTGG - Intergenic
1018500327 6:164402725-164402747 CAGGAGTGAGCCATTGTACCTGG + Intergenic
1019170731 6:170131925-170131947 CAGGAGTGAGCCACAGCACCTGG + Intergenic
1019358699 7:594146-594168 AAGGAGGGAGCCACAGTTCCAGG - Intronic
1020059630 7:5142734-5142756 CAGGAGTGAGCCACAGCACCCGG + Intergenic
1021404605 7:20250478-20250500 CAGGAGTGAGCCACCGTACCTGG - Intergenic
1022051549 7:26678716-26678738 CAGGAGTGAGCCACAATACCTGG + Intronic
1023925159 7:44663489-44663511 AAGGCGTGAGCCACAGCACCCGG - Intronic
1024324404 7:48097509-48097531 CAGGAGTGAGCCACTGTACCCGG + Intronic
1024324974 7:48102307-48102329 AAGGAGAGCCTCAAAGTACCAGG + Intronic
1024541138 7:50475965-50475987 CAGGAGTGAGCCACAGCACCTGG + Intronic
1024999995 7:55307889-55307911 CAGGAGTGAGCCACTGTACCTGG - Intergenic
1025810268 7:64871179-64871201 AAGGAGGACCCCAAAGTGCCAGG + Intronic
1026085842 7:67262330-67262352 AAGGTGTGCGCCACTGCACCTGG + Intergenic
1026644155 7:72153399-72153421 CAGGAGTGAGCCAATGCACCTGG - Intronic
1026981187 7:74527562-74527584 AAGGAGTGAACCACAGTCCCCGG - Intronic
1027175829 7:75902743-75902765 CAGGAGTGAGCCACAGTGCCTGG - Intronic
1028454792 7:91027405-91027427 TAGGAGTGCCCCAAAGTTTCAGG + Intronic
1029409557 7:100399943-100399965 CAGGTGTGCGCCACTGTACCTGG - Exonic
1029549206 7:101228122-101228144 AAGGTGTGCGCCACCATACCTGG - Intergenic
1030109452 7:106014101-106014123 CAGGAGTGCGCCACTGTGCCTGG + Intronic
1030248296 7:107410583-107410605 CAGGAGTGCGCCACAATGCCTGG + Intronic
1032131930 7:129236476-129236498 TAGGTGTGAGCCAATGTACCTGG + Intronic
1032548211 7:132761282-132761304 CAGGCGTGAGCCAAAGTGCCTGG + Intergenic
1032754760 7:134878680-134878702 AAGGAGTGAGCCACTGCACCTGG - Intronic
1033626846 7:143118543-143118565 CAGGAGTGCGCCACAATGCCTGG - Intergenic
1034074824 7:148221626-148221648 AAGGTCTACGCCAAAGTATCAGG + Intronic
1034115098 7:148577321-148577343 CAGGAGTGAGCCACCGTACCTGG + Intergenic
1034636327 7:152570117-152570139 CAGGAGTGAGCCAATGCACCTGG + Intergenic
1035832241 8:2709115-2709137 CAGGAGTGAGCCAATGCACCCGG + Intergenic
1037898563 8:22674292-22674314 AAGGGGTGGGCCAAAAGACCAGG - Intergenic
1039588529 8:38727659-38727681 CAGGAGTGAGCCACAGCACCCGG + Intergenic
1039969547 8:42309475-42309497 CAGGAGTGAGCCACTGTACCCGG - Intronic
1040338165 8:46426704-46426726 CAGGAGTGCTCCAAAGCCCCAGG + Intergenic
1040929349 8:52717515-52717537 CAGGAGTGAGCCACAGCACCTGG + Intronic
1042239462 8:66648072-66648094 CAGGTGTGAGCCACAGTACCTGG + Intronic
1042595127 8:70439342-70439364 GAGCAGTGCCCCACAGTACCTGG + Intergenic
1043454463 8:80399773-80399795 CAGGAGTGAGCCAGAGCACCTGG + Intergenic
1044229870 8:89761621-89761643 CAGGGGTGTGCCAATGTACCTGG - Intronic
1045303563 8:100936536-100936558 AAGGAGTGAGCCACCGTGCCCGG - Intronic
1046125797 8:109905944-109905966 CAGGAGTGAGCCACAGTGCCCGG - Intergenic
1046673062 8:117078963-117078985 AAGGTGTGAGCCAATGTGCCTGG + Intronic
1047192487 8:122690747-122690769 ATGGAGTGGGCCAAGGTCCCAGG + Intergenic
1048752554 8:137696817-137696839 AAGAAGTTCGCCAAAGTGACAGG + Intergenic
1051014488 9:12459031-12459053 CAGGAGTGAGCCAATGCACCAGG - Intergenic
1052855798 9:33405499-33405521 CAGGAGTGAGCCAATGCACCTGG - Intergenic
1052861844 9:33442339-33442361 AAGGCGGGGGCCAAAGTCCCGGG + Exonic
1052913129 9:33902189-33902211 TAGGTGTGCCCCAAAGCACCTGG + Intronic
1053238575 9:36477542-36477564 CAGGTGTGAGCCACAGTACCCGG - Intronic
1053300265 9:36944039-36944061 CAGGTGTGCACCAAAGTACCTGG - Intronic
1053452428 9:38204138-38204160 CAGGAGTGAGCCACTGTACCTGG + Intergenic
1053517788 9:38745966-38745988 AAGGAGAGCCTCAAATTACCTGG - Intergenic
1053640962 9:40079515-40079537 CAGGAGTGAGCCACTGTACCCGG + Intergenic
1053765176 9:41385953-41385975 CAGGAGTGAGCCACTGTACCCGG - Intergenic
1053810968 9:41851521-41851543 CAGGAGTGAGCCACTGTACCTGG - Intergenic
1054321650 9:63675496-63675518 CAGGAGTGAGCCACTGTACCCGG + Intergenic
1054543790 9:66297115-66297137 CAGGAGTGAGCCACTGTACCCGG - Intergenic
1054619626 9:67335918-67335940 CAGGAGTGAGCCACTGTACCTGG + Intergenic
1055693992 9:78863256-78863278 CAGGAGTGAGCCACCGTACCTGG + Intergenic
1055892315 9:81136559-81136581 CAGGTGTGAGCCAACGTACCGGG - Intergenic
1059289147 9:113206857-113206879 CAGGAGTGCGCCACCGCACCCGG + Intronic
1059343974 9:113615938-113615960 AAGGCATGAGCCAGAGTACCAGG - Intergenic
1059513199 9:114868631-114868653 CAGGAGTGAGCCACAGTGCCCGG + Intergenic
1060500147 9:124147089-124147111 AAGGAGTGAGCCAGAGCACTTGG + Intergenic
1060993326 9:127861452-127861474 CAGGCGTGAGCCACAGTACCCGG + Intergenic
1061472342 9:130836192-130836214 AAGGAGTCCCCCAGAGTACTGGG + Intronic
1062616636 9:137399758-137399780 CAGGAGTGAGCCACTGTACCCGG - Intronic
1202788734 9_KI270719v1_random:62590-62612 CAGGAGTGAGCCACTGTACCCGG + Intergenic
1203627748 Un_KI270750v1:40479-40501 CAGGAGTGAGCCACAGCACCTGG + Intergenic
1185549648 X:972979-973001 ATGGAGTGCCCCAGAGTTCCGGG + Intergenic
1185965223 X:4592722-4592744 AAGGAGTGAGCCACTGTGCCTGG - Intergenic
1186118134 X:6326906-6326928 CAGGGGTGAGCCACAGTACCCGG - Intergenic
1186877744 X:13833435-13833457 CAGGAGTGAGCCACAGTGCCTGG - Intronic
1187181909 X:16950769-16950791 CAGGCGTGCGCCACAGCACCAGG - Intronic
1189194993 X:39145410-39145432 AAGGAGTAGGCCCATGTACCTGG - Intergenic
1189823341 X:44892279-44892301 AAGGCGTGAGCCACCGTACCCGG - Intronic
1190234173 X:48603368-48603390 CAGGAGTGCGCCACTGTGCCTGG - Intronic
1190629567 X:52372071-52372093 CAGGTGTGAGCCAATGTACCTGG - Intronic
1190849209 X:54222272-54222294 CAGGTGTGAGCCAAAGTACCTGG - Intronic
1193179465 X:78436775-78436797 AAGGACTGCATCAAAGTACGAGG + Intergenic
1193741581 X:85223743-85223765 AAGGAGTTTGGCACAGTACCAGG - Intergenic
1193835825 X:86342527-86342549 CAGGAGTGAGCCACCGTACCTGG - Intronic
1195056471 X:101150645-101150667 AAGGTGTGCGCCACTGTGCCTGG + Intronic
1195143267 X:101986063-101986085 AAGGAGTGAGCCACCGTGCCTGG + Intergenic
1195521311 X:105832744-105832766 CAGGAGTGAGCCACAGCACCAGG - Intronic
1196287793 X:113902207-113902229 CAGGAGTGAGCCACAGTGCCTGG + Intergenic
1196912301 X:120496498-120496520 AAGGAGTGAGCCACTGCACCCGG + Intergenic
1197003136 X:121463164-121463186 CAGGAGTGAGCCACAGTGCCCGG - Intergenic
1197907903 X:131445800-131445822 TAGGAGTGAGCCACAGTGCCTGG + Intergenic
1198109520 X:133490667-133490689 CAGGAGTGCGCCAACATGCCAGG + Intergenic
1198249299 X:134864300-134864322 CAGGAGTGAGCCATTGTACCCGG + Intergenic
1198538488 X:137610663-137610685 AAGGAGTGAGCCACTGTGCCAGG + Intergenic
1199410100 X:147511616-147511638 TAGGAGTGAGCCAATGTGCCCGG - Intergenic
1200277405 X:154747521-154747543 CAGGCGTGAGCCAATGTACCTGG - Intronic
1200638653 Y:5688920-5688942 CAGGAGTGAGCCACTGTACCCGG - Intronic
1201066237 Y:10097698-10097720 AAGGAGTTCCCCACATTACCAGG - Intergenic
1202588399 Y:26456322-26456344 CAGGCGTGAGCCAATGTACCTGG + Intergenic