ID: 1144952166

View in Genome Browser
Species Human (GRCh38)
Location 17:19000213-19000235
Sequence CACTAGGGCTGGAGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 663
Summary {0: 1, 1: 0, 2: 6, 3: 48, 4: 608}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144952152_1144952166 30 Left 1144952152 17:19000160-19000182 CCTGGGGCTAGGGGAGGGGCAGG 0: 1
1: 1
2: 11
3: 231
4: 1485
Right 1144952166 17:19000213-19000235 CACTAGGGCTGGAGGGAGGCTGG 0: 1
1: 0
2: 6
3: 48
4: 608
1144952156_1144952166 0 Left 1144952156 17:19000190-19000212 CCTTCCATCTTGGAGTAGGAGCC 0: 1
1: 0
2: 0
3: 17
4: 218
Right 1144952166 17:19000213-19000235 CACTAGGGCTGGAGGGAGGCTGG 0: 1
1: 0
2: 6
3: 48
4: 608
1144952157_1144952166 -4 Left 1144952157 17:19000194-19000216 CCATCTTGGAGTAGGAGCCCACT 0: 1
1: 0
2: 4
3: 9
4: 135
Right 1144952166 17:19000213-19000235 CACTAGGGCTGGAGGGAGGCTGG 0: 1
1: 0
2: 6
3: 48
4: 608

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144952166 Original CRISPR CACTAGGGCTGGAGGGAGGC TGG Intronic
900003525 1:29232-29254 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
900013844 1:136147-136169 CACTCGGGCTGCTGGGAGGTAGG - Intergenic
900014162 1:137356-137378 CACGCGGGCTGCTGGGAGGCAGG + Intergenic
900023245 1:199748-199770 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
900043914 1:492130-492152 CACTCGGGCTGCTGGGAGGTAGG - Intergenic
900044025 1:492558-492580 CACGCGGGCTGCTGGGAGGCAGG + Intergenic
900065351 1:727133-727155 CACTCGGGCTGCTGGGAGGTAGG - Intergenic
900065435 1:727464-727486 CACGCGGGCTGCTGGGAGGCAGG + Intergenic
900211806 1:1459846-1459868 GACTGGGGCTGGAGGGACCCAGG - Intronic
900552727 1:3264680-3264702 CCCCAGGCCAGGAGGGAGGCAGG + Intronic
900860627 1:5226671-5226693 CTCTAGGGCTGAGGGGAGGTAGG + Intergenic
900893654 1:5467723-5467745 AACCAGGGCTGGAAGGTGGCTGG - Intergenic
900954961 1:5881105-5881127 CCCTAGGGCTGAGGGTAGGCAGG - Intronic
901206926 1:7502858-7502880 TACAAGGGCTGAAGCGAGGCAGG + Intronic
901690129 1:10967400-10967422 CACAAGGACTGAAAGGAGGCAGG - Intronic
901794196 1:11671174-11671196 CAGGAGGGCGGGAGGGAGGGTGG - Intronic
901801312 1:11709614-11709636 CACCAGGGCTGGAGCTAGACTGG - Intronic
901877211 1:12173735-12173757 CCCTAGGCCTGGAAGGGGGCAGG - Intronic
902132902 1:14279278-14279300 AATTAGGGGTGGAGAGAGGCTGG + Intergenic
902175660 1:14648560-14648582 AACTAGAGCTGCAGAGAGGCTGG + Intronic
902210523 1:14901367-14901389 GAGTAGGGGTGGTGGGAGGCAGG + Intronic
902990541 1:20184644-20184666 CATTAGAACTGGAGGGAGGGAGG + Intergenic
903050918 1:20600336-20600358 CACTAGGCTGGGAGTGAGGCTGG + Intronic
903287511 1:22286046-22286068 GACTTGGGCTAGAGGGAGGCAGG - Intergenic
903593811 1:24478872-24478894 CCCTAGGGCTGGGGGAAGACAGG + Intergenic
903976610 1:27154484-27154506 TTCTGGGGGTGGAGGGAGGCTGG + Exonic
904043677 1:27598314-27598336 GAAGGGGGCTGGAGGGAGGCAGG + Intronic
904396519 1:30225934-30225956 TCCCAGGGCTGGAGGAAGGCCGG - Intergenic
904783919 1:32971378-32971400 CACAAAGGATGGAGGGAGGTGGG - Intergenic
905335310 1:37240822-37240844 CACTAGGGCAGGAGGCTGGCAGG - Intergenic
905753666 1:40488584-40488606 CAGCATGGCTGGAGGTAGGCTGG - Intronic
906962997 1:50430729-50430751 CACTACGGAGGGAGGGAGTCTGG - Intergenic
907044321 1:51290526-51290548 CACTAAGGCTGAAGAGATGCTGG - Exonic
907215034 1:52855568-52855590 GCTTAGGGCTGGAGGGATGCGGG - Intronic
907455922 1:54575406-54575428 CCTTGGGGGTGGAGGGAGGCAGG + Intronic
907941799 1:59095554-59095576 CACTTGGGCTGGAGGTTGGTGGG - Intergenic
908083750 1:60608609-60608631 CAGTATGGCTAGAGGTAGGCTGG - Intergenic
908990659 1:70084319-70084341 GTCTAGGGCTGGAGGGAGTATGG - Intronic
911078950 1:93909314-93909336 CGCTCGGGCCCGAGGGAGGCCGG + Exonic
912121261 1:106474348-106474370 CACTGGGACAGGAGGGAGGCTGG + Intergenic
913089594 1:115467568-115467590 CATTAAGGCTGGAGGAAGGAAGG + Intergenic
914343808 1:146781353-146781375 GACTAAGGATGGATGGAGGCGGG - Intergenic
914684839 1:149969280-149969302 CTCCAAGGCTGGAGTGAGGCTGG - Intronic
915469916 1:156119729-156119751 CACCAGGGTGGGAGGGAGGGGGG - Intronic
916058232 1:161082477-161082499 AAATAGGGATGGAAGGAGGCAGG + Intronic
916506627 1:165433949-165433971 CACTATGGCTTCAGGGATGCAGG + Intronic
918048784 1:180956571-180956593 CACCAGAGCTGGATGGAGGCTGG - Intergenic
918342943 1:183582206-183582228 AAGAAGGGCTAGAGGGAGGCGGG - Intronic
918487675 1:185046016-185046038 GAGTAGGGCTGCAGAGAGGCTGG - Intronic
919921658 1:202169766-202169788 CACAGGGGCTGGAGGAAGGATGG - Intergenic
920198428 1:204244749-204244771 CACTAGGGCTGGAGGCCTGTGGG + Intronic
920216358 1:204363709-204363731 CACTATGGCTGGGAGGTGGCAGG + Intronic
920455381 1:206097238-206097260 AAGGAGGGCTGCAGGGAGGCAGG - Intronic
921778512 1:219131837-219131859 CAATAGGGCTGGAGACAGTCAGG + Intergenic
922177248 1:223206229-223206251 CACTAGGAGTGGAGGGAGCTTGG + Intergenic
922672191 1:227518968-227518990 CAGTGGGGCTAGAGGGAGCCTGG + Intergenic
922727088 1:227927599-227927621 GGCTAGGGCGGGAGGCAGGCGGG + Intronic
922734428 1:227971726-227971748 CACGCGGGCTGCCGGGAGGCAGG - Intergenic
922734493 1:227971961-227971983 CACGCGGGCTGCTGGGAGGCAGG + Intergenic
922734716 1:227972858-227972880 CACGTGGGCTGCTGGGAGGCAGG - Intergenic
922734774 1:227973092-227973114 CACGCGGGCTGCTGGGAGGCAGG + Intergenic
924043979 1:240009731-240009753 CACAGGGCCTGTAGGGAGGCAGG - Intergenic
924343489 1:243054931-243054953 CACGCGGGCTGCTGGGAGGCAGG + Intergenic
924597877 1:245463180-245463202 CACCACGGCTGAAGGGCGGCCGG - Intronic
924728251 1:246689818-246689840 CACCAGGGCTGGCGGGCGCCGGG - Intergenic
1062822980 10:548504-548526 CAGGAGGGAGGGAGGGAGGCAGG + Intronic
1062966304 10:1610202-1610224 CCCTGGGGCTGCAGGGAGGCAGG - Intronic
1063200382 10:3781564-3781586 CACCAGCCCTGGAGGGAGCCGGG - Intronic
1066119172 10:32267267-32267289 CGCCAGGGCTGGAGGGAGCTGGG - Intergenic
1066733031 10:38450771-38450793 CACGCGGGCTGCTGGGAGGCAGG + Intergenic
1067218328 10:44322317-44322339 CACCAGGGTTTGAAGGAGGCAGG - Intergenic
1067437700 10:46289790-46289812 CACTAGGGCTTGGGGAAGGGAGG - Intronic
1067806233 10:49395320-49395342 CAGCAGGGCTGGTGGGTGGCTGG - Intronic
1068951180 10:62779149-62779171 CACAAGGGCTCGAGGGAAGTTGG + Intergenic
1069949606 10:72009888-72009910 CCTGAGGGCTTGAGGGAGGCTGG + Exonic
1070100440 10:73380972-73380994 CTCTAGGGCAGGAGGGAGGGAGG + Intronic
1070396672 10:76017250-76017272 CACGAAGGCTGGAGTTAGGCTGG + Intronic
1071287150 10:84159403-84159425 AACTCGGGCAGGAGGGAGGGAGG - Intergenic
1071443654 10:85726540-85726562 CACAAGGGATGAAGGGAGGAGGG + Intronic
1071573954 10:86712361-86712383 TAGTATTGCTGGAGGGAGGCAGG + Intronic
1071603498 10:86970266-86970288 TGGTGGGGCTGGAGGGAGGCGGG + Intronic
1072462999 10:95637495-95637517 CACAAGGGATGGAGGTAGGGTGG + Intronic
1072554416 10:96503910-96503932 CACTGGGGGTGGAGGCAGCCAGG + Intronic
1072806987 10:98429930-98429952 CAGAAGGGGTGGAGGGAGCCAGG - Intronic
1073412071 10:103350731-103350753 CGTTGAGGCTGGAGGGAGGCCGG - Exonic
1073474614 10:103744674-103744696 TACTTGGGCTGGGGGAAGGCAGG + Intronic
1073625018 10:105088093-105088115 CACTAGGGAAGGAGAGGGGCAGG + Intronic
1074233635 10:111562522-111562544 CACTAGTGATGGAGGAAGGAAGG + Intergenic
1075120355 10:119660044-119660066 GGCTGGGGCTGCAGGGAGGCTGG + Intronic
1075158841 10:120004907-120004929 CACTGGAGCTGGTGGGGGGCAGG + Intergenic
1075212009 10:120499538-120499560 CACTAGGTCTGGGGTGGGGCTGG + Intronic
1075407942 10:122207000-122207022 CAGTAGGGGAGCAGGGAGGCTGG + Intronic
1075747504 10:124737891-124737913 CACTAGGACTGTGGGGAGGCAGG + Intronic
1075936109 10:126342896-126342918 GATGAGGGCTGGAGGGAGGGTGG + Intronic
1076036408 10:127202025-127202047 AACTAGGGCAGGAAGGAGCCAGG + Intronic
1076338668 10:129727996-129728018 TTCTTGGCCTGGAGGGAGGCTGG - Intronic
1076454348 10:130579052-130579074 CCCTATGGCTGGAGGGAAGCAGG - Intergenic
1076815997 10:132914889-132914911 CACTTGGGCAGAAGGGAGGGCGG - Intronic
1076836325 10:133022898-133022920 CAGTGGGGCGGGAGGGAGGCAGG - Intergenic
1076847328 10:133075682-133075704 CAGCAGGGCTGGCAGGAGGCTGG + Intronic
1076970188 11:128361-128383 CACTCGGGCTGCTGGGAGGTAGG - Intergenic
1076970362 11:129033-129055 CACGCGGGCTGCTGGGAGGCAGG + Intergenic
1077440323 11:2565873-2565895 CACTGGGTCTGGAGGAAGGAGGG + Intronic
1077457966 11:2692291-2692313 CAATAGGGATGGAGGGAAGCAGG - Intronic
1077591993 11:3499464-3499486 CCCTGGGGCTGGAGGGAGCAGGG + Intergenic
1078076371 11:8165514-8165536 GCCTAGGGCTGGAGGTGGGCTGG + Intronic
1080030025 11:27650518-27650540 CACCAGCTATGGAGGGAGGCAGG + Intergenic
1080606018 11:33865317-33865339 GGTTAGGGCTGGAGGGAGGATGG - Intronic
1081492827 11:43580686-43580708 CACTTGGGCTGGAATGAGGAGGG + Intronic
1081710851 11:45214401-45214423 CACTATGGCTGGGGGCAGGATGG - Intronic
1081869124 11:46375379-46375401 CACCAGGGCTGGGGGCAGGGGGG - Intronic
1082881681 11:58044299-58044321 CACCAGGTAAGGAGGGAGGCTGG - Intronic
1082911016 11:58374607-58374629 CACTGGGGCCTGATGGAGGCAGG + Intergenic
1082925156 11:58537496-58537518 CACTGGGGCCTGATGGAGGCAGG + Intronic
1084409385 11:68997546-68997568 CTCAAGGGCAGGATGGAGGCCGG + Intergenic
1084569282 11:69949743-69949765 CAGAAGGGCTGGAAGGAGGCAGG + Intergenic
1084824988 11:71723297-71723319 CCCTGGGGCTGGAGGGAGCAGGG - Intergenic
1085004619 11:73074929-73074951 CAGTGGGGAGGGAGGGAGGCAGG + Intronic
1085322701 11:75584392-75584414 CCCTGGGGCTGGGGGGAGGATGG - Intergenic
1085658982 11:78345031-78345053 CAGGAGGGAGGGAGGGAGGCGGG + Intronic
1087957517 11:104306958-104306980 GACTAGGGACGGAGGGAGGGAGG - Intergenic
1088551690 11:111019780-111019802 CACTTGAACTGGAGAGAGGCTGG - Intergenic
1088557540 11:111078138-111078160 TCCCAGTGCTGGAGGGAGGCAGG + Intergenic
1088907832 11:114168255-114168277 TCCTGGGGCTGGAGGGAAGCAGG - Intronic
1089800706 11:121024462-121024484 CCCTGGGGCTAGAGGGAGGATGG + Intronic
1090357069 11:126147232-126147254 CAGTAGGGAGGGAGGGAGGGAGG - Intergenic
1091022823 11:132116231-132116253 CCATAGGGCTGGAGGGACACAGG + Intronic
1091376944 12:31286-31308 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
1091388334 12:109398-109420 CAGTAAGGCTGCAGAGAGGCCGG - Intronic
1091545264 12:1497484-1497506 CTCTGGGGCTGGGGGGAAGCTGG + Intergenic
1091588114 12:1827575-1827597 CACCATGGCCCGAGGGAGGCAGG - Exonic
1091618420 12:2067259-2067281 CACCTGGGATGGAGGCAGGCTGG - Intronic
1091661281 12:2385602-2385624 AACTAAGAATGGAGGGAGGCAGG - Intronic
1091688232 12:2578788-2578810 CCCCAGGGGTTGAGGGAGGCAGG + Intronic
1091798102 12:3308767-3308789 CACTTGGGCTGGAGGGGGCAGGG + Intergenic
1092249345 12:6883976-6883998 CCCCTGGGCTGGAGGGAGGCAGG + Intronic
1092270267 12:7018240-7018262 CGCGAGGGGCGGAGGGAGGCAGG + Intronic
1092529379 12:9331883-9331905 CAGTGTGGCTGCAGGGAGGCTGG + Intergenic
1092917495 12:13201981-13202003 AACTAGGACAGGAGGGAGGGAGG + Intronic
1095729731 12:45493412-45493434 CACGAGGGCTGGAGGCGGACAGG + Intergenic
1096398002 12:51281308-51281330 CGGGAGGGATGGAGGGAGGCAGG - Exonic
1096498093 12:52050289-52050311 CACAGGTGCTGGAGGTAGGCTGG + Intronic
1097349844 12:58536693-58536715 AACCATGGCTGGAGGTAGGCAGG - Intergenic
1097563746 12:61240512-61240534 CACCAGGGATGGAGGTGGGCAGG + Intergenic
1097906988 12:64930867-64930889 CACTGGGACAGGAGTGAGGCTGG - Intergenic
1100274308 12:93058023-93058045 GTCAAGGGCAGGAGGGAGGCTGG + Intergenic
1100502011 12:95183348-95183370 AACTAGGGGTTGCGGGAGGCAGG - Intronic
1101376041 12:104172301-104172323 CCCAAGGGCTGGAGGCTGGCCGG + Intergenic
1102008375 12:109603093-109603115 CCCTAGGTCTGGAGGGAGGCAGG - Intergenic
1102074381 12:110048332-110048354 CCCTCGGGCTGGCGGGCGGCGGG - Intronic
1102152207 12:110696599-110696621 TCTTAGGGCTGGAGGGAGACAGG - Intronic
1102561115 12:113762878-113762900 TCCTGGGGCTGGAGGAAGGCTGG - Intergenic
1102685528 12:114721529-114721551 AAAAAGGGCTGGAGGGTGGCTGG - Intergenic
1102696594 12:114804487-114804509 GCCTAGGGCTGGAGGGAAGAGGG - Intergenic
1103892285 12:124249086-124249108 CACAAGGGCTGGAATGTGGCAGG - Intronic
1103904032 12:124318353-124318375 CACTTCCTCTGGAGGGAGGCCGG - Intergenic
1103945765 12:124525540-124525562 CAATCTGGCTGCAGGGAGGCAGG + Intronic
1104035827 12:125096548-125096570 GGCTGGGGCTGGAGGGAGCCAGG + Intronic
1104806119 12:131590543-131590565 CTGTAGGTCTGGAGGGGGGCTGG + Intergenic
1104984091 12:132586987-132587009 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984097 12:132587010-132587032 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984115 12:132587074-132587096 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984154 12:132587231-132587253 CAGTGCGGCTGGAGGGAGGGCGG + Intergenic
1104984198 12:132587433-132587455 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1104984204 12:132587456-132587478 CAGTGCGGCTGGAGGGAGGACGG + Intergenic
1105257697 13:18755226-18755248 AACTAGAGCTGCAGGGATGCAGG + Intergenic
1105260349 13:18774534-18774556 AACTAGAGCTGCAGGGATGCAGG + Intergenic
1105756645 13:23471012-23471034 CAACAGGGTTGGAGGGAGGGAGG + Intergenic
1106131526 13:26943570-26943592 TACTAGGGTAGGAAGGAGGCAGG + Intergenic
1106335315 13:28778165-28778187 CAGTAGGGCAGGCGGCAGGCTGG + Intergenic
1106485503 13:30168758-30168780 CACTGGGGTTTGAGGAAGGCTGG - Intergenic
1107037566 13:35917344-35917366 CAATAACGCTGGATGGAGGCAGG + Intronic
1107095905 13:36534935-36534957 TACCAGGGCTGGAGAGAGGGTGG - Intergenic
1107122614 13:36812001-36812023 TGCTAGGGGTGGAGGCAGGCTGG - Intergenic
1108035041 13:46281874-46281896 GAGGAGGGCAGGAGGGAGGCTGG - Intergenic
1108259725 13:48644490-48644512 CACTAGTGGTAGAGAGAGGCAGG - Intergenic
1108286015 13:48908623-48908645 CACTATTGCTGAAGGGAAGCTGG - Intergenic
1108353736 13:49611199-49611221 CACTAGAGCTGGAGGGTGTTGGG - Intergenic
1108615509 13:52128707-52128729 CACTTGGGCGGGAGGGTCGCGGG - Intronic
1112334723 13:98504835-98504857 CACAAGGTGTGGATGGAGGCAGG + Intronic
1112409495 13:99150435-99150457 GGCTTGGGCTGGAGTGAGGCTGG + Intergenic
1113351122 13:109530182-109530204 CTCTGGGGCTGGCTGGAGGCGGG + Intergenic
1114532705 14:23405494-23405516 GACTAGGGGTGGAGGGGGGAAGG + Intronic
1115519960 14:34223536-34223558 CTCTAGTTTTGGAGGGAGGCAGG - Intronic
1115769626 14:36656206-36656228 CACGGGGGCTGGTGGGTGGCGGG + Intergenic
1116303780 14:43221692-43221714 CAGTAGGGATGGTGGGAGGAGGG - Intergenic
1118165262 14:63329862-63329884 CACTAAGGCTGGAGGTGGGGAGG - Intergenic
1119030896 14:71191919-71191941 GCCTAGGGTTGGAGGGAGGCAGG - Intergenic
1119952332 14:78758023-78758045 CTCTAAGGCTGCAGGGAGGGAGG - Intronic
1121279159 14:92687269-92687291 CCCTAGGGGTGGAGGACGGCGGG + Intronic
1121767779 14:96502499-96502521 CACTGAGGCGGGAGGGAGGGGGG - Exonic
1121797225 14:96745206-96745228 CTGTAGGGAAGGAGGGAGGCAGG - Intergenic
1122277696 14:100603703-100603725 CAGCAGGGCTGGACGAAGGCTGG - Intergenic
1122466684 14:101938538-101938560 CACTGGGGCGGGAAGGAGGTTGG - Intergenic
1122487407 14:102090268-102090290 CACCTGGCCTGGTGGGAGGCAGG - Intronic
1122853073 14:104547148-104547170 CCCTTGGGCTGGAGGGAGGCTGG + Intronic
1123067952 14:105627717-105627739 CAGCAGGGCCGGTGGGAGGCAGG - Intergenic
1123072128 14:105647048-105647070 AACAAGGGCAGGTGGGAGGCAGG - Intergenic
1123091633 14:105744718-105744740 CAGCAGGGCCGGTGGGAGGCAGG - Intergenic
1123194209 14:106600977-106600999 CACTAGTGCTGGAGGAGGGTGGG - Intergenic
1124008142 15:25810980-25811002 AGCTGGGGCTGGAAGGAGGCGGG + Intronic
1124400462 15:29343489-29343511 CTGTAGGGCAGCAGGGAGGCTGG - Intronic
1125932165 15:43608079-43608101 CACTAGAGTTCGAGGGAGCCTGG - Exonic
1125945263 15:43707553-43707575 CACTAGAGTTCGAGGGAGCCTGG - Intergenic
1126775155 15:52094155-52094177 AAATAGGTCAGGAGGGAGGCTGG + Intergenic
1126845384 15:52755248-52755270 CTCCAGGGATGGAGGGAGCCGGG - Intergenic
1127347450 15:58114687-58114709 CACTAGGGTGGTCGGGAGGCAGG - Intronic
1128092785 15:64930450-64930472 CACAAAGACTTGAGGGAGGCAGG + Intronic
1128327090 15:66730873-66730895 CACAAGCTCTGGAGGCAGGCAGG - Intronic
1128452883 15:67817072-67817094 GCCTAGGGCTGGAGGGAAGTAGG + Intergenic
1128609560 15:69063054-69063076 AGCTAGAGCTGGGGGGAGGCGGG - Intergenic
1129312042 15:74719776-74719798 GACTAGGGCTGGAGTGAGGGGGG - Exonic
1129313966 15:74729931-74729953 CACTAGAACTAGAGGCAGGCAGG - Intergenic
1129324116 15:74790525-74790547 CACAAGGGCTGCTGGGAGCCGGG + Intronic
1129521737 15:76190542-76190564 CAGTGGAGGTGGAGGGAGGCGGG + Intronic
1129606603 15:77028169-77028191 CTCCAGGGGTGGAGGGAGGAGGG + Intronic
1130561482 15:84962779-84962801 GACTAGGGCTGGGGGTAGGGAGG + Intergenic
1130563848 15:84979013-84979035 CACAGGGGTAGGAGGGAGGCTGG + Intergenic
1131102667 15:89705375-89705397 CAAGAGGGGTGGAGGAAGGCAGG + Intronic
1131234045 15:90681209-90681231 CTCTGGGGCAGCAGGGAGGCTGG + Intergenic
1131285010 15:91049584-91049606 GACTGGGGCTGGAGAGAAGCGGG + Intergenic
1132255355 15:100372310-100372332 GACTAGGGAGGGAGGGAGGCAGG + Intergenic
1132372805 15:101309814-101309836 CACTAGGTCTTGAGGGTGTCCGG + Intronic
1132392611 15:101450138-101450160 CACTAGGGCTGGTGCGATGAGGG - Intronic
1132449976 15:101961708-101961730 CGGAGGGGCTGGAGGGAGGCGGG + Intergenic
1132723792 16:1330158-1330180 CCCTCAGGCTGGTGGGAGGCGGG + Intergenic
1133088895 16:3388252-3388274 GACTTGGGCTGGAGCGAGGTGGG - Intronic
1133240100 16:4409080-4409102 GACTAGGCATGGAGGGTGGCGGG + Intronic
1134482828 16:14633324-14633346 CCCTAGGGCGGGAAGGAGGAGGG + Intronic
1134557541 16:15178628-15178650 CCCTAGGGCTAGAGAGAGGTGGG - Intergenic
1134584197 16:15396518-15396540 GACCAAGGCTGGAGGTAGGCAGG + Intronic
1134918109 16:18090311-18090333 CCCTAGGGCTAGAGAGAGGTGGG - Intergenic
1136135718 16:28255821-28255843 CCATGGGGCTGGGGGGAGGCGGG + Intergenic
1136413626 16:30091095-30091117 CGCTAGGGCGGGTGGGAAGCTGG + Exonic
1136551323 16:30984080-30984102 CACTAAGGCTGGGGGGGTGCTGG - Exonic
1137492335 16:48943651-48943673 CTCTGGGGCTGGAAGGAGGGTGG + Intergenic
1137505510 16:49050866-49050888 CAGTAGGTCTGGAGGGATGTGGG - Intergenic
1137515637 16:49141083-49141105 CACTGGGGTGGGAGGGAGGACGG - Intergenic
1137673214 16:50291341-50291363 CTCTGGGGGTGGAGGGAGGGCGG + Intronic
1138451238 16:57094295-57094317 CAGTAGGGCGGCTGGGAGGCTGG + Intronic
1138551896 16:57752974-57752996 GGCCTGGGCTGGAGGGAGGCGGG - Intronic
1139313934 16:66051366-66051388 CATTTGGGCTGGAGGGAGGGAGG + Intergenic
1139599162 16:67976285-67976307 GACTAGGGCTGGTGGGCAGCGGG - Intronic
1139773058 16:69294841-69294863 CACTCGGGCTGGAGGGCTGGAGG + Intronic
1139990185 16:70933982-70934004 GACTAAGGATGGATGGAGGCGGG + Intronic
1141137904 16:81478601-81478623 AACAAGGGCTGGAGGGTGGAGGG - Intronic
1141421984 16:83923591-83923613 CTCTAGGGAAGGAGGCAGGCTGG - Exonic
1141464539 16:84197080-84197102 AACTGGGGCTGGAGGGAAGGAGG + Exonic
1141642383 16:85348866-85348888 CTCGGGGGCTGGAGGGAGGGAGG - Intergenic
1141888147 16:86907341-86907363 ATTTAGGGCTGGAGGGAGGGTGG - Intergenic
1142206481 16:88785347-88785369 CACCAGGGCGGGCCGGAGGCGGG - Intergenic
1142450489 16:90170771-90170793 CACTCGGGCTGCTGGGAGGTAGG + Intergenic
1142457073 17:62920-62942 CACTCGGGCTGCTGGGAGGTAGG - Intergenic
1142457197 17:63397-63419 CACGCGGGCTGCTGGGAGGCAGG + Intergenic
1142709390 17:1715291-1715313 AACCAGGGCCGGAGGGAGGTGGG + Intergenic
1143447943 17:7019830-7019852 GAGCAGGGCTGGCGGGAGGCAGG - Intergenic
1144461341 17:15460894-15460916 CACTGTGGCTGGAGGGTGGTTGG - Intronic
1144758775 17:17695300-17695322 CTCCTGGGCTGGAGGGAGGCCGG - Intronic
1144807689 17:17978594-17978616 CAGCAGGGCTGGACTGAGGCAGG - Intronic
1144952166 17:19000213-19000235 CACTAGGGCTGGAGGGAGGCTGG + Intronic
1145251155 17:21297742-21297764 CCCTAGGGGTGGAGTGAGGAAGG + Intronic
1145788854 17:27611656-27611678 CAGTAGGGCTGGAGGTGGGGTGG + Intronic
1146631028 17:34469385-34469407 CATTAGGGTTGGAGGGAAGCTGG - Intergenic
1146888237 17:36486766-36486788 CACTAGGGCACGCGGCAGGCTGG - Exonic
1146916079 17:36679350-36679372 CACTGAGGCAGGAGGGAGCCGGG - Intergenic
1146939755 17:36836337-36836359 CACTGGGGCTGGAGGGTGAGAGG + Intergenic
1146955075 17:36932682-36932704 CACGAGCGCTGGAGGGACCCTGG - Intergenic
1147038257 17:37698020-37698042 CTCTAGGGCTGGAAGGAGATCGG + Intronic
1147135108 17:38429650-38429672 CACTTTGGCTGAAGGGAGTCGGG - Intronic
1147142262 17:38466427-38466449 CACCAGGGCTGGGGCGGGGCTGG - Exonic
1147461683 17:40576189-40576211 CCCTAGAGCTGGAGGGACACAGG - Intergenic
1147636541 17:41967551-41967573 CAGAAGGGCTGGTGGGGGGCAGG - Intronic
1147718197 17:42522027-42522049 CACTAGGGGCGGAGCCAGGCAGG - Exonic
1148664987 17:49367792-49367814 AAGTAGGGCTGGTGGGAGGTGGG - Intergenic
1149623115 17:58060803-58060825 CACTGCGGATGGAGGGGGGCGGG + Intergenic
1150223001 17:63507795-63507817 GCCTGGGGCAGGAGGGAGGCAGG + Intronic
1151656430 17:75498393-75498415 CTCTAGGGCCGCAGGGAGGTAGG - Intronic
1152014551 17:77741861-77741883 CATCAGGGATGGAGGGAGACTGG - Intergenic
1152104755 17:78322567-78322589 GACCAGGGATGGAGGCAGGCTGG - Intergenic
1152535658 17:80949119-80949141 CCCTGGAGCTGGAGGGAGGAAGG + Intronic
1152740909 17:82017963-82017985 CACCAGGGCAGGAGAGAGGCTGG + Intergenic
1152755813 17:82086557-82086579 CCCTGGGGAGGGAGGGAGGCAGG + Exonic
1152790132 17:82274199-82274221 CGCAGGGACTGGAGGGAGGCAGG - Intergenic
1152931606 17:83113031-83113053 CGCCAGGCCTGGTGGGAGGCGGG - Intergenic
1153468275 18:5414656-5414678 CAGGAGGGCTGCAGGGAGCCTGG + Intronic
1153631299 18:7072865-7072887 CTGGAGGGCTGGAGGGAGGCAGG + Intronic
1154162368 18:11989929-11989951 CTTTAGGGGTGGAGGAAGGCAGG + Intronic
1154174568 18:12076824-12076846 CTCTGGGCCTGGAGGGAGCCAGG + Intergenic
1154219692 18:12441158-12441180 CACTTGAACTGGAGGGAGGGGGG + Intergenic
1154346242 18:13545840-13545862 CAATGGGGCAGGATGGAGGCTGG + Intronic
1154433360 18:14325502-14325524 AACTAGAGCTGCAGGGATGCAGG - Intergenic
1157411462 18:47466490-47466512 CACCTGGGTTGTAGGGAGGCAGG - Intergenic
1157495995 18:48157960-48157982 GAATAGGGCTTGAGGGAGGTGGG + Intronic
1157706726 18:49813672-49813694 CCCTCGGGCTGGGGTGAGGCGGG - Exonic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1160393947 18:78558574-78558596 CACTTGGGGAGGAGGGAGGGCGG - Intergenic
1160488961 18:79320696-79320718 AACGAGGGCTGGAGGGGGGTGGG - Intronic
1160635278 19:70840-70862 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
1160646986 19:198279-198301 CACTCGGGCTGCTGGGAGGTAGG - Intergenic
1160647556 19:200502-200524 CACGCGGGCTGCTGGGAGGCAGG + Intergenic
1160669175 19:348675-348697 AAGCAGGGCTGGAGGGAGGGAGG - Intergenic
1160725710 19:616971-616993 TGCCAGTGCTGGAGGGAGGCGGG - Exonic
1160934122 19:1585207-1585229 CGCTCGGGCTGCGGGGAGGCGGG + Exonic
1161008921 19:1950745-1950767 GACACTGGCTGGAGGGAGGCAGG - Intronic
1161210611 19:3063299-3063321 CAGGAAGGCCGGAGGGAGGCAGG + Intergenic
1161233769 19:3188180-3188202 CCGGGGGGCTGGAGGGAGGCCGG - Intronic
1161569656 19:5023567-5023589 CACAGGGGCTGGAGGCCGGCTGG + Intronic
1161716822 19:5880842-5880864 CCCTGGGCCAGGAGGGAGGCTGG + Intronic
1161738442 19:6005841-6005863 CAGTGGGGCTTAAGGGAGGCTGG + Intronic
1161925183 19:7294299-7294321 CACCTGGGCTGGCGGGTGGCGGG + Intergenic
1162736167 19:12748210-12748232 CACTTGGGCAGGAGGCAGGGAGG + Exonic
1163333564 19:16657236-16657258 CACCTGGGCTGGAAGGAGACTGG + Intronic
1163607348 19:18282233-18282255 CACGCGGGGTGGAGGGAGGGAGG - Intergenic
1164109167 19:22138247-22138269 CGTTGAGGCTGGAGGGAGGCCGG + Intergenic
1164248029 19:23451303-23451325 CACTAGGGCTAGTCGGAGGATGG - Intergenic
1164743525 19:30594482-30594504 AGCTAGTGCTGGAGGGAGGTAGG - Intronic
1165076228 19:33281359-33281381 GGCTCTGGCTGGAGGGAGGCTGG + Intergenic
1165136962 19:33675612-33675634 CAGTGGGGCAGGAAGGAGGCTGG - Intronic
1165388797 19:35526915-35526937 CACGAGGCCGGGAAGGAGGCAGG - Exonic
1166142448 19:40812239-40812261 CACTAGGGCTGGGGGCGGGGTGG - Intronic
1166185079 19:41134563-41134585 CACCAGGGCTGGGGGTGGGCTGG + Intergenic
1166293439 19:41877688-41877710 CACCAGGGCTGGGGGCAGGAAGG + Intronic
1166397921 19:42456034-42456056 CACTAGGCATGGAAAGAGGCAGG + Intergenic
1166792232 19:45405104-45405126 GACTTGGGCTGGAGGGAGGCGGG + Intronic
1167424468 19:49423047-49423069 GACTAGGGGTGGGGGAAGGCGGG - Intronic
1167854835 19:52229086-52229108 CATCAGGGCTGGAGGGAAGGAGG + Exonic
1168053891 19:53850177-53850199 CCCAGGGGCTGGAGGGAGTCCGG + Intergenic
925886995 2:8401779-8401801 CACCAGGCCTGCAGGGAGGAAGG + Intergenic
927194685 2:20539375-20539397 CACTAGGGCAGGAGGGGAGGTGG + Intergenic
927278213 2:21279648-21279670 TGCTGGGGCTGGAGGGAGGGCGG + Intergenic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
927963279 2:27254223-27254245 CAGGCTGGCTGGAGGGAGGCTGG - Intronic
927994292 2:27472165-27472187 CACCAGGGACTGAGGGAGGCAGG - Intronic
928368817 2:30723801-30723823 CAAGAGAGGTGGAGGGAGGCAGG - Intronic
929246432 2:39708247-39708269 CAGTGGGGCTGGAGGGAGTGAGG + Intronic
929769232 2:44878229-44878251 CCCTGGGGCTAGAAGGAGGCAGG - Intergenic
931827324 2:66015170-66015192 CACTAGAGATGGGGGGAGACTGG + Intergenic
932768847 2:74489352-74489374 CCCCAAGGCTGGAGGGAGCCTGG + Intronic
932795504 2:74692018-74692040 CACTGGGCCAGGAGGGAAGCTGG + Intergenic
933752419 2:85611631-85611653 CGCGCGGGCTGGAGGCAGGCGGG + Intronic
933779845 2:85794053-85794075 TATCAGGGCTGGGGGGAGGCAGG - Intergenic
934664145 2:96158295-96158317 CCCTATGCCTGGAGAGAGGCTGG - Intergenic
934714707 2:96536900-96536922 CACGAGGGCTGGAGGGGACCCGG - Intronic
934761571 2:96859654-96859676 CTCTCTGGGTGGAGGGAGGCTGG - Intergenic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
935268802 2:101416167-101416189 CACTGGGGGTGGAGGGAGTGTGG + Intronic
936093142 2:109513705-109513727 CACAAGGGAAGGAGGGAGGTGGG + Intergenic
936566202 2:113584203-113584225 CGGAGGGGCTGGAGGGAGGCGGG + Intergenic
937028539 2:118719092-118719114 TACCAGGGCTGGAGAGAGGCAGG + Intergenic
937239751 2:120452373-120452395 CACCAGGGCTGGGGGTCGGCTGG + Intergenic
937241946 2:120467569-120467591 CCCTTGGGCTGCAGGGAGCCAGG + Intergenic
937369345 2:121286673-121286695 ACCTATGGCTGGAGGGAGGAGGG - Intergenic
938029935 2:127983464-127983486 CACTCAGCCTGGAGGTAGGCAGG - Intronic
939476511 2:142694357-142694379 CACTAGGACAGGAGCGAGGCTGG + Intergenic
939480593 2:142742832-142742854 CATTGGGGGTGGAGGGAGGGGGG - Intergenic
940864830 2:158807542-158807564 GTCTAGGGTTGGAGGAAGGCTGG + Intronic
942278645 2:174340697-174340719 GCCTAGGGCTTGGGGGAGGCCGG - Intergenic
942428236 2:175881754-175881776 TACTTGGGGTGGAGGGTGGCAGG + Intergenic
944309589 2:198218541-198218563 CTCTAGGGCTAAAGGGAGGAGGG + Intronic
944941607 2:204634115-204634137 AGCTAGGGCAGGAGGGAGGTGGG - Intronic
944982120 2:205133417-205133439 CAGTAGGTGTGGAGGGAGCCTGG - Intronic
945251597 2:207769592-207769614 CACCTGGGCGGGAGGAAGGCGGG + Intergenic
946194788 2:218026654-218026676 GAAAAGGGCTGGAGGGAGGTAGG - Intergenic
947955139 2:234183334-234183356 ATATAGGACTGGAGGGAGGCTGG - Intergenic
948536535 2:238651346-238651368 CATTAGGGATGGATGGGGGCAGG - Intergenic
948650663 2:239441388-239441410 CAGCAGGGAGGGAGGGAGGCCGG + Intergenic
948853878 2:240721197-240721219 CACAGGGGCTGGAGGGGGCCGGG - Intronic
948931217 2:241133571-241133593 CACGGGGACTGGAGGGAGCCAGG - Intronic
949046322 2:241874131-241874153 CACTGAGGCTGGAGGGAAGAGGG - Intergenic
1168854145 20:997187-997209 CACTGAGGAAGGAGGGAGGCGGG - Intronic
1168972686 20:1941571-1941593 CTCCAGGGCTGGAGGCTGGCAGG + Intergenic
1170007004 20:11680541-11680563 CACTAGGGCTGGGATGAGGGTGG - Intergenic
1170075250 20:12411756-12411778 GACTGTGGCTGGAGGGAGACAGG - Intergenic
1170144069 20:13153727-13153749 CTAGAGGGCTGGTGGGAGGCAGG - Intronic
1170897742 20:20431228-20431250 AAGTAGGACTGGAGAGAGGCCGG + Intronic
1170906235 20:20517276-20517298 CATTAGGACAGGAGTGAGGCTGG + Intronic
1171883497 20:30634671-30634693 AACTAGAGCTGCAGGGATGCAGG + Intergenic
1172027772 20:31960722-31960744 CACTGTGGCAGGAGGGAGCCAGG + Intergenic
1172162133 20:32876067-32876089 CTCAGGTGCTGGAGGGAGGCTGG + Intronic
1173475594 20:43356861-43356883 CTCTAGGGGTGGAGTGAAGCTGG - Intergenic
1173540888 20:43849982-43850004 CACCAGGGCCGCAGGGAGGAAGG - Intergenic
1173557698 20:43978347-43978369 AAGAAGGGCGGGAGGGAGGCAGG - Intronic
1173789232 20:45816976-45816998 CACTAGGGTTGGAGGTACTCAGG + Intergenic
1174526943 20:51180076-51180098 AACTGGGGCTGGAGAGATGCAGG - Intergenic
1175308028 20:57991451-57991473 GCCTAGGGCTGGTGGAAGGCGGG + Intergenic
1175642323 20:60641219-60641241 AACCAGGCCTGGAGGGAGACAGG + Intergenic
1175913045 20:62413739-62413761 CCCGAGGTCTGGGGGGAGGCCGG + Intronic
1176041430 20:63067913-63067935 GGCCAGGACTGGAGGGAGGCAGG + Intergenic
1176843690 21:13860255-13860277 AACTAGAGCTGCAGGGATGCAGG + Intergenic
1176846359 21:13879575-13879597 AACTAGAGCTGCAGGGATGCAGG + Intergenic
1176946632 21:14990200-14990222 GAGGAGGGGTGGAGGGAGGCAGG - Intronic
1177046895 21:16182539-16182561 AAGGAGGGATGGAGGGAGGCAGG - Intergenic
1177223360 21:18222094-18222116 CTCCAGTGCTGGAGGGAGGTAGG + Intronic
1178523537 21:33305632-33305654 CTCTAGGCCTGTTGGGAGGCAGG + Intergenic
1178662826 21:34521466-34521488 CCCTCGGGTGGGAGGGAGGCAGG - Intronic
1179549643 21:42135733-42135755 CACTTTGGCTGGAGGGTGGGAGG + Intronic
1179617657 21:42592578-42592600 CACTAAGGCTGGAGGGACAAGGG + Intergenic
1179621448 21:42618873-42618895 CTCTAAGGGTGGAGGGTGGCAGG - Intergenic
1179712669 21:43272360-43272382 CAGTGAGCCTGGAGGGAGGCAGG + Intergenic
1179820702 21:43935343-43935365 CCCCGGGGCTGGAGAGAGGCGGG - Intronic
1179937455 21:44614359-44614381 CACTGTGGCTGGAGGGAGCCCGG + Intronic
1179982136 21:44901124-44901146 CACCCGGCCTGGAGGGAGGAGGG + Intronic
1180137342 21:45870459-45870481 TCCTAGGGCAGCAGGGAGGCCGG + Intronic
1180143274 21:45905939-45905961 CACTAAGGCTGCAGGTAGGTGGG + Intronic
1180151561 21:45950801-45950823 CAACAGGGCTGGAGGGAGGGAGG - Intergenic
1180994611 22:19959441-19959463 CACTGGGCCGGGAGGGACGCGGG - Intronic
1181015472 22:20066185-20066207 CACTGGAGCGGGAGGCAGGCTGG + Intergenic
1181021697 22:20106907-20106929 GACAAGGGCTGGACGGAGACAGG - Intronic
1182639310 22:31753935-31753957 CGCGAGGGCGGGAAGGAGGCGGG + Intronic
1182800683 22:33029573-33029595 TCCTAAGGCTGGAGGGAGGATGG - Intronic
1183174529 22:36213048-36213070 CAGAAGGGCTGGAGTGGGGCTGG + Intergenic
1183417091 22:37688774-37688796 CTCCAGGGCGGGAGGGAGGCTGG + Intronic
1184547844 22:45184227-45184249 GACCCGGGCTGGAGGGAGGACGG + Intronic
1184836069 22:47021804-47021826 CACTGGGGCGGGAGGGAGACAGG - Intronic
1184975351 22:48057776-48057798 TACAAGGGTTGGAGGGAGGTGGG + Intergenic
1185014047 22:48333246-48333268 GAGTGAGGCTGGAGGGAGGCGGG - Intergenic
1185058605 22:48593817-48593839 CAGCAGGGCAGGAGGGCGGCAGG - Intronic
1185108039 22:48885387-48885409 GACGAGGGGAGGAGGGAGGCAGG - Intergenic
1185108053 22:48885432-48885454 GACGAGGGGAGGAGGGAGGCAGG - Intergenic
1185134285 22:49060308-49060330 CAGGAGGGCTGGAGGGTGGAAGG - Intergenic
1185175422 22:49323844-49323866 CACTGGGGAGGGAGGGTGGCAGG - Intergenic
1185298145 22:50064231-50064253 CTCCTGGGCTGGAGGGCGGCTGG - Intronic
1185307325 22:50127253-50127275 AACCAGGGGTGGAGGCAGGCAGG - Intronic
1185338397 22:50280966-50280988 CATCAGGTCTGGGGGGAGGCTGG + Exonic
949588469 3:5467216-5467238 CATTAGGTCTGGAGCAAGGCTGG + Intergenic
949987730 3:9553421-9553443 AGCCAGGGCTGGAGGTAGGCTGG + Intronic
950546121 3:13639070-13639092 CACTGTGGGTGGAGGGAAGCAGG + Intergenic
951498952 3:23362488-23362510 CAGCAGGGATGGAGGGAGGAGGG - Intronic
951508940 3:23480158-23480180 TACGAGTGCAGGAGGGAGGCCGG - Intronic
952636271 3:35536661-35536683 CACTAGGTCTATCGGGAGGCAGG - Intergenic
952954324 3:38547773-38547795 CCCTGGGGCTGGGGGAAGGCAGG + Intergenic
953775506 3:45813189-45813211 CAAGAGTGCTGGAGGGATGCTGG - Intergenic
954138951 3:48595235-48595257 GACTCGGGCTGGAGGGGCGCTGG - Exonic
954297141 3:49680610-49680632 CACCAGGGTTGGAGGTAGGCTGG - Exonic
954362638 3:50130355-50130377 CACTAAGGCTGGATTTAGGCTGG - Intergenic
954663331 3:52237601-52237623 CACCAGGGCTGGAGGCTGGGAGG + Intronic
956836514 3:73100431-73100453 CCATAGGGCAGGAGGGAGGGGGG + Intergenic
957062041 3:75490021-75490043 CCCTGGGGCTGGAGGGAGCAGGG + Intergenic
957927487 3:86833106-86833128 GATTAGGGCTTGAGGCAGGCAGG - Intergenic
958552615 3:95636604-95636626 GACCAGGGCTTGAGGGAGGAGGG - Intergenic
961034756 3:123634654-123634676 CGCTCTGGCTTGAGGGAGGCTGG + Intronic
961041017 3:123678381-123678403 CACAAGTGCAGGAGGGAGGTGGG - Intronic
961049946 3:123737604-123737626 CACTAGGATTGGCAGGAGGCAGG - Intronic
961291360 3:125849380-125849402 CCCTGGGGCTGGAGGGAGCAGGG - Intergenic
961373689 3:126448640-126448662 CCCTAGGGCTGGAGGGACTAGGG + Intronic
961616543 3:128187201-128187223 CAATGGGGCTGGAGGCAGTCAGG - Intronic
961895812 3:130166968-130166990 CCCTGGGGCTGGAGGGAGCAGGG + Intergenic
962270654 3:133975653-133975675 CAGTATGGCTGGATGGAGGGAGG - Intronic
962530536 3:136276443-136276465 CACTAGGGCAGGAGCGAGTCTGG - Intronic
963121164 3:141778229-141778251 CAAGAGGGCTGGAGGGCTGCTGG - Exonic
963256797 3:143152998-143153020 GACTGGGGCAGGAGGGAGGAGGG - Intergenic
964090310 3:152868540-152868562 CAGAAGGGCTGGAGGGATGTGGG - Intergenic
965700938 3:171459158-171459180 CAGTGGGGCTGGGGGGAGGGAGG + Intronic
966747974 3:183296416-183296438 CTTCAGGGCTGGAGGGAGCCTGG - Intronic
966973332 3:185065262-185065284 CCCTGGGGCTGGAGCAAGGCAGG - Intergenic
967889757 3:194356772-194356794 GGCCAGGGCTGGAGGGAGGTGGG - Intronic
968228106 3:196988619-196988641 CGCCAGTGCTGGAGGCAGGCTGG - Intronic
968370286 3:198219611-198219633 CACGCGGGCTGCTGGGAGGCAGG - Intergenic
968370696 3:198221244-198221266 CACTCGGGCTGCTGGGAGGTAGG + Intergenic
968545048 4:1194172-1194194 GGCTGGGGGTGGAGGGAGGCCGG - Intronic
968591522 4:1462150-1462172 GGCTGGGACTGGAGGGAGGCGGG - Intergenic
968612439 4:1563416-1563438 CTCTAGGGCTGCAGGGAGGACGG - Intergenic
968698390 4:2043427-2043449 CACTAGGGCTGGTGGGGGGTGGG - Intronic
969005936 4:4020112-4020134 CCCTGGGGCTGGAGGGAGCAGGG + Intergenic
969460600 4:7326846-7326868 CTCCAGGGCTGGGGAGAGGCTGG + Intronic
969543835 4:7811100-7811122 CACTGGAGCTGAGGGGAGGCCGG + Intronic
969606682 4:8205451-8205473 CAAGAGGCCTGGAGGCAGGCAGG - Intronic
969624534 4:8295567-8295589 CACTAGGGCTGAAGAGAAGGTGG - Intronic
969659539 4:8518414-8518436 CATTAGGGCAGAAGGGAGGGCGG + Intergenic
969746962 4:9080148-9080170 CTCTGGGGCTGGAGGGAGCAGGG - Intergenic
969807013 4:9617178-9617200 CCCTGGGGCTGGAGGGAGCAGGG - Intergenic
969843540 4:9901434-9901456 CACAAGGCTTGGAGAGAGGCCGG - Intronic
970534369 4:17014268-17014290 CAGAAGGGCTGGAAGCAGGCAGG - Intergenic
970603050 4:17655329-17655351 CCCCAGGGATGGAGAGAGGCTGG - Intronic
973367148 4:49216943-49216965 AACTAGAGCTGCAGGGATGCAGG + Intergenic
976907860 4:90262765-90262787 CACAGGGGCAGGAGTGAGGCTGG - Intronic
979004958 4:115282438-115282460 CTCGTGGGGTGGAGGGAGGCGGG + Intergenic
981580106 4:146242409-146242431 CACTAGGGCTGGCCCGAGGCGGG - Intergenic
981585362 4:146295641-146295663 CACTAGGGTTGGTGGGTAGCTGG + Intronic
982227772 4:153181731-153181753 CACCTGGGCTGGAGGTGGGCAGG + Intronic
982360297 4:154512232-154512254 CTGGAGGGCTGGAGGGAGGATGG + Intergenic
982645208 4:158015507-158015529 CAGTAGGGCTGGAAAAAGGCTGG + Intergenic
983162452 4:164433095-164433117 CACTCTTGCTTGAGGGAGGCTGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
986733171 5:10649782-10649804 CCCCAGGGCGGGAGGGAGGCCGG - Exonic
987093760 5:14530325-14530347 CACTAGGTCTGGGGTGAGTCTGG - Intronic
987167883 5:15219976-15219998 CACAAGGGCTGGACTGTGGCAGG + Intergenic
988481076 5:31631096-31631118 CACGAGGGAAGGAGGGAGGTGGG + Intergenic
991365080 5:65859843-65859865 CACAAAGGTTGGAGGGAGGCTGG + Intronic
992249944 5:74866495-74866517 AGCCGGGGCTGGAGGGAGGCAGG - Intronic
992888909 5:81185789-81185811 CGCCAGGGCTAGAGGGAGGCTGG + Intronic
993075610 5:83226356-83226378 CTCTGGGGCTGGAGGGAGGGTGG + Intronic
994140325 5:96334381-96334403 CACTAGGGGTGGAGGTGGGTGGG - Intergenic
994160160 5:96548523-96548545 CACAAGGGTTGGTGGGGGGCGGG - Intronic
995468031 5:112470904-112470926 CATCACTGCTGGAGGGAGGCAGG + Intergenic
995840416 5:116438521-116438543 CCCAAGGGCAGGAGGAAGGCTGG + Intergenic
996507239 5:124281341-124281363 TACCAGGGCTGGAGGAAGGAGGG - Intergenic
997228944 5:132228853-132228875 CACTGGGCCTGGGCGGAGGCTGG - Intronic
997374904 5:133390902-133390924 CACAAGGGCTGGGGCGAGGGAGG + Intronic
997519256 5:134512186-134512208 CTCTAGGCCTGCAGGGAAGCTGG - Intergenic
997567270 5:134898047-134898069 CAGTGGTGCTGAAGGGAGGCTGG - Intronic
999176904 5:149638275-149638297 CCCTACAGCTGGAGAGAGGCGGG - Intergenic
1001646670 5:173287277-173287299 TACCAGGGCAGTAGGGAGGCGGG + Intergenic
1001663050 5:173411025-173411047 CTCTGGAGCTGGAGGGCGGCTGG - Intergenic
1001860210 5:175047763-175047785 CTCTGGGGCAGGAGGGTGGCAGG + Intergenic
1002047234 5:176549069-176549091 CACTGGGGCAGGCTGGAGGCGGG - Intronic
1002063045 5:176637738-176637760 GAGGAGGGCTGGAGGGAGGAGGG + Intronic
1002285741 5:178161681-178161703 CACAAAGTCTGGAAGGAGGCTGG - Intergenic
1002356406 5:178632885-178632907 CACACGGGCAGGAGGGAGCCAGG - Intergenic
1002454574 5:179338847-179338869 CACCAGGCGTGGAGGGAAGCCGG + Intronic
1002729818 5:181326371-181326393 CACGCGGGCTGCTGGGAGGCAGG - Intergenic
1002729929 5:181326799-181326821 CACTCGGGCTGCTGGGAGGTAGG + Intergenic
1002884325 6:1280649-1280671 CACCATTGCTGGAGGGAGGAGGG + Intergenic
1003153423 6:3571641-3571663 CAGTAGGGCTGGAGCAAGGCTGG + Intergenic
1003292671 6:4793416-4793438 GACTGGGGTTGGAGTGAGGCCGG + Intronic
1003567784 6:7235239-7235261 CATTAGAGCTGGAAGGAGCCTGG + Intronic
1004692542 6:18004772-18004794 CAGTGAGGCTGGAGGGAGCCAGG - Intergenic
1006257554 6:32843808-32843830 CCCTAGGGATGCAGGGAGGCGGG - Intronic
1006606312 6:35259932-35259954 TGCTAGGGCCGGAGGGAGGTGGG - Intronic
1006734077 6:36259827-36259849 TACTAGGGAGGGAGGGAGGAGGG + Intronic
1006803108 6:36771820-36771842 CACTGGGGCTGGGGGGCGGGGGG + Intronic
1006939792 6:37744113-37744135 CATCAGGGCTGGTGGGAGGATGG + Intergenic
1007048208 6:38798859-38798881 CACTAGGGCTGAAGGGACCAGGG + Intronic
1007337976 6:41168469-41168491 CATCCGGGATGGAGGGAGGCAGG - Intergenic
1007622546 6:43223762-43223784 CATTAGAGCTGGAGAGAGCCTGG - Intronic
1007745689 6:44041714-44041736 CGCTGGGGGTGGAGGGAGGTGGG - Intergenic
1007817253 6:44533358-44533380 CACTAGGGCAGGAGTGGGGATGG + Intergenic
1010781226 6:79947633-79947655 TACTAGGGAGGGAGGGAGGGAGG - Intergenic
1011260198 6:85462264-85462286 AAGTAGGGCTGGAGGCAGTCCGG - Intronic
1011746901 6:90415112-90415134 CACAGGGGCTGGGGGGAGACGGG + Intergenic
1015856580 6:137631454-137631476 CCTTAGGGCTGGAAGGAAGCTGG + Intergenic
1016395475 6:143619245-143619267 AACTAGGTCTGGAGTGGGGCTGG - Intronic
1016804873 6:148202487-148202509 CAGGAGGGCTGCCGGGAGGCTGG + Intergenic
1017065754 6:150527757-150527779 GTCGGGGGCTGGAGGGAGGCTGG - Intergenic
1017609358 6:156168055-156168077 CACCCAGGCTGGAGGGAGGGAGG + Intergenic
1017734036 6:157344559-157344581 AGCTAGGGCTGGGGGGAGGAGGG - Intergenic
1018650568 6:165988488-165988510 CGCTCTGCCTGGAGGGAGGCTGG + Intergenic
1019354317 7:570857-570879 CGCTTGGGCTGCAGGGAGGGTGG - Intronic
1019357138 7:586495-586517 CAACAGGGCTGGAGGGTGGCAGG - Intronic
1019367430 7:642012-642034 CACTTGGGGAGGAGGGAGGAGGG - Intronic
1019490293 7:1310059-1310081 GACCAAGGCTTGAGGGAGGCTGG + Intergenic
1020083657 7:5299225-5299247 TAACAGGGCTGGAGGGTGGCGGG - Exonic
1020326489 7:6978417-6978439 CTCTGGGGCTGGAGGGAGCAGGG + Intergenic
1022170195 7:27820012-27820034 CAGTAAGGCTGGAGTGGGGCAGG - Intronic
1022247314 7:28572797-28572819 CACCATGCCTGGATGGAGGCGGG + Intronic
1023819090 7:43970453-43970475 CCCTAGGGCTGCTGGGAGGAGGG + Intergenic
1023819139 7:43970717-43970739 CCCTAGGGCTGCTGGGAGGAGGG + Intergenic
1023840909 7:44097020-44097042 CCCCAGGGCTGGAGGGAGGAGGG + Intergenic
1024074486 7:45811624-45811646 CACGCGGGCTGCCGGGAGGCAGG - Intergenic
1024074817 7:45812982-45813004 CACGCGGGCTGCCGGGAGGCAGG - Intergenic
1024648590 7:51387623-51387645 CACGCGGGCTGCCGGGAGGCAGG + Intergenic
1025052537 7:55742447-55742469 CACGCGGGCTGCCGGGAGGCAGG + Intergenic
1025052922 7:55743904-55743926 CACGCGGGCTGCTGGGAGGCAGG + Intergenic
1025129825 7:56369454-56369476 CACGCGGGCTGCCGGGAGGCAGG + Intergenic
1026877172 7:73886481-73886503 CTCTGGGACAGGAGGGAGGCGGG + Intergenic
1027199339 7:76053233-76053255 GACCAGGGATGGAGGGAGGGGGG + Intronic
1028990194 7:97040913-97040935 CACTAGAGGTGTAGGAAGGCAGG - Intergenic
1029582677 7:101447801-101447823 CACTTGGGCTGCAGGGGGCCAGG + Intronic
1029744143 7:102507412-102507434 CCCTAGGGCTGCTGGGAGGAGGG + Intronic
1029744190 7:102507680-102507702 CCCTAGGGCTGCTGGGAGGAGGG + Intronic
1029762134 7:102606575-102606597 CCCTAGGGCTGCTGGGAGGAGGG + Intronic
1029762181 7:102606842-102606864 CCCTAGGGCTGCTGGGAGGAGGG + Intronic
1031359713 7:120834451-120834473 GATGAGGGCTGCAGGGAGGCTGG + Intronic
1031709886 7:125032256-125032278 CACTGGGGCTTGTGGGAGGTGGG - Intergenic
1032051534 7:128653492-128653514 CACGTGGGCTGCTGGGAGGCAGG - Intergenic
1032291812 7:130595964-130595986 CACTACGGCTGAGGGGAGTCAGG - Intronic
1032469640 7:132169001-132169023 CCCTAGGGCTGGAGAGGGGTGGG - Intronic
1033131782 7:138751252-138751274 CAGCAGGGCCGGTGGGAGGCAGG - Intronic
1034262174 7:149764077-149764099 GACTAGAGCTGAAGGGGGGCAGG - Intergenic
1034455270 7:151166973-151166995 GACCAGGGCTGGCGGGAGGCCGG - Intronic
1034492651 7:151402208-151402230 CACTAGGGCTGGAAGAGGCCAGG + Intronic
1034738278 7:153449272-153449294 GACAAGGGCTGGAGGGAAGCAGG + Intergenic
1034953507 7:155317316-155317338 CACAGTGGCTGGAGGCAGGCAGG - Intergenic
1035136937 7:156712859-156712881 CAACAGGGCAGGGGGGAGGCTGG + Intronic
1035280537 7:157775676-157775698 CACAAGGGCAGGACGGAGCCTGG + Intronic
1035573150 8:687586-687608 GAGCAGGACTGGAGGGAGGCGGG + Intronic
1035761953 8:2074990-2075012 CACTGGAGCTGGAGGCAGGTGGG - Intronic
1037748665 8:21665860-21665882 CACTATTTTTGGAGGGAGGCTGG - Intergenic
1037775788 8:21834803-21834825 CAGGAGGGAGGGAGGGAGGCAGG + Intergenic
1037805317 8:22055376-22055398 ATCTAGGGCTGGAGTGGGGCTGG + Intronic
1037827129 8:22166056-22166078 CACTTGGGCTGGGTGGTGGCTGG - Intronic
1037868281 8:22465993-22466015 CACTGGGGCTGGTCGGAGGATGG - Intronic
1038412485 8:27368959-27368981 CACAAGGGCTGGAGTGAGAGAGG - Intronic
1038540227 8:28385512-28385534 CGCCAGGGCGGGAGGGACGCGGG + Intronic
1038591899 8:28846913-28846935 TACTAGAGCTGGAGGGAAGCTGG + Intronic
1039470857 8:37813034-37813056 AACTGGGGGTGGAGTGAGGCAGG + Intronic
1039471122 8:37814441-37814463 CAGAAGGTCTGGAGGCAGGCGGG - Intronic
1040101807 8:43512654-43512676 CACTAGGCCTGGTGTCAGGCAGG - Intergenic
1041986970 8:63933380-63933402 CACAGGGGCTGGAGGGGGGAAGG - Intergenic
1042064023 8:64853970-64853992 CACAAGGGCAGGTGGGAGGTAGG + Intergenic
1042484621 8:69336721-69336743 CCCGAGGCCTGGAAGGAGGCAGG + Intergenic
1043855780 8:85263137-85263159 CTCTAAGGCAGGAGTGAGGCTGG + Intronic
1044629723 8:94266591-94266613 CACATGGGGTGGAGGGAGGATGG + Intergenic
1045489384 8:102656839-102656861 CACTCCAGCTGGTGGGAGGCAGG + Intergenic
1047670014 8:127135945-127135967 GAAGAGGGCTGGAGGGAGGGTGG - Intergenic
1048298617 8:133235095-133235117 CACGAGGTCAGGAGGGAGGGAGG - Intergenic
1048550422 8:135428244-135428266 CACTGGGGCTGGAGGGACAAGGG - Intergenic
1048887922 8:138923384-138923406 CACAAGGGCTGAAGGGACTCAGG - Intergenic
1049156921 8:141072986-141073008 CACTCGGGCTGCAGGCAGGCAGG - Intergenic
1049214904 8:141403035-141403057 CCCCAGGGCTGCTGGGAGGCTGG - Intronic
1049433523 8:142576006-142576028 CACCCAGGCTGGAGGGAAGCAGG + Intergenic
1049443804 8:142620952-142620974 CATTCTGGGTGGAGGGAGGCTGG - Intergenic
1049578539 8:143400530-143400552 CCCCAGGGCTGGAGGGGGCCTGG - Intergenic
1049594599 8:143477580-143477602 CACCAGGCCTGGAGGGAGGCAGG + Intronic
1050294664 9:4193695-4193717 CACCTGAGCTGGAGGGAGGCTGG + Intronic
1052998358 9:34563873-34563895 CACTCTGAGTGGAGGGAGGCAGG - Intronic
1053414326 9:37937505-37937527 CACTCGTGCTGGAAGGAGGATGG + Intronic
1054361719 9:64128406-64128428 CCCTAGGGCTGAAGGAAGACGGG - Intergenic
1054841434 9:69745465-69745487 CACTTGTGATGGAGGGAGGAAGG - Intronic
1056316864 9:85398608-85398630 AACTAAGGCTGGAGAGGGGCTGG - Intergenic
1056507978 9:87275406-87275428 CACTAGAGCAGGAGGGAGGCAGG + Intergenic
1056942942 9:90970866-90970888 CAATGGGGCTGGAAGGAGGCTGG - Intergenic
1057571332 9:96206382-96206404 CACTCTGGCTGGAGCGAGGAGGG + Intergenic
1057930021 9:99185141-99185163 CTCAAGGGCGAGAGGGAGGCAGG + Intergenic
1058938485 9:109791471-109791493 CACTTCTGCTGGAGGAAGGCTGG - Intronic
1059311342 9:113390767-113390789 CAGCAGGGCTGGTGGGAGGGAGG + Intronic
1059711051 9:116868046-116868068 CACTGGGGGCGGAGGCAGGCTGG + Intronic
1059949212 9:119444474-119444496 AACCAGGGCTGGAGGGATGAGGG + Intergenic
1060109081 9:120893963-120893985 CAGTAGTTCTGGAGTGAGGCTGG - Intronic
1060337222 9:122736689-122736711 GAATAGGTCTGGAGTGAGGCAGG + Intergenic
1060346301 9:122819418-122819440 CATTAGAGCTGGAGTGGGGCTGG - Exonic
1060934140 9:127506045-127506067 CAGGCGGGCAGGAGGGAGGCAGG + Exonic
1060995451 9:127872965-127872987 CACTGGCACTGGAGGGAGCCCGG - Intronic
1061290804 9:129649386-129649408 CCCTGCGTCTGGAGGGAGGCTGG + Intergenic
1061296422 9:129679279-129679301 CACAAGGAATGGAGGGAGTCCGG + Intronic
1061817791 9:133206890-133206912 CTCCAGGGCAGGAGGGTGGCCGG - Intronic
1061847314 9:133394960-133394982 CACTCTGGCTGCAGGGAGGCAGG + Intronic
1062243172 9:135550476-135550498 CACTGGGGCTGCAGGGATGCGGG + Intergenic
1062309446 9:135928262-135928284 TACTCGGGCTGGGGGGTGGCGGG - Intergenic
1062423398 9:136494903-136494925 GGCAGGGGCTGGAGGGAGGCGGG - Exonic
1062544560 9:137055660-137055682 CGCTGGGCCTGGAGGGAAGCGGG - Intergenic
1062547314 9:137069621-137069643 CACCAGGGCCGGGGGGTGGCAGG - Intronic
1062709952 9:137969863-137969885 CAGTAGGGCAGGAGGGAGGCAGG - Intronic
1062754230 9:138278883-138278905 CACGCGGGCTGCTGGGAGGCAGG - Intergenic
1062754344 9:138279313-138279335 CACTCGGGCTGCTGGGAGGTAGG + Intergenic
1203577790 Un_KI270745v1:21640-21662 CACGCGGGCTGCTGGGAGGCAGG - Intergenic
1203578248 Un_KI270745v1:23473-23495 CACTCGGGCTGCTGGGAGGTAGG + Intergenic
1186605118 X:11081487-11081509 CAGTATGTCTGGAGGGTGGCAGG + Intergenic
1187024210 X:15417057-15417079 TACTGGGGGTGGAGGGGGGCGGG - Intronic
1187464997 X:19519207-19519229 CAGTGGGGCTGGGGGGAGGTAGG - Intergenic
1188327306 X:28821679-28821701 CACTAGGGCTGAAGAAAGCCAGG - Intronic
1189920799 X:45901414-45901436 CACTGGTACAGGAGGGAGGCAGG + Intergenic
1190262330 X:48805295-48805317 CACCAGAGCTGATGGGAGGCAGG + Intronic
1190479507 X:50861933-50861955 CACTAGGGCTGCAAGAAGACAGG + Intergenic
1190726787 X:53195117-53195139 CACCAGGGAGGGAAGGAGGCGGG - Intronic
1192343460 X:70282236-70282258 GACGAGGCCTGGATGGAGGCCGG + Exonic
1192436812 X:71148237-71148259 CAGCAGGGCAGGCGGGAGGCAGG - Intronic
1192799225 X:74449988-74450010 CACTAGTGGTGGAGGAAGGATGG - Intronic
1193047835 X:77070999-77071021 CACTAAGGCTGCAGAGGGGCTGG + Intergenic
1193300983 X:79887894-79887916 CACTGGGACAGGAGTGAGGCTGG + Intergenic
1195000592 X:100639614-100639636 TGGTAGGGATGGAGGGAGGCTGG - Intronic
1195264181 X:103164135-103164157 CACAGGGGCTGGAGGGTGGGAGG + Intergenic
1195691303 X:107628253-107628275 GACTGGGGGTGGAGGGATGCTGG - Intergenic
1197526847 X:127575050-127575072 CACGAGCTCAGGAGGGAGGCTGG + Intergenic
1198204241 X:134451399-134451421 CCCTAGGCCTGGAGGAAAGCGGG + Intergenic
1198816072 X:140591738-140591760 AGCTGGGGCTGGAGGGAGACAGG + Intergenic
1199397432 X:147355583-147355605 CACTAGGGCTGGTCGGGGGAGGG + Intergenic
1199745312 X:150768741-150768763 CAGTAAAGCTGGAGGCAGGCTGG + Exonic
1200064672 X:153498661-153498683 TACCAGGGAGGGAGGGAGGCAGG + Intronic
1200746770 Y:6910483-6910505 AGCTGGGGCTGGTGGGAGGCGGG + Intergenic
1201291203 Y:12421635-12421657 TACCAGGGCTGGGCGGAGGCGGG - Intergenic
1201757050 Y:17497768-17497790 CACTAGGGCTGGTCTGAGGGTGG + Intergenic
1201844504 Y:18408216-18408238 CACTAGGGCTGGTCTGAGGGTGG - Intergenic