ID: 1144938475

View in Genome Browser
Species Human (GRCh38)
Location 17:18919105-18919127
Sequence TTCCACAGTGCTGGGATTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 618139
Summary {0: 2, 1: 196, 2: 16379, 3: 344193, 4: 257369}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144938475_1144938486 27 Left 1144938475 17:18919105-18919127 CCTTTAATCCCAGCACTGTGGAA 0: 2
1: 196
2: 16379
3: 344193
4: 257369
Right 1144938486 17:18919155-18919177 CAGGAGTTTGAGACCAGCCTGGG 0: 19126
1: 38854
2: 56666
3: 50459
4: 31838
1144938475_1144938481 -8 Left 1144938475 17:18919105-18919127 CCTTTAATCCCAGCACTGTGGAA 0: 2
1: 196
2: 16379
3: 344193
4: 257369
Right 1144938481 17:18919120-18919142 CTGTGGAAGGCTAAGGTGGAAGG 0: 1
1: 9
2: 315
3: 6756
4: 63561
1144938475_1144938482 8 Left 1144938475 17:18919105-18919127 CCTTTAATCCCAGCACTGTGGAA 0: 2
1: 196
2: 16379
3: 344193
4: 257369
Right 1144938482 17:18919136-18919158 TGGAAGGTTTGCTTGAGCCCAGG 0: 7
1: 619
2: 8143
3: 27029
4: 58150
1144938475_1144938485 26 Left 1144938475 17:18919105-18919127 CCTTTAATCCCAGCACTGTGGAA 0: 2
1: 196
2: 16379
3: 344193
4: 257369
Right 1144938485 17:18919154-18919176 CCAGGAGTTTGAGACCAGCCTGG 0: 18758
1: 81811
2: 152089
3: 186177
4: 177040

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144938475 Original CRISPR TTCCACAGTGCTGGGATTAA AGG (reversed) Intronic
Too many off-targets to display for this crispr