ID: 1144938481

View in Genome Browser
Species Human (GRCh38)
Location 17:18919120-18919142
Sequence CTGTGGAAGGCTAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70642
Summary {0: 1, 1: 9, 2: 315, 3: 6756, 4: 63561}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144938473_1144938481 11 Left 1144938473 17:18919086-18919108 CCAGGTACTTTGGCGCACTCCTT 0: 1
1: 0
2: 0
3: 13
4: 417
Right 1144938481 17:18919120-18919142 CTGTGGAAGGCTAAGGTGGAAGG 0: 1
1: 9
2: 315
3: 6756
4: 63561
1144938475_1144938481 -8 Left 1144938475 17:18919105-18919127 CCTTTAATCCCAGCACTGTGGAA 0: 2
1: 196
2: 16379
3: 344193
4: 257369
Right 1144938481 17:18919120-18919142 CTGTGGAAGGCTAAGGTGGAAGG 0: 1
1: 9
2: 315
3: 6756
4: 63561

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144938481 Original CRISPR CTGTGGAAGGCTAAGGTGGA AGG Intronic
Too many off-targets to display for this crispr