ID: 1144945189

View in Genome Browser
Species Human (GRCh38)
Location 17:18966137-18966159
Sequence CGTGGGGGTCCTGCATGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144945173_1144945189 30 Left 1144945173 17:18966084-18966106 CCAGGGCCGTGAAGCACTGGCAG 0: 1
1: 0
2: 1
3: 13
4: 131
Right 1144945189 17:18966137-18966159 CGTGGGGGTCCTGCATGGGGAGG 0: 1
1: 0
2: 3
3: 14
4: 196
1144945176_1144945189 24 Left 1144945176 17:18966090-18966112 CCGTGAAGCACTGGCAGGGTTTC 0: 1
1: 0
2: 2
3: 18
4: 172
Right 1144945189 17:18966137-18966159 CGTGGGGGTCCTGCATGGGGAGG 0: 1
1: 0
2: 3
3: 14
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144945189 Original CRISPR CGTGGGGGTCCTGCATGGGG AGG Intronic
900115753 1:1027132-1027154 CGTGGGGGGACTGCAGGAGGAGG - Intronic
900207367 1:1437309-1437331 CCTTGAGCTCCTGCATGGGGGGG - Exonic
900336740 1:2167963-2167985 CGTGGGTGTCCTCCAGGGGTTGG + Intronic
900386927 1:2414825-2414847 CATGGGGGTCCTGCCAGGGGAGG + Intergenic
901511587 1:9720547-9720569 CCTGGGGGTCCTGCCCGGGCTGG + Intronic
901767892 1:11515457-11515479 CTTGGGCATCCTGAATGGGGTGG + Exonic
902115035 1:14114276-14114298 CGTGGGGGGCCGGCATTGGGGGG + Intergenic
903268388 1:22172489-22172511 GGTGGGGCTGTTGCATGGGGAGG + Intergenic
903673523 1:25050532-25050554 CCCGGGGCTCCTGCATGGTGAGG + Intergenic
905342856 1:37291153-37291175 TGTGGAGGTCCTGTTTGGGGAGG + Intergenic
906581767 1:46940973-46940995 CTTGGCAGTCCTGCATGTGGAGG - Intronic
907809114 1:57850947-57850969 CTTGGGGGGCTTGCAGGGGGTGG - Intronic
909445522 1:75744235-75744257 GGTATGGGTGCTGCATGGGGAGG + Intronic
914679184 1:149927259-149927281 CGTGGGGGGCCTGGATGAGAAGG - Exonic
915251988 1:154597152-154597174 CATGAAGGCCCTGCATGGGGAGG - Exonic
915844907 1:159252749-159252771 CGTGGTGGACCTGCCTGGTGAGG - Intergenic
920203860 1:204277342-204277364 CCTTGGGGTGCTGAATGGGGAGG - Intronic
922566719 1:226605970-226605992 CCTGGGCATCCTGCATGAGGCGG - Exonic
1063609571 10:7551699-7551721 CTTGGGGGGTCTGCAGGGGGAGG - Intergenic
1064142708 10:12804015-12804037 TGTTGGGGCCCTGGATGGGGTGG + Intronic
1066375366 10:34853552-34853574 GGTGGGGGTGGTGCAGGGGGCGG - Intergenic
1069589673 10:69634101-69634123 CGTGGAGGCCCTGCCTGGGGAGG + Intergenic
1070762736 10:79034864-79034886 GGTGGGGGTCCAGCGTGGGATGG - Intergenic
1073060602 10:100731229-100731251 CGTGGGGATTCTGCAGGCGGGGG - Intergenic
1074704164 10:116116558-116116580 AGTGAGGGTCCTGCATGTGTGGG - Intronic
1076195842 10:128517181-128517203 CGTGGGGGTCTTTCATCAGGGGG + Intergenic
1077235585 11:1480646-1480668 CGTGGGGGTCCCCCTTGAGGAGG + Intronic
1077365353 11:2159336-2159358 GGAGGGGGTCCTGCAGGGCGGGG - Intronic
1078081157 11:8205696-8205718 CATGGGGGTCCTGCCCAGGGTGG - Intergenic
1078448480 11:11422764-11422786 AATGGGGGTTCTGCAGGGGGTGG + Intronic
1081536652 11:44001724-44001746 CCTGGGGTTCATGGATGGGGTGG + Intergenic
1081789760 11:45774486-45774508 CCTGGGCTTCCTGCCTGGGGTGG + Intergenic
1083288465 11:61676233-61676255 CATCTGGGTCCTCCATGGGGAGG + Intergenic
1083455844 11:62778134-62778156 TGCCGGGGTCCTGCATGGGTTGG + Intronic
1084116157 11:67044344-67044366 CGGGAGGGTCCTGCCTGGGGCGG - Intronic
1097048445 12:56205406-56205428 TGTGGGGGTTCTGGATAGGGTGG - Exonic
1098679864 12:73338899-73338921 GGTGGGGGTCTTGGAAGGGGAGG + Intergenic
1101131721 12:101697582-101697604 GGAGGGGGTCCTGCTAGGGGCGG - Intronic
1101316755 12:103635828-103635850 CTGGGAGGTCATGCATGGGGAGG - Intronic
1102068047 12:109995751-109995773 CCTGGGTGTCCTGCCCGGGGAGG - Intronic
1102207779 12:111102178-111102200 GGTGGGTGTCCTGCGTGGGTGGG + Intronic
1103218614 12:119224258-119224280 CGTGGGGAAACTGCGTGGGGGGG + Intergenic
1103743501 12:123107043-123107065 GATGGGGGTACAGCATGGGGAGG + Intronic
1106228202 13:27800948-27800970 CGTGGGAGTTCTCCATGGGCAGG + Intergenic
1106409977 13:29504832-29504854 TGAGGGGGTCCTGCAGGGGCCGG + Exonic
1107445938 13:40470474-40470496 CGTGGGGGTCCCAGATGGGCTGG + Intergenic
1110394422 13:75012764-75012786 TGGTGGTGTCCTGCATGGGGAGG + Intergenic
1114527656 14:23376721-23376743 CCTGGGGGTGCTGCCTGGGCTGG + Intergenic
1118571392 14:67199109-67199131 CGTGGGGGGCCTGAATGAGAAGG + Intronic
1121720451 14:96105255-96105277 GGTGGGGGGTCAGCATGGGGCGG - Intergenic
1122658516 14:103279099-103279121 CGCGGGGGTCTGGCCTGGGGCGG - Intergenic
1122692618 14:103538415-103538437 CCTGGGCGTCCTGAATGGGCAGG - Intergenic
1122693944 14:103543884-103543906 CGTGGGCTTCCTGCAGGAGGAGG + Intergenic
1122774613 14:104111723-104111745 TGTGCGGGTCCTGCATGGGGAGG - Intronic
1122825527 14:104368750-104368772 CGAGGGGGTCCTGCATGTGGAGG + Intergenic
1124142429 15:27088888-27088910 CATGGGGGAGATGCATGGGGAGG + Intronic
1124348609 15:28939153-28939175 CGTAGGGGTCCTGCACGTTGTGG + Intronic
1124632714 15:31346604-31346626 CCTGGGGGGCCTGCAAGGAGGGG - Intronic
1125516531 15:40324049-40324071 CGTCGCGCTCCTTCATGGGGGGG - Intergenic
1125744416 15:41988978-41989000 CGAGTGGGTCCTGCATTCGGTGG + Intronic
1127124261 15:55796885-55796907 GGTGGGGGTGCTGAATGGGGTGG - Intergenic
1127478247 15:59354868-59354890 GGTGGGGCTCCTGCAGGAGGGGG - Intronic
1127626899 15:60788641-60788663 TGTGTGGATCCTGCCTGGGGAGG - Intronic
1128234565 15:66058958-66058980 GTTGGGAGTCCTGGATGGGGAGG - Intronic
1129059501 15:72849448-72849470 GGTGGGGGTGCTGTATGGGAAGG + Intergenic
1132599608 16:767822-767844 CGTGGGGGGGGCGCATGGGGGGG + Intronic
1134794764 16:17024839-17024861 CGTGGGTATTCTGCAAGGGGTGG - Intergenic
1135955702 16:26954825-26954847 TGTGGGAGTCCTGCATTGGGGGG - Intergenic
1136385429 16:29923011-29923033 GGTGGGGGTGCTGCCTGAGGCGG + Intronic
1138640974 16:58386608-58386630 AGTGGAGGACCTGCAAGGGGAGG - Intronic
1139337686 16:66244577-66244599 CGTGTGGGTCCTGCTTGAGCTGG + Intergenic
1140218266 16:73025278-73025300 TGTGTGAGTCCTGCATGGGCTGG - Intronic
1141720966 16:85754984-85755006 CCTAGGGGTCCTGCAGGGTGGGG + Intergenic
1141724214 16:85775663-85775685 CTTGGGGGTCCTGCCTCCGGGGG + Intronic
1142192357 16:88723718-88723740 CTTGGGAGGCCTGGATGGGGCGG + Intronic
1142759757 17:2035500-2035522 GGTGGGGGCCCTGCCTGTGGTGG + Intronic
1143482682 17:7236589-7236611 CTTGGGGGTCCTGGCTGGGTGGG + Exonic
1144684058 17:17214775-17214797 CCTCCGGCTCCTGCATGGGGAGG - Intronic
1144945189 17:18966137-18966159 CGTGGGGGTCCTGCATGGGGAGG + Intronic
1145925691 17:28645090-28645112 CGTCGGGGCCCGGCATGGCGGGG - Exonic
1145994630 17:29098285-29098307 CCTGGGGGACCTGCAGGGGCTGG + Intronic
1146904466 17:36609106-36609128 CGTGGGGGGCCCCCGTGGGGTGG - Intergenic
1152659850 17:81537156-81537178 CTTGGGGGTCCTGCAGCTGGAGG + Intergenic
1152916282 17:83037891-83037913 CGTGGGGCTCCTGCTTGGGGAGG + Intronic
1152925390 17:83085323-83085345 GGTGAGTGTCCTGCCTGGGGCGG + Exonic
1156036672 18:32772313-32772335 CGTGGGGGTGCTGCCGGCGGAGG - Intronic
1157391841 18:47309695-47309717 CGTGGGGTCCTTGCATGTGGGGG + Intergenic
1160600653 18:80010224-80010246 AGAGGGGGTCCTGAATGGGGTGG + Intronic
1160905393 19:1449651-1449673 CCTGAGGGTCCTGCCTGGTGGGG - Intronic
1160934027 19:1584788-1584810 CGTGGGGGTCCTGGCGGGCGCGG - Intronic
1161040671 19:2109335-2109357 CTTGGGGGTCCTGGAAGGTGTGG + Intronic
1161079413 19:2303137-2303159 GGTGGGGGTCCGGGCTGGGGAGG - Intronic
1162746604 19:12802058-12802080 CGTTGGAGTCCAGCATGGCGCGG + Intronic
1162967889 19:14164573-14164595 GGTGGGGGGCCTGGCTGGGGCGG - Intronic
1163468997 19:17486177-17486199 CCTGGGGGTCCTGGTTAGGGTGG + Intronic
1165740856 19:38204287-38204309 GGGGTGGGTCCTGCATGGCGGGG - Intronic
1165793707 19:38506839-38506861 CGTAGGGGACCAGCAGGGGGTGG - Exonic
1166299672 19:41906673-41906695 GGTGGGGGTCATGGATGAGGGGG - Intronic
1167427067 19:49434773-49434795 CGTGAGGATCCTGCAGGGGTTGG - Exonic
1167713167 19:51124694-51124716 GGGGTGGGCCCTGCATGGGGTGG + Intergenic
1167715766 19:51142089-51142111 GGGGTGGGCCCTGCATGGGGTGG + Intergenic
1168696822 19:58408511-58408533 CGGGCGGGCCCTGCGTGGGGCGG - Intronic
1168703556 19:58455432-58455454 CTTGGGGGGCCTGAGTGGGGAGG - Exonic
927172348 2:20380814-20380836 GGAGAGGGTCCTGCATGAGGTGG - Intergenic
927895435 2:26778618-26778640 CCTGGGGGTTCTGCAGGGAGGGG - Exonic
930018448 2:46986531-46986553 GGTGGGGGTGCTGCCTGGGGTGG + Intronic
930111179 2:47680128-47680150 AGTGGTGATCCTGCATGGGAGGG + Intergenic
931168886 2:59781110-59781132 CGTGGTGGGCCTGAATGGAGAGG - Intergenic
932144378 2:69305576-69305598 GGTGAGGGTCCTGAATGGGCAGG + Intergenic
932454861 2:71843100-71843122 GGTGGAGGCCCAGCATGGGGAGG + Intergenic
936073749 2:109388466-109388488 CCTGGGGGGCCTGGCTGGGGAGG - Intronic
937225580 2:120366993-120367015 CTGGGGGATGCTGCATGGGGTGG + Intergenic
937987600 2:127645462-127645484 CCTGGGGCTCCTCCCTGGGGTGG - Intronic
940659698 2:156531590-156531612 CGTGTGGCACCTGCATGTGGAGG + Intronic
943531151 2:189082763-189082785 AGTGTGGGCCCTCCATGGGGAGG - Intronic
947207706 2:227677030-227677052 GGTGGGGGTCCTGGGAGGGGTGG - Intergenic
948809542 2:240467577-240467599 GGAAGGGGTCCTGCAGGGGGAGG + Exonic
1172527311 20:35607635-35607657 CCTGGGGGTCATGGGTGGGGAGG + Intergenic
1173019391 20:39254325-39254347 AGTGGGGGTCCTACAAGGCGGGG + Intergenic
1173836419 20:46128887-46128909 CCTGGGGTTCCTGCTTGGGGTGG - Exonic
1175763596 20:61577998-61578020 CTTGGCAGTCCTGCATGGTGGGG - Intronic
1176020446 20:62959895-62959917 TGTGGAGGAGCTGCATGGGGTGG + Intronic
1179486218 21:41712364-41712386 GGAGGGGGACCTGCAGGGGGAGG + Intergenic
1180057720 21:45367466-45367488 CCTGGGGGTCCCAGATGGGGAGG + Intergenic
1180065995 21:45412712-45412734 CGTGAGGGTCCTGCAAGTGAAGG + Intronic
1180087423 21:45514260-45514282 CCTGGGGACCCTGCTTGGGGGGG - Exonic
1180846286 22:18984216-18984238 CGTGGGGGCCCTGCATGGACTGG - Intergenic
1181630821 22:24150414-24150436 CGTGAGGGTCCCTCATGGGGTGG + Intronic
1183377734 22:37474738-37474760 AGTGGAGGGCCTTCATGGGGTGG - Intronic
1183743596 22:39681110-39681132 CAGGGGGGTCCTGCCTGGGTGGG - Intronic
1183922063 22:41177457-41177479 GGTGGGGGCCCTGGAAGGGGTGG - Exonic
1184024933 22:41848528-41848550 GGTGGGGCTCTTGCATGGGTCGG + Intronic
1184451055 22:44583104-44583126 AGTGGGGGTCCACCTTGGGGTGG - Intergenic
1184602989 22:45554439-45554461 CGGGGGAGTCCTGCCTGGGAGGG - Intronic
1184734187 22:46388511-46388533 CATGGGGGCCCTGCATGGACTGG + Intronic
1184828650 22:46970210-46970232 GGTGGGGGTCAGGCAGGGGGCGG - Intronic
1184886137 22:47345407-47345429 GGAGGGTGTCCTGCATGAGGAGG + Intergenic
1185149135 22:49154218-49154240 GGTGGGGGTCCTTCCTGGGTGGG + Intergenic
1185316228 22:50180355-50180377 CGTGGGGGTGCTGCAGGACGTGG + Intergenic
1185375623 22:50481591-50481613 GTTGGGGGTCCTGCCTGGAGCGG - Exonic
950419897 3:12892597-12892619 CTTGGAGGTCCTGGGTGGGGTGG - Intergenic
952781376 3:37102902-37102924 CGTGAGTGTATTGCATGGGGTGG - Exonic
953923976 3:46971356-46971378 CCAGGGGGTCTTGCATGGGCTGG + Intronic
959496521 3:107058455-107058477 CCAGGGGATCCTGCATTGGGAGG - Intergenic
961095040 3:124147206-124147228 CCTGGAGGGGCTGCATGGGGTGG - Intronic
961381613 3:126499434-126499456 CATGGGTGTCCTGCCTTGGGTGG - Intronic
961681719 3:128604120-128604142 TGCGGGGGTACAGCATGGGGAGG - Intergenic
968433718 4:574831-574853 CGCGGGGGTCCTGAGCGGGGCGG + Intergenic
968910110 4:3473214-3473236 CCTGTGGGTCTTGCAAGGGGAGG + Intronic
969655648 4:8496484-8496506 GGTTGAGCTCCTGCATGGGGCGG - Intergenic
969728374 4:8939195-8939217 CTTGGGGGACCTGGGTGGGGTGG - Intergenic
970647686 4:18141841-18141863 GGTGGAGGGCCTGCAGGGGGAGG - Intergenic
976024407 4:80670144-80670166 CATGGGGGTCTGTCATGGGGAGG - Intronic
978370930 4:108029090-108029112 GCTGGGTGTCCTGCCTGGGGTGG + Intronic
984812402 4:183806881-183806903 CGTGGGGGCAGTGCATGCGGGGG - Intergenic
985017578 4:185652432-185652454 CCTGGTTGTCCTCCATGGGGAGG + Intronic
985678353 5:1243716-1243738 CGTGGGGGTCCTGCCTAGATGGG + Exonic
986330562 5:6713782-6713804 CGTCGGGCTCCGGCGTGGGGCGG - Intergenic
987926894 5:24353260-24353282 GGTGGGGCTCCTGCCTGTGGTGG - Intergenic
988099044 5:26655289-26655311 GGTGGGTGGCCTGCCTGGGGAGG - Intergenic
990449493 5:55921373-55921395 CATGGCGGGCCTGCATGGTGTGG + Intronic
995848009 5:116514844-116514866 CCTGGGGGTGATGCAAGGGGAGG - Intronic
997473873 5:134131691-134131713 CCTGGGGGTCCTGGATGGCAGGG - Intronic
1006641598 6:35492256-35492278 CGGGGGGGTCGAGGATGGGGAGG + Intronic
1006725735 6:36197602-36197624 CTTCGGGGACCTGGATGGGGTGG + Intronic
1007238191 6:40406036-40406058 CATGGGGCTCCTTCATGGAGGGG + Intronic
1012379655 6:98604903-98604925 CATGGAGTCCCTGCATGGGGAGG - Intergenic
1017572360 6:155760103-155760125 CGTTGGGGTCCTGCTTAGAGAGG - Intergenic
1017748868 6:157471430-157471452 CTCGGGGGTTCTGGATGGGGAGG - Intronic
1017873250 6:158503470-158503492 CCTGGGGGTTCTGCATGGGCGGG - Exonic
1018471379 6:164101219-164101241 GGAGGGGGTCCTGCAGGTGGAGG - Intergenic
1018471435 6:164101364-164101386 GGAGGGGGACCTGCATGTGGAGG - Intergenic
1018855030 6:167669043-167669065 GGTGAGGGTCCTGGACGGGGTGG - Intergenic
1019355956 7:579107-579129 CGTCCGGGGCCTCCATGGGGTGG - Intronic
1019493522 7:1325813-1325835 CTTGGGGCACCTGGATGGGGCGG - Intergenic
1020130842 7:5557838-5557860 GGTGAGGGTCCTGGATGGGAAGG + Intronic
1021749859 7:23785829-23785851 CGTGGGGGCCTGTCATGGGGTGG + Intronic
1023732540 7:43205968-43205990 AGAGGGTGTCCTGGATGGGGAGG - Intronic
1023882773 7:44329836-44329858 CGTTGGGGGCCTGCCTGGGCTGG - Intronic
1024226165 7:47328158-47328180 CGAGGGAGTCGTGCAGGGGGCGG + Intronic
1024894693 7:54244331-54244353 TGAGGGGGTCCTGTAAGGGGTGG + Intergenic
1027674289 7:81140886-81140908 TTTGGTGTTCCTGCATGGGGAGG - Intergenic
1029698101 7:102227856-102227878 CGTGGGGGTGCAGGGTGGGGAGG - Intronic
1032476921 7:132217850-132217872 AGTGGGGGTGGTGCATGGGTGGG + Intronic
1034338788 7:150339672-150339694 CGTGGGGGTGATGCCTGGGCTGG - Intronic
1034471625 7:151257753-151257775 CCTGGCGCTCCTGCATGGAGAGG - Intronic
1034529483 7:151686669-151686691 AGAGGGGGTCCTGCAGGGGCAGG - Intronic
1035727390 8:1833520-1833542 CGTGAGGGCCGTGCTTGGGGCGG - Intronic
1036210231 8:6835139-6835161 CGGGGGGATCGTGCATGGGCGGG + Intronic
1043229895 8:77788441-77788463 CCTGGGGGACCTGCATGGTGAGG + Intergenic
1047498141 8:125422873-125422895 CGTGGAGGCCCTACATGGTGAGG + Intergenic
1049745425 8:144261224-144261246 CGTGGGGGTGGGGCAGGGGGTGG - Intronic
1049746541 8:144265547-144265569 CGTGGCTGTTCTGCCTGGGGAGG - Intronic
1049804052 8:144530936-144530958 CGTGGCGGACATGCATGGAGGGG + Intronic
1051314148 9:15810477-15810499 CTTGGGGGCCCGCCATGGGGTGG + Intronic
1053055403 9:34990658-34990680 AGTGGGGGTGCTGCTGGGGGTGG - Exonic
1056216352 9:84408902-84408924 CCAGTGGGTCCTGCACGGGGCGG - Intergenic
1056572107 9:87825182-87825204 CCTGGGGGTCCTGCCTGCTGTGG + Intergenic
1058118510 9:101112584-101112606 TGTGGGGGTTCTGCATGTGGAGG - Intronic
1059862541 9:118481056-118481078 AGTGGGGATCCTGCCTTGGGAGG - Intergenic
1059939721 9:119346856-119346878 CGTTGGGGTTCTGCCTGTGGTGG + Intronic
1061119971 9:128636287-128636309 CGTGGGAGGGCTGCGTGGGGTGG + Exonic
1061395909 9:130343220-130343242 CGTTGGGCTCCTGCATGGCTGGG + Intronic
1062187347 9:135224993-135225015 AGTGGGGGCTCTGCAGGGGGTGG - Intergenic
1062479821 9:136746081-136746103 CGTGGGAGTCCTGAGAGGGGCGG + Intronic
1062484686 9:136769324-136769346 CGGGGGGGCAGTGCATGGGGGGG - Intergenic
1062484729 9:136769418-136769440 CGGGGGGGAAGTGCATGGGGGGG - Intergenic
1062533148 9:137010489-137010511 GGGGTGGGGCCTGCATGGGGTGG - Intronic
1062538586 9:137031675-137031697 CTTGGGGGTCCTGGCCGGGGTGG - Exonic
1062600572 9:137317073-137317095 CGTGGCGGGCCTGGAGGGGGTGG + Intronic
1188714988 X:33449506-33449528 CCTGGAGGACCTGCATGGTGAGG - Intergenic
1190756930 X:53409334-53409356 TCTGGGGGTCCTGCATGAAGAGG + Intronic
1192559894 X:72120976-72120998 CGTGGGGGTCCTGGCTGGCCAGG - Intergenic
1199964354 X:152807331-152807353 CCATGGGGTCCTGCATGGTGGGG + Intergenic