ID: 1144951306

View in Genome Browser
Species Human (GRCh38)
Location 17:18995514-18995536
Sequence TTGCAGTCTCAGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 0, 3: 76, 4: 416}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144951303_1144951306 -8 Left 1144951303 17:18995499-18995521 CCAATATATGTGTAATTGCAGTC 0: 1
1: 3
2: 7
3: 34
4: 184
Right 1144951306 17:18995514-18995536 TTGCAGTCTCAGAAGGTGGAAGG 0: 1
1: 0
2: 0
3: 76
4: 416
1144951302_1144951306 -4 Left 1144951302 17:18995495-18995517 CCATCCAATATATGTGTAATTGC 0: 1
1: 0
2: 0
3: 18
4: 163
Right 1144951306 17:18995514-18995536 TTGCAGTCTCAGAAGGTGGAAGG 0: 1
1: 0
2: 0
3: 76
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144951306 Original CRISPR TTGCAGTCTCAGAAGGTGGA AGG Intronic
901748283 1:11389129-11389151 CTGCAGACTCAGAGGGGGGAAGG - Intergenic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
904068010 1:27770130-27770152 TTGCTGGGTCAGAAGGTGCATGG + Intergenic
904287879 1:29464228-29464250 TTGGAGTCTCTGAAGGAGGCAGG - Intergenic
904504936 1:30944356-30944378 TTACAGTCTCCTAAGGTGGGTGG - Intronic
905338342 1:37260612-37260634 TTGGAGCCCCAGAAGGTTGAGGG + Intergenic
906994254 1:50773315-50773337 CTGCAGACTCAGAAGTGGGATGG - Intronic
910402255 1:86848891-86848913 TAGCAGACTCAGAAATTGGAAGG + Intergenic
910877018 1:91886759-91886781 ATGCAGTCTCAGCTGCTGGAGGG - Intronic
911365658 1:96934532-96934554 TTGCAGGCTTTGAAGATGGAAGG - Intergenic
911946207 1:104112760-104112782 TTGGAGACTCAAAAGGGGGAAGG - Intergenic
912003539 1:104864322-104864344 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
912174098 1:107137215-107137237 TTGTATTCTCACATGGTGGAAGG - Intergenic
912632135 1:111255052-111255074 GTGCCTTCTCAGAAGGTGGTTGG + Intergenic
915047063 1:153026809-153026831 AAGCAGTCTCAGAAGCTGGCAGG + Intergenic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
915983804 1:160442925-160442947 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
916299744 1:163260491-163260513 TTACAGACTCAGCAGGGGGAGGG + Intronic
917410822 1:174758452-174758474 TTGGAGACTCAGAAGGGGAAAGG - Intronic
918566880 1:185944302-185944324 TTGAAGACTCAGAAGGGAGAGGG + Intronic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
919664087 1:200275479-200275501 TTGCATTCTCTCAAGGTGGAAGG - Intergenic
920365405 1:205445588-205445610 TTGCAGTCTGGAAAAGTGGAGGG - Intronic
920376744 1:205512847-205512869 TCTCAGTCTCAGGAGGGGGAGGG - Intronic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
921277565 1:213535008-213535030 TTGCAGTGTCAGTAGGTTGTAGG - Intergenic
921562753 1:216677945-216677967 TTGCAGCATCAGAATGAGGAAGG - Intronic
921773752 1:219073096-219073118 TTGGAGACTTGGAAGGTGGAAGG - Intergenic
921883533 1:220280287-220280309 TTGCAGTCTAAGGAGCTGCAGGG + Intergenic
924688163 1:246317434-246317456 TTGCAGACTGAGCAGGTGGTGGG - Intronic
1063381196 10:5587375-5587397 TTGCAGTCAGGGAAGCTGGAAGG - Intergenic
1063912763 10:10848996-10849018 TTGCAATTTCAGAAGAAGGACGG - Intergenic
1064067157 10:12191959-12191981 TTGCAGCCTCAGCAGATGGCCGG - Intronic
1064293504 10:14056551-14056573 TTTCAGTTACAGAGGGTGGAGGG - Intronic
1065187739 10:23185411-23185433 TTGCAGACTCAGAAGTGGGGTGG + Intergenic
1065853609 10:29812290-29812312 TTGCACCCTCAGAAGATAGATGG - Intergenic
1065997512 10:31072751-31072773 TTGCACTCTCCTAAGCTGGAAGG - Intergenic
1066697271 10:38090632-38090654 TTGAAGTCTCAGAAGCAGGAAGG + Intergenic
1066995261 10:42556833-42556855 TTGAAGTCTTAGAAGCAGGAAGG - Intergenic
1069959453 10:72071042-72071064 TTGCAGTCTTAGAAGGCTGCAGG - Intronic
1070316815 10:75321442-75321464 TGGAAGTCTCAGAAGGAGAAAGG + Intergenic
1070470471 10:76774342-76774364 TTGCTGGCTTGGAAGGTGGAGGG + Intergenic
1070627521 10:78061851-78061873 TAGAGATCTCAGAAGGTGGAGGG - Intergenic
1070707063 10:78647514-78647536 CAGCAGACTCAGAAGATGGAAGG - Intergenic
1071327887 10:84534761-84534783 TTACAGGCTTATAAGGTGGAAGG + Intergenic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1074734847 10:116419596-116419618 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
1076037667 10:127214483-127214505 TTGCAGTCTCTCCAGGTTGATGG + Intronic
1076260326 10:129059953-129059975 CTGCAGTCACAGAATGTGGCAGG + Intergenic
1076799158 10:132812638-132812660 CTGCAGTCACAGAGGGTGGGGGG + Intronic
1077327827 11:1971329-1971351 AGGCAGTGTCAGGAGGTGGATGG - Intronic
1079812812 11:25016308-25016330 TTACAGACTCAGAAGGGGGAAGG - Intronic
1080050066 11:27850679-27850701 TTGCTGGCTCTGAAGGTGGATGG - Intergenic
1080675792 11:34425551-34425573 TTTGAGACTCAGAAGGGGGAGGG + Intergenic
1081155908 11:39690144-39690166 TTGGAGACTCAGAAAGGGGAAGG - Intergenic
1081493584 11:43584506-43584528 CTGCTGTCTCAGAAGGAGAATGG - Intronic
1082119269 11:48360618-48360640 TTGGAGACTCAGAAGCGGGAAGG + Intergenic
1082202983 11:49396303-49396325 TTTGAGACTCAGAAGGTGGGAGG - Intergenic
1083809520 11:65095982-65096004 CTGCTGTCCCAGAAGGGGGACGG - Intronic
1084162579 11:67357872-67357894 TTGCAATGTCAAAGGGTGGAGGG - Intronic
1084233410 11:67769830-67769852 TTCCAGGCTCAGGAGGTGGCTGG + Intergenic
1084680213 11:70662480-70662502 TTGCAGCCTTGGAAGGTGGCCGG + Intronic
1086652048 11:89303776-89303798 TTTGAAACTCAGAAGGTGGAAGG + Intergenic
1089654854 11:119939886-119939908 TTACAGTCACAGAAGCTGGATGG - Intergenic
1090814065 11:130275171-130275193 TTCCAGTGTCTTAAGGTGGAGGG + Intronic
1090834904 11:130447249-130447271 TTGCTGTCTCAGAGGGTTGGCGG + Intergenic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1202810807 11_KI270721v1_random:26509-26531 AGGCAGTGTCAGGAGGTGGATGG - Intergenic
1091616752 12:2055298-2055320 ACGCAGTCTCAGAACCTGGAGGG - Intronic
1091715953 12:2776305-2776327 TTGCTGGCTCCGAAGCTGGAGGG + Intergenic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093012064 12:14117855-14117877 TTGGAGTCCCAGAAGGAGAAGGG + Intergenic
1093418988 12:18952777-18952799 TTACAGTCTCTGGAGGAGGAGGG + Intergenic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094143975 12:27209624-27209646 ATGGAGGCTCAGAAGGGGGAGGG + Intergenic
1095557914 12:43529640-43529662 TTGGAGACTCAGAAGCGGGAGGG + Intronic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1098078275 12:66756851-66756873 TGGCAGTCTCTGAAGGCAGAAGG - Intronic
1098819956 12:75214601-75214623 TTGCATCCTCAGATGGTGGAAGG + Intergenic
1101616480 12:106342895-106342917 TTGCAGTATCAGAAGGAAGAGGG + Intronic
1101831750 12:108263277-108263299 TTCCAGACTCAAAAGGAGGAAGG - Intergenic
1103301150 12:119927426-119927448 CTGCATCCTCAGACGGTGGAAGG - Intergenic
1105513350 13:21069649-21069671 TTGGAGTCTCTGGAGGTGGCTGG - Intergenic
1107242987 13:38259971-38259993 TTGCTGGCTTTGAAGGTGGAAGG - Intergenic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108252135 13:48577931-48577953 TTTGTGTCTCAGAAGGAGGAAGG - Intergenic
1108404560 13:50086995-50087017 TTGCTGACTCTGAAGGTGGAAGG + Intronic
1108415659 13:50195998-50196020 CTGCATTCTCACATGGTGGAAGG + Intronic
1108738994 13:53315143-53315165 TTGGAGACTCAGAAGAGGGAGGG + Intergenic
1108822425 13:54369604-54369626 TTGGAGGCTCAGAAGGGAGAGGG - Intergenic
1109940797 13:69361373-69361395 TTGAAGACTCAGAAGGGGGAAGG + Intergenic
1111533763 13:89574959-89574981 ATCCAGTCTCTGAATGTGGACGG + Intergenic
1111677027 13:91399586-91399608 CTGCTTTCTCATAAGGTGGAGGG + Intronic
1112950129 13:104984368-104984390 TTGCAGTTTCAGTAGCTGGCTGG + Intergenic
1115653899 14:35424356-35424378 TTGCTGGCTTTGAAGGTGGAGGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116042001 14:39697407-39697429 TTGGAGACTCAGAAGGGGGGAGG - Intergenic
1117640501 14:57793399-57793421 TTGGAGGCTCAGAAGGTAGAAGG - Intronic
1117740135 14:58809526-58809548 ATGGAGTCTCAGAAGGGTGAGGG - Intergenic
1121451419 14:94010700-94010722 GAGCAGTCTGAGAAGGTGGCTGG + Intergenic
1121880532 14:97496782-97496804 TGGCAATGTAAGAAGGTGGAGGG + Intergenic
1122470488 14:101962784-101962806 TCTGAGTCTCAGATGGTGGATGG + Intergenic
1124643438 15:31415714-31415736 TTCCAGTCTCTTAAGGTGAAAGG - Intronic
1125137825 15:36364931-36364953 ATGCAGTCTCAGAAGCCAGAGGG + Intergenic
1125442220 15:39715252-39715274 TAGGAGTCTCAGGAGTTGGAGGG - Intronic
1125970911 15:43910992-43911014 TTGCAGTTTCACTAGTTGGATGG + Intronic
1125987397 15:44067580-44067602 CTGCATCCTCAGAGGGTGGAGGG + Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1127904760 15:63368407-63368429 CTGCAGTCTTAGAAGGAGCAGGG - Intronic
1128505461 15:68267959-68267981 TTGCATTGGCAGAAGGTGAAAGG + Intergenic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1130685544 15:86033893-86033915 CTGCATTCTCACATGGTGGAAGG + Intergenic
1130824256 15:87527663-87527685 TTTTATTCTCAGAAGGTTGATGG - Intergenic
1131398472 15:92105594-92105616 TGGCAGTCTCAGAAGCTGCTCGG + Intronic
1133235851 16:4387108-4387130 TTGAAGTTTCAGAAGGCGGATGG + Intronic
1133263328 16:4567069-4567091 TTCCAGTGTCTTAAGGTGGAAGG + Intronic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1133542090 16:6765962-6765984 TTGGAGACTCAGAAGATGGGAGG + Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1133922189 16:10163286-10163308 CACCAGGCTCAGAAGGTGGAAGG + Intronic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135407759 16:22210223-22210245 CTCCAGAGTCAGAAGGTGGATGG + Intronic
1135948590 16:26889844-26889866 TTCCAGACTCAGAAAGAGGAGGG - Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1139128207 16:64107818-64107840 GTGCAGCCTCACATGGTGGAAGG - Intergenic
1139295083 16:65893695-65893717 TCGCAGGCTGAGATGGTGGAAGG + Intergenic
1139316736 16:66078387-66078409 TTGCAGACTCAGAAGAGGGGAGG - Intergenic
1139532622 16:67550110-67550132 ATGCAGCCTCAGCATGTGGATGG - Intergenic
1139653136 16:68372524-68372546 TGGCAGGCTCAGCAGGTGGCTGG + Intronic
1141030387 16:80582631-80582653 TTAGAGACTCAGAAGGAGGAAGG + Intergenic
1141350603 16:83291442-83291464 TTGCACTATCAGGTGGTGGAAGG - Intronic
1144211152 17:13016826-13016848 TTGCAGTGTCAGAGGCTGGTGGG - Intronic
1144591435 17:16527440-16527462 TGGCAGCCCCAGAAGCTGGAAGG - Intergenic
1144774077 17:17775738-17775760 TTGCTGTCTCGGGTGGTGGAGGG + Intronic
1144951306 17:18995514-18995536 TTGCAGTCTCAGAAGGTGGAAGG + Intronic
1146614567 17:34344618-34344640 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1148579919 17:48736384-48736406 CTCCAGTCTCAGAAGGTGTCAGG - Intergenic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1150151409 17:62811800-62811822 TTGCATCCTCATATGGTGGAAGG + Intergenic
1150567994 17:66360185-66360207 TTGCAGTATTTGAAGTTGGAGGG + Intronic
1152260175 17:79262576-79262598 TTCCAGTCTCAAGAGGTGGAGGG + Intronic
1153078064 18:1188722-1188744 CTGCTATCTTAGAAGGTGGAGGG - Intergenic
1153343964 18:4006529-4006551 TTGCAGTCACAGTTGGAGGAGGG + Intronic
1154083855 18:11282863-11282885 TTGGAGACTCAGAAGGGTGAGGG - Intergenic
1154181998 18:12146065-12146087 CTGCAGTCTCTGAAGGCCGAAGG - Intergenic
1155146141 18:23085167-23085189 TTGCAGTCTCTGGAAGTTGAGGG + Intergenic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155605458 18:27600707-27600729 TGGAAGTGTCACAAGGTGGAGGG - Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1157394702 18:47331860-47331882 AAGCAGACTCAGAAGCTGGAAGG - Intergenic
1158242233 18:55389934-55389956 GAGCAGTCTCAGATGGTGGCTGG + Intronic
1158609733 18:58928242-58928264 TGGCAGTCTCAGAAGGCTAAAGG - Intronic
1158867777 18:61654551-61654573 ATGGAGTCTCATAAGGTAGAGGG + Intergenic
1159046262 18:63371079-63371101 CAGCACTCTCAGAAGTTGGATGG - Intergenic
1159794214 18:72822228-72822250 CTCAAGTCTCAGAGGGTGGAGGG + Intronic
1160047326 18:75399126-75399148 TTTCTGGCTCAGGAGGTGGAAGG - Intergenic
1160363094 18:78300949-78300971 TCATAGTCTCAGAAGGTAGAAGG - Intergenic
1161652304 19:5492822-5492844 TTGCAGGCGAAGAATGTGGACGG - Intergenic
1162050082 19:8027720-8027742 TTGCAGCCACAGCAGGTAGAAGG + Intronic
1163296154 19:16414146-16414168 TTGCTGACTTTGAAGGTGGAGGG + Intronic
1163554172 19:17983197-17983219 TGGCAGTCTCAGAGGCAGGAGGG + Intronic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164471785 19:28542228-28542250 TGGGAGACTCAGAAGGGGGAGGG + Intergenic
1164851482 19:31487905-31487927 TTGCAATAGCTGAAGGTGGAAGG - Intergenic
1165282009 19:34805759-34805781 TGGCAGTCTGAGAAGTTGGGTGG - Intergenic
1165854527 19:38871482-38871504 TTGTAGTCCCAGAGGGAGGAGGG - Intronic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1168214957 19:54918608-54918630 TCAGAGTCTCAGAAGGGGGAGGG - Intergenic
925152676 2:1625995-1626017 CAGCAGACTCACAAGGTGGACGG + Intergenic
926607415 2:14911364-14911386 TTCCTGAGTCAGAAGGTGGAAGG - Intergenic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
927126950 2:20020835-20020857 TTGCAGTCTCATAGGCTGAAGGG - Intergenic
927137197 2:20105620-20105642 TTGCAGTGACAAAGGGTGGAGGG - Intergenic
927144662 2:20154947-20154969 TTGGAGTCTCAGAAAGAGGTGGG + Intergenic
927440311 2:23111414-23111436 TTGCATGCCCAGAGGGTGGAAGG - Intergenic
927812372 2:26187292-26187314 TTGCAGTCTCCCCAGGTGCATGG - Exonic
930407508 2:50978520-50978542 TTACAGTATCAGAAGTTGGAAGG - Intronic
931412201 2:62043393-62043415 TTTCAGTCTCATAAGGAAGAAGG + Intronic
932362285 2:71118824-71118846 TTGCAGTGTCAGAGTGAGGAGGG - Intronic
932812603 2:74836914-74836936 TTGTAGTCTGAGGACGTGGAAGG + Intronic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
933850530 2:86362940-86362962 CTGCATTCTCACATGGTGGAAGG - Intergenic
933901934 2:86856293-86856315 TCAGAGTCTGAGAAGGTGGAGGG - Intronic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
933997886 2:87683312-87683334 ATGCACACTCACAAGGTGGATGG - Intergenic
935274706 2:101466161-101466183 TTGCAGTGTCAGGGGGTGCATGG - Intronic
935386890 2:102509259-102509281 TTGCAGGCTCTGAAGATGGAAGG - Intronic
935778609 2:106492972-106492994 TCAGAGTCTGAGAAGGTGGAGGG + Intergenic
936295965 2:111267554-111267576 ATGCACACTCACAAGGTGGATGG + Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
937553657 2:123127567-123127589 ATGCAGTCTGAGAAGATGGCCGG - Intergenic
937596035 2:123674596-123674618 TTGCAGTTTTGGAGGGTGGAAGG - Intergenic
938903124 2:135815409-135815431 TTCCATTTTCAGAAGGTGGGTGG + Intronic
939904988 2:147901836-147901858 TTGCAGTCTCTGAAGCAGTATGG + Intronic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
941197224 2:162467899-162467921 TTGCATCCTCAGGTGGTGGAAGG + Intronic
941564634 2:167091298-167091320 TTGGAGTCTCAGAAGTGGCAGGG - Intronic
943020449 2:182566303-182566325 TTACAGTATTAGAAGGTGTAGGG - Intergenic
943494995 2:188609379-188609401 AGGCATTCTCAGAGGGTGGAAGG + Intergenic
945932295 2:215867055-215867077 TTGCTGGCTTAGAAGCTGGAAGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946881213 2:224179101-224179123 GTCTAGTCTCAGAAGATGGAAGG - Intergenic
948917542 2:241043065-241043087 TTGGAGTCTGCGAAGGAGGATGG + Intronic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169416576 20:5422345-5422367 TTAGAGACTCAGAAGCTGGAGGG + Intergenic
1169635795 20:7690045-7690067 CTGCAGTCTCACATGGTAGAAGG - Intergenic
1169766780 20:9155105-9155127 TTACAGACTCAGAAGGGGAAGGG - Intronic
1170809195 20:19660292-19660314 TTGGAGACTTAGAAGGTGGGGGG - Intronic
1171042073 20:21773917-21773939 CTGCAGACTCAGAAGGTGGGAGG - Intergenic
1171171628 20:23020502-23020524 CTGCATTCTCAGAAGGTTAAGGG + Intergenic
1173020935 20:39267869-39267891 TTGCAGTCTCTGACCCTGGATGG - Intergenic
1173139446 20:40469583-40469605 CAGCAGTCTCAGAAGGTGTCTGG - Intergenic
1173461749 20:43248534-43248556 TTGCAGACTCAGCAGGTTTAGGG + Intergenic
1174413587 20:50352231-50352253 TTGCCATCCCAGAAGGTGCAAGG - Intergenic
1176097883 20:63352632-63352654 TTTGTGCCTCAGAAGGTGGAGGG - Intronic
1176988531 21:15465587-15465609 TGGCAGCCTCACATGGTGGAAGG - Intergenic
1177267710 21:18805880-18805902 TTCGAGTCTCAGAATGGGGAGGG + Intergenic
1177547368 21:22576217-22576239 TTGCTGGCTTAGAAGATGGAGGG + Intergenic
1178816452 21:35934553-35934575 GTTCAGTCTGGGAAGGTGGAGGG - Intronic
1179058120 21:37954715-37954737 TTCCAGTTTCAGAAGGTGGCTGG + Intronic
1181447949 22:22993083-22993105 TGGCAGGCTCTGAAGGTGGGTGG + Intergenic
1183022198 22:35036373-35036395 TTGCATCCTCACAAGGTGGAAGG - Intergenic
1183414243 22:37673497-37673519 CAGCAGTTTCAGAAGGGGGACGG + Intergenic
950297406 3:11843752-11843774 TTGCAGTGTGAGGAGGTGGTTGG - Intronic
951495177 3:23317442-23317464 ATGCAGTCTCTGCTGGTGGATGG + Intronic
952494447 3:33903617-33903639 CTGCTGTGGCAGAAGGTGGAAGG + Intergenic
952641651 3:35603800-35603822 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
952643374 3:35625390-35625412 TTGGAGACTCAGAAGTGGGATGG - Intergenic
952749202 3:36811533-36811555 TTAGGGACTCAGAAGGTGGAGGG + Intergenic
955032548 3:55234811-55234833 TTGGAGACTCAGGAGGGGGATGG - Intergenic
955276695 3:57553856-57553878 TTGCTGTCTCCCAAGCTGGAGGG + Intergenic
955980800 3:64525362-64525384 GTGCAGGCGCAGAGGGTGGAGGG - Intronic
956992366 3:74781889-74781911 TTGAAGACTCAGAAGCTGGGAGG + Intergenic
957050694 3:75409717-75409739 TTCCAGGCTCAGGAGGTGGCTGG + Intergenic
957491925 3:80938762-80938784 TTGAAATCTCAAAAGGTGGTTGG - Intergenic
957959286 3:87227952-87227974 TGGCAGTCTCGGAATGGGGAGGG + Intronic
958648868 3:96910226-96910248 TTGCTGCCTCAGAAATTGGATGG - Intronic
959574450 3:107919330-107919352 ATGCAATTTCAGAAGGTAGAAGG + Intergenic
960059573 3:113307076-113307098 TTGCAGTCTCAATAGATGAACGG - Intronic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960414953 3:117373246-117373268 TTGGATACTCAGAAGGTAGAGGG - Intergenic
960806710 3:121590555-121590577 TTCCAGTCTCAGACGGAAGATGG - Intergenic
960840883 3:121957436-121957458 TTGGAGTCTCAGAAGGGGATAGG + Intergenic
962237111 3:133716060-133716082 GTGCAGTGTCAGGAGGGGGAAGG - Intergenic
962250939 3:133835790-133835812 CTGCATCCTCACAAGGTGGAAGG - Intronic
962695546 3:137943927-137943949 TTGCAGCCTCAGAAGTTTCAAGG + Intergenic
963525986 3:146413991-146414013 GTGAAGTCCAAGAAGGTGGAAGG + Intronic
966737861 3:183203626-183203648 TGGCAGTCTCAGAAGGAGAGAGG + Intronic
966846488 3:184134727-184134749 TTGAACTCTCAGAAGGATGAAGG - Intergenic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968857548 4:3138394-3138416 TTGGAGACTCACAAGGCGGAAGG - Intronic
969821738 4:9725938-9725960 TTCCAGTCTCTGGAGGTGGCTGG - Intergenic
970381494 4:15512580-15512602 TTTCAGTCTGGGAAGATGGATGG + Intronic
970559063 4:17265182-17265204 CTGCATCCTCACAAGGTGGAAGG + Intergenic
970660145 4:18276191-18276213 TTGTGGTCTCAGAAGGAGTATGG + Intergenic
971519886 4:27536202-27536224 TTGCAGACTCAGAAGGTGAGAGG - Intergenic
972367245 4:38387707-38387729 TTGCAGCCTAAGTGGGTGGAAGG + Intergenic
973235122 4:47893234-47893256 TTAAAGTCTCAGAAGGTGACGGG + Intronic
975290482 4:72672115-72672137 TTGGAGACTCAGAAGTGGGAGGG - Intergenic
975479192 4:74858778-74858800 TTGCAGTGTGTGAAGGTGTAGGG - Intergenic
976171927 4:82313263-82313285 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
976733006 4:88283546-88283568 TTGCAGTCTCAAAAGCTCCACGG - Intronic
977198948 4:94092490-94092512 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
978002450 4:103573009-103573031 TTTGAGTCTTAGAAGGTGGATGG + Intergenic
978161610 4:105555166-105555188 TTGGATTCTTTGAAGGTGGAAGG + Intronic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
979465763 4:121036763-121036785 CTTCTGTCTCAGAATGTGGAAGG - Exonic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981372326 4:143973046-143973068 TTGGAGACTCAGAAGCGGGAGGG - Intergenic
982765029 4:159336328-159336350 TTGGAGACTCAGAAGGGGAAGGG - Intronic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
982997411 4:162367153-162367175 TTACAGTCTTGGAAGGTGCAAGG - Intergenic
983557842 4:169074242-169074264 CTGCATTCTCACATGGTGGAAGG + Intergenic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
985770517 5:1807321-1807343 TTTCAGTTTACGAAGGTGGAAGG + Intronic
986496800 5:8350517-8350539 TTGCATCCTCACATGGTGGAAGG - Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
987900336 5:24002852-24002874 TAGCACTCTCTGAAGTTGGATGG + Intronic
988669205 5:33362796-33362818 CTGCAGTCTGAGAAGGAGGCAGG + Intergenic
988774390 5:34464082-34464104 GTGGAGTCACAGAGGGTGGAAGG + Intergenic
990232521 5:53729129-53729151 CTGTAGTCCCAGAAGGTGGAGGG + Intergenic
991063706 5:62403983-62404005 TTGGAGTCACAGAGGGAGGAAGG + Intronic
991602589 5:68368355-68368377 TTGCTGTCTCAGTGTGTGGATGG + Intergenic
991671352 5:69051278-69051300 TTGCATCCTCACATGGTGGAAGG - Intergenic
992368059 5:76113504-76113526 TTGTAGTCTGATAGGGTGGATGG + Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992658469 5:78933972-78933994 TTAAAGGCTCTGAAGGTGGAAGG + Intronic
993540051 5:89138136-89138158 TTGGAGACTCTGAAGGGGGAAGG - Intergenic
994313544 5:98305497-98305519 TTGAAGACTCAGAAGTGGGAAGG + Intergenic
994624427 5:102200665-102200687 TGGAAGTGTCAGAAGGTTGATGG - Intergenic
995010463 5:107252019-107252041 ATGCAGTCTCAAAAGGCGGTAGG + Intergenic
995088776 5:108147022-108147044 TTGCATCCTCACATGGTGGAAGG + Intronic
996339406 5:122419279-122419301 GTGCAGTCTTAGAATGTGCAAGG - Intronic
997497344 5:134340299-134340321 TTCCAGTGTCTTAAGGTGGAAGG - Intronic
997642855 5:135460845-135460867 CTGCACTCTGAGAACGTGGAGGG - Intergenic
999382489 5:151131322-151131344 TGGCTGCCTCAGAAGGGGGATGG + Intronic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1002050292 5:176566700-176566722 TTCCAGTCACAGAAGGAGGAAGG + Intronic
1002065730 5:176650804-176650826 GTGCAGTCTCAGAGGGGGAAAGG - Intronic
1002347899 5:178560738-178560760 TTTCCGGCTCAGAAGTTGGACGG - Exonic
1003423344 6:5977893-5977915 TTGCAGGCTTTGAAGATGGAGGG - Intergenic
1004170671 6:13293323-13293345 TTGGGGACTCAGAAGGGGGAGGG + Intronic
1004950300 6:20662754-20662776 TGACAGACACAGAAGGTGGAAGG - Intronic
1004984079 6:21059917-21059939 GTGAAGACTCAGAAGGGGGAGGG - Intronic
1005671504 6:28110475-28110497 GGGCAGTTTCAGGAGGTGGATGG + Intergenic
1006777155 6:36603860-36603882 TTGCAGGCTCTTAAGTTGGAAGG + Exonic
1009271374 6:61619262-61619284 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1009806697 6:68608510-68608532 TTGTAGTATCAGATGGAGGAAGG + Intergenic
1010321726 6:74518192-74518214 TGGCAGTCTCAGAAAGGGAAAGG + Intergenic
1011553799 6:88554007-88554029 TTGGAGTCTCAGATGCAGGACGG - Intergenic
1011960954 6:93089309-93089331 TTGCAATATGAGAAGGTGGAAGG + Intergenic
1012182137 6:96167404-96167426 TTGCAGCATCACAAGGTGGAGGG + Intronic
1013795807 6:113887402-113887424 TTGCGGTCTGAGAAGGTGTCAGG + Intergenic
1013858448 6:114604544-114604566 TTGGAGTCTCAGAAGTGGGGAGG + Intergenic
1014031560 6:116711395-116711417 TTGTAATTTCTGAAGGTGGAAGG + Intronic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014162292 6:118184448-118184470 TTGCTTACTCAGAAGTTGGATGG - Intronic
1014393648 6:120896133-120896155 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1016311095 6:142734348-142734370 TTTCAGTTTCAAAAGGTTGAGGG - Intergenic
1016385971 6:143531243-143531265 TTGGAGACTCAGAAAGGGGAGGG + Intergenic
1016681133 6:146830506-146830528 GTTTAGTCTGAGAAGGTGGAAGG - Intergenic
1017100573 6:150846438-150846460 TTGAAGTCAAATAAGGTGGAAGG + Intergenic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017367038 6:153655142-153655164 TTTCAGTGTAAAAAGGTGGATGG - Intergenic
1017446563 6:154511606-154511628 TTGCAGTCCATGAATGTGGAAGG - Intergenic
1017580548 6:155859866-155859888 TTGCAGACTCATTAAGTGGAAGG + Intergenic
1018402058 6:163433291-163433313 TTGAAGCCTGAGAAGGGGGAAGG + Intronic
1018696944 6:166397788-166397810 CTGTGGTCCCAGAAGGTGGAGGG - Intergenic
1018896264 6:168019792-168019814 TTGCAGTCCCAAAAGGTGACGGG + Intronic
1019661957 7:2229513-2229535 TTGTGGTCTCAGACTGTGGAGGG - Intronic
1020317013 7:6912888-6912910 TTCCAGGCTCAGGAGGTGGCTGG + Intergenic
1020511693 7:9064727-9064749 CTGCATCCTCACAAGGTGGAAGG - Intergenic
1021466500 7:20949987-20950009 TTGGAGACTCAGAAGGTGGGAGG + Intergenic
1021550730 7:21868446-21868468 ATGCAGTCTCACAAGGTGAGAGG + Intronic
1021681860 7:23141380-23141402 TTGCTGTCTTTGAAGGTGGAAGG + Intronic
1021873132 7:25023194-25023216 TTGGAGACTCTGAAGGGGGAGGG - Intergenic
1022492077 7:30828692-30828714 CTGCCGTCTGACAAGGTGGATGG + Exonic
1022751417 7:33230577-33230599 TTGCAGACTCAGAAGCAGGCAGG - Intronic
1023352725 7:39336311-39336333 TGCCAGGCTCTGAAGGTGGAAGG - Intronic
1025256926 7:57390343-57390365 TTGCCATCCCAGAAGGTGCAAGG + Intergenic
1026387200 7:69861847-69861869 TTCCCGTCTCAGAAGATGGCAGG + Intronic
1027345497 7:77255406-77255428 TTGGATTATCAGAAGGTGGAAGG - Intronic
1027528723 7:79303145-79303167 TTGGAGACTCAGAGGGTGGAAGG + Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028858922 7:95625105-95625127 TTGCAGTGTCTTAAAGTGGAAGG - Intergenic
1029040425 7:97567121-97567143 ACAAAGTCTCAGAAGGTGGAAGG - Intergenic
1030574432 7:111268269-111268291 GTGAAGTCTCACAGGGTGGAAGG + Intronic
1031003674 7:116447250-116447272 TTGGAGACTCAGAAGAGGGAGGG + Intronic
1032873491 7:136011686-136011708 TTGCCGTCTTTGAAGATGGAAGG + Intergenic
1033407883 7:141088322-141088344 GAGCAGTCTCAGGAGGGGGATGG - Intronic
1033607158 7:142936084-142936106 TTCCAGTCTAAGGAGATGGAGGG + Intergenic
1035130414 7:156647352-156647374 TTGGAGACTCAGGAGGCGGAGGG - Intronic
1035130501 7:156648261-156648283 TTGGAGTCACACAAGGTGGAGGG + Intronic
1035343219 7:158178354-158178376 TTGGAGACTCAGAAGCGGGAGGG - Intronic
1035543755 8:462732-462754 TTGGAGACTCAGAAGAGGGAAGG + Intronic
1036013878 8:4758930-4758952 TTTCAGTAGCAGACGGTGGAGGG + Intronic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036577884 8:10045354-10045376 TTGCAGCCTGGGAAGGGGGATGG - Intergenic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1039099742 8:33928481-33928503 CTGCATTCTCACATGGTGGAAGG + Intergenic
1039201661 8:35101341-35101363 TTAGAGCCTCAGAAGGAGGACGG - Intergenic
1039208294 8:35182250-35182272 TTGCAGACTCAGAATGGGGGAGG + Intergenic
1039791107 8:40876179-40876201 TTGCTGTCTCAGGAGGGGCAGGG - Intronic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1040719859 8:50306051-50306073 TTAGAGACTCAGAAGGGGGAGGG - Intronic
1041151953 8:54944242-54944264 CTCCAGTGGCAGAAGGTGGAGGG + Intergenic
1041319254 8:56596363-56596385 TAGGAGACTCAGAAGGTGGGAGG - Intergenic
1042179067 8:66066709-66066731 TCGGAGACTCAGAAGGGGGAGGG + Intronic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1042979694 8:74511839-74511861 CTGCAGTCCTAGAAGATGGATGG + Intergenic
1042985661 8:74580282-74580304 TTGCTGGCTCTGAAGATGGAGGG - Intergenic
1043367596 8:79553275-79553297 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1044661534 8:94596140-94596162 ATTCAGATTCAGAAGGTGGAAGG + Intergenic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1045328716 8:101137035-101137057 TTGCATTCACAAATGGTGGAGGG + Intergenic
1046015764 8:108603381-108603403 TTGCATCCTCACATGGTGGAGGG + Intergenic
1046232951 8:111381475-111381497 TTGGAGACTCAGAAGGGGGCAGG - Intergenic
1046238964 8:111465187-111465209 TTAGAGACTCAGAATGTGGAGGG + Intergenic
1046396747 8:113650281-113650303 ATGCACCCTCACAAGGTGGAAGG - Intergenic
1046825875 8:118690799-118690821 TTGGAGTCTCAGAAGTGGGGAGG - Intergenic
1046870654 8:119202530-119202552 TTAGAGTCTCAGAAGGAGAAGGG - Intronic
1047003561 8:120596703-120596725 TTGCTGGCTTTGAAGGTGGAAGG - Intronic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1048104858 8:131396878-131396900 TTGCAGCCTGATAAGGTAGAGGG - Intergenic
1049813663 8:144587970-144587992 CTCCAGTCTCTGAAGGTGGAAGG + Intronic
1050125854 9:2355694-2355716 TCACAGTCTCAGAAGATGGCAGG + Intergenic
1051314525 9:15813985-15814007 TTGCAGTTTCAGTAAATGGAAGG + Intronic
1051533052 9:18126872-18126894 TTGCAGTATGAGAAGATAGAGGG + Intergenic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053145476 9:35709060-35709082 ATGCATTTTCAGAAGGTGGGGGG + Intronic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053525064 9:38820818-38820840 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1053532198 9:38893854-38893876 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054197295 9:62045240-62045262 TTGGAGACTCAGAAGGGGAAGGG - Intergenic
1054204421 9:62118263-62118285 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054633940 9:67470101-67470123 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
1054641114 9:67543442-67543464 TTGGAGACTCAGAAGGGGAAGGG + Intergenic
1054990186 9:71316585-71316607 TTGCTGTCTTTGAAGATGGAAGG + Intronic
1055340091 9:75272403-75272425 TTGGAAACTCAGAAGGGGGAAGG - Intergenic
1055413766 9:76060487-76060509 TTGCAGTCTCAGGGGTGGGAAGG + Intronic
1055560990 9:77521555-77521577 TTCCATTCTCAGAAAGTGGAAGG - Intronic
1055611114 9:78025645-78025667 TTTCTCCCTCAGAAGGTGGAGGG - Intronic
1055709752 9:79047855-79047877 TTGCATTCCCAGGAGGTGGAAGG + Intergenic
1055808650 9:80125465-80125487 TTGCCTTCTCTGCAGGTGGAAGG + Intergenic
1056024712 9:82481754-82481776 TTGGAGTTTCAGAAAGTAGATGG - Intergenic
1056121510 9:83493162-83493184 TTACAGTCCCAGGAGTTGGAAGG + Intronic
1056784319 9:89579176-89579198 TTGCTGGCTTTGAAGGTGGAGGG + Intergenic
1057936563 9:99244451-99244473 TAACAGTCTCTGAAAGTGGAAGG + Intergenic
1058455409 9:105133682-105133704 TTGCAGTTAGAGAAGGTGAAAGG + Intergenic
1059616413 9:115956309-115956331 TTGGAGTCAGAGAAGGTGGTGGG - Intergenic
1059636923 9:116180130-116180152 TTGGAGTCACAGAATGTGGATGG + Intronic
1060957730 9:127655756-127655778 TTGCTGTCTCCCAAGCTGGAGGG + Intronic
1061694942 9:132365681-132365703 TTGCTGGCTCTGAAGCTGGAAGG + Intergenic
1062066505 9:134530486-134530508 TTGGGGTCTCATAAGGTTGAAGG + Intergenic
1062192227 9:135253902-135253924 TTGCAGGCTCAGGCGGTAGATGG - Intergenic
1185926441 X:4152321-4152343 TTGGACACTCAGAAGGGGGAGGG - Intergenic
1185998961 X:4987314-4987336 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1186835861 X:13437159-13437181 TTGGAGACTCAGAAGGGTGAGGG + Intergenic
1187435537 X:19265404-19265426 TCAGAGACTCAGAAGGTGGAGGG - Intergenic
1187586657 X:20669993-20670015 TTGGATACTCAGAAGGGGGAAGG - Intergenic
1188124098 X:26346281-26346303 TTTCATTCTCTGAAGGTGGTTGG + Intergenic
1188919810 X:35958959-35958981 TTTCTGGCTCTGAAGGTGGAAGG + Intronic
1189027704 X:37414772-37414794 ATACAGCCTCAAAAGGTGGATGG - Intronic
1190056340 X:47183215-47183237 ATGGAGACTCAAAAGGTGGAGGG + Intronic
1190425043 X:50327992-50328014 TTGCTGGCTTTGAAGGTGGAAGG + Intronic
1190705926 X:53028163-53028185 TTCCAGGCTCAGAAGGTGATTGG + Intergenic
1191673177 X:63768135-63768157 TTGGAGACTCAGAAGGGGAAGGG - Intronic
1191885635 X:65885031-65885053 CTGCATCCTCAGATGGTGGAAGG - Intergenic
1192058408 X:67797531-67797553 TTGGAGACTAAGAAGGGGGAGGG + Intergenic
1192781746 X:74300765-74300787 TTTCAGTTTCTTAAGGTGGATGG - Intergenic
1193187515 X:78530448-78530470 TTAGAGACTCAGAAGGGGGAGGG - Intergenic
1193460316 X:81783798-81783820 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193617174 X:83703485-83703507 TTGGAGACTCAGAAGTAGGAGGG - Intergenic
1193992356 X:88323612-88323634 TTGTAGTATCAGAAGAGGGAAGG - Intergenic
1194088515 X:89558244-89558266 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1194089909 X:89572931-89572953 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1194266593 X:91761069-91761091 TTGCTGGCTCTGAAGATGGAGGG - Intergenic
1194597336 X:95874658-95874680 TTAGAGTCTCAGAAGGGAGAGGG + Intergenic
1195309684 X:103619495-103619517 TTTCAGTGTCTTAAGGTGGAAGG - Intronic
1196134126 X:112188650-112188672 TTGGAGTCACTGAAAGTGGAAGG - Intergenic
1196557934 X:117112704-117112726 TTGGAGACTCAGAAGCAGGAGGG + Intergenic
1197201438 X:123752185-123752207 TTGCTGGCTGTGAAGGTGGAAGG + Intergenic
1197571314 X:128154156-128154178 TTGGAGACTCAGAAGTAGGAGGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197645952 X:129016681-129016703 TTGGAGACTCAGAAGGGGGTAGG - Intergenic
1197669240 X:129257658-129257680 TTTCAGTTTCAGAAAGTGTAAGG - Intergenic
1197987602 X:132283612-132283634 TTGGCGTCTCAGAAGGGGGAAGG - Intergenic
1198038327 X:132823431-132823453 TTAGAGACTCAGAAGGAGGAGGG - Intronic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198455353 X:136812208-136812230 TTGCATCCTCACATGGTGGAAGG + Intergenic
1199078096 X:143546956-143546978 TTAGAGACTCAGAAGGGGGAAGG + Intergenic
1199186672 X:144923307-144923329 TTTCTGCCTCAGAAGGTGCAAGG - Intergenic
1199865216 X:151841198-151841220 TTACAGTCTCAGAATGGGGAAGG + Intergenic
1200374286 X:155763293-155763315 TTGCATACTGAGAAGTTGGAAGG - Intergenic
1200441191 Y:3214291-3214313 TTAGAGACTCAGAAGGGGGAGGG + Intergenic
1200442560 Y:3228985-3229007 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1200491400 Y:3827990-3828012 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1200583798 Y:4981983-4982005 TTGCAGGCTCTGAAGATGGAGGG - Intergenic
1200886000 Y:8270569-8270591 TTGAGGTCTCAGAAGCTGGATGG + Intergenic
1200952458 Y:8912787-8912809 TTGAGGTCTCAGAAGCTGGATGG - Intergenic
1201016961 Y:9614382-9614404 TTGAATTCTCAGAAGCTGGATGG + Intergenic
1201052813 Y:9956419-9956441 TTGAGGTCTCAGAACCTGGATGG - Intergenic
1201058964 Y:10025794-10025816 TTGAGGTCTCAGAAGCTGGAAGG + Intergenic
1202112203 Y:21433978-21434000 TTGAGGTCTCAGAAGCTGGATGG + Intergenic
1202118296 Y:21496470-21496492 CTGAGGTCTCAGAAGCTGGACGG - Intergenic
1202120748 Y:21520010-21520032 CTGAGGTCTCAGAAGCTGGATGG - Intronic
1202123199 Y:21543551-21543573 CTGAGGTCTCAGAAGCTGGATGG - Intronic
1202155807 Y:21885830-21885852 CTGAGGTCTCAGAAGCTGGACGG + Intronic
1202158255 Y:21909371-21909393 CTGAGGTCTCAGAAGCTGGATGG + Intronic
1202160552 Y:21930804-21930826 TTGAGGTCTCAGAAGCTGGATGG + Intergenic
1202184708 Y:22174296-22174318 CTGAGGTCTCAGAAGCTGGATGG + Intronic
1202188472 Y:22215069-22215091 TTGAGGTCTCAGAACCTGGATGG - Intergenic
1202198139 Y:22317435-22317457 CTGAGGTCTCAGAAGCTGGATGG - Intronic
1202206652 Y:22412105-22412127 CTGAGGTCTCAGAAGCTGGATGG - Intronic
1202230804 Y:22655571-22655593 TTGAGGTCTCAGAAGCTGGATGG - Intergenic
1202312354 Y:23540594-23540616 TTGAGGTCTCAGAAGCTGGATGG + Intergenic
1202558449 Y:26130000-26130022 TTGAGGTCTCAGAAGCTGGATGG - Intergenic