ID: 1144939937

View in Genome Browser
Species Human (GRCh38)
Location 17:18931929-18931951
Sequence CTCTAAAGACAGATGAGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144939937_1144939944 15 Left 1144939937 17:18931929-18931951 CCCGGCCTCATCTGTCTTTAGAG No data
Right 1144939944 17:18931967-18931989 TTCCCCAGAGTCCATTGGAGTGG No data
1144939937_1144939948 25 Left 1144939937 17:18931929-18931951 CCCGGCCTCATCTGTCTTTAGAG No data
Right 1144939948 17:18931977-18931999 TCCATTGGAGTGGCCTCCCCTGG No data
1144939937_1144939943 10 Left 1144939937 17:18931929-18931951 CCCGGCCTCATCTGTCTTTAGAG No data
Right 1144939943 17:18931962-18931984 TGAGCTTCCCCAGAGTCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144939937 Original CRISPR CTCTAAAGACAGATGAGGCC GGG (reversed) Intergenic
No off target data available for this crispr