ID: 1144953227

View in Genome Browser
Species Human (GRCh38)
Location 17:19004895-19004917
Sequence ACGCACTGCCCACGGTCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144953219_1144953227 6 Left 1144953219 17:19004866-19004888 CCCTCGACAGACAGACAGACCTG 0: 1
1: 1
2: 3
3: 26
4: 148
Right 1144953227 17:19004895-19004917 ACGCACTGCCCACGGTCCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 126
1144953220_1144953227 5 Left 1144953220 17:19004867-19004889 CCTCGACAGACAGACAGACCTGG 0: 1
1: 1
2: 2
3: 29
4: 217
Right 1144953227 17:19004895-19004917 ACGCACTGCCCACGGTCCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 126
1144953217_1144953227 22 Left 1144953217 17:19004850-19004872 CCGGAAGCTGATTCACCCCTCGA 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1144953227 17:19004895-19004917 ACGCACTGCCCACGGTCCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 126
1144953218_1144953227 7 Left 1144953218 17:19004865-19004887 CCCCTCGACAGACAGACAGACCT 0: 1
1: 0
2: 0
3: 14
4: 161
Right 1144953227 17:19004895-19004917 ACGCACTGCCCACGGTCCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144953227 Original CRISPR ACGCACTGCCCACGGTCCCC TGG Intronic
900476535 1:2878871-2878893 ACGGCCTCCCCACCGTCCCCCGG + Intergenic
900505914 1:3029691-3029713 ACACACTGCTCACAGGCCCCAGG + Intergenic
900619438 1:3580209-3580231 ACTCCCTGCCCACCTTCCCCAGG - Intronic
901461790 1:9396371-9396393 AGCCACTGCGCCCGGTCCCCAGG - Intergenic
902871469 1:19316089-19316111 ACTCACTGTCCAGGGTGCCCGGG + Intronic
904629740 1:31831897-31831919 ACTCACTGCCTAGGGTCACCGGG - Intergenic
915662078 1:157412858-157412880 AAGTACTGCCCACTGTCCTCAGG - Intergenic
915720744 1:157983622-157983644 ACACACAGCCCAAGGTCTCCAGG + Intergenic
919910521 1:202107878-202107900 ACACACTGCCCAAGGTCACAGGG - Intergenic
921079255 1:211725576-211725598 TCCCACTGCCCACTGCCCCCTGG + Intergenic
1065878731 10:30021123-30021145 ACCTGCTGCCCACAGTCCCCTGG + Intronic
1071545009 10:86522135-86522157 CTGCACAGCCCGCGGTCCCCAGG - Intergenic
1071800517 10:89054743-89054765 ACGTTCTTCCCATGGTCCCCAGG - Intergenic
1076770327 10:132659363-132659385 ACCCTCTGCCCATGGTCCCATGG - Intronic
1076880434 10:133236999-133237021 ACGCCCTGAGCACGGGCCCCCGG - Intergenic
1080705207 11:34685272-34685294 ACCCACTGCCAACGGTCACAAGG - Intergenic
1081752985 11:45525334-45525356 AAGCATTGCCCACGTTCCCTGGG - Intergenic
1086002728 11:82000977-82000999 ACCCAGTGACCAGGGTCCCCTGG + Intergenic
1088259259 11:107928804-107928826 GCGCGGTGCCCAAGGTCCCCGGG - Intronic
1089219494 11:116858876-116858898 ACGCAGTGCCCTCAGTCCCTTGG - Intronic
1090399287 11:126438537-126438559 AGGCACTGCCAAATGTCCCCTGG + Intronic
1091657423 12:2355714-2355736 ACACACTGCCAAATGTCCCCAGG - Intronic
1103415952 12:120741560-120741582 ACCCCCTCCCCACTGTCCCCGGG - Intergenic
1103915435 12:124373435-124373457 CCTCACTGCCCACTGTGCCCGGG - Intronic
1103915469 12:124373561-124373583 CCTCACTGCCCACTGTGCCCGGG - Intronic
1103915481 12:124373603-124373625 CCTCACTGCCCACTGTGCCCGGG - Intronic
1105889368 13:24671181-24671203 ACGCTCTGCCCACTCTCCCAAGG - Intergenic
1113908611 13:113831550-113831572 AGACACAGCCCAGGGTCCCCTGG + Intronic
1114455183 14:22849339-22849361 AGGCACCTCCCAGGGTCCCCGGG - Intergenic
1117785023 14:59274540-59274562 AAGCACTGCCCTAGGCCCCCAGG - Intronic
1118244232 14:64093126-64093148 AAGCACTGCCCAAGGTGCCCTGG + Intronic
1118321045 14:64753603-64753625 ACACTCTGCCCATGGTCCCGCGG + Exonic
1119266738 14:73267201-73267223 ACCCACTGCCAAATGTCCCCTGG + Intronic
1122307433 14:100774505-100774527 AGGCATTGCCTACTGTCCCCCGG - Intergenic
1126724851 15:51622277-51622299 ACGCAGGACCCACGGTCCCACGG + Intronic
1127391983 15:58513104-58513126 ACTCACGGCCCACAGTCCCTAGG + Intronic
1128313567 15:66646438-66646460 ACGCACTGACCACTATCCCAGGG - Intronic
1128944196 15:71810398-71810420 CCGGGCTGCCCAAGGTCCCCCGG - Intronic
1129165588 15:73775401-73775423 CCGCACTGCCCACAGCCCTCAGG - Intergenic
1130398684 15:83529350-83529372 ACACACTGCCCAGGGGCCCCAGG - Intronic
1131227750 15:90639256-90639278 ACGCACTCCCCTCACTCCCCAGG - Intronic
1132203408 15:99970405-99970427 ACACACTGCCCACAGCCCCCTGG - Intergenic
1133107332 16:3521015-3521037 ACACCCTGCCCACTGTCCCGAGG + Intronic
1134608727 16:15591170-15591192 ATCCACTGCCCACGGTCCCAGGG + Intronic
1138355055 16:56371035-56371057 AAGCAGTGCCCAGGGCCCCCAGG + Intronic
1141999306 16:87655045-87655067 AGGCGCTGCCCACTGACCCCAGG - Intronic
1144653534 17:17021423-17021445 AGGCACTGTCCCCGCTCCCCTGG - Intergenic
1144953227 17:19004895-19004917 ACGCACTGCCCACGGTCCCCTGG + Intronic
1147187434 17:38720298-38720320 AGGCCCCGCCCCCGGTCCCCTGG + Intronic
1150209920 17:63436306-63436328 AGGAGCTGCCCAGGGTCCCCAGG - Intronic
1152094593 17:78265834-78265856 ACGCTCTGCCCAGGGATCCCAGG - Intergenic
1152255946 17:79239554-79239576 CCACACTGCCCACTGCCCCCAGG + Intronic
1152395578 17:80030860-80030882 ACGCACTGAGCCCGGTCACCTGG + Intronic
1152630654 17:81409396-81409418 ACGCACTTCCCCCCTTCCCCAGG - Intronic
1152754461 17:82081425-82081447 ATGCACAGCCCACGCACCCCTGG - Intronic
1152810972 17:82382806-82382828 ACGCGTTGCCCCCCGTCCCCTGG + Intergenic
1152893948 17:82899095-82899117 ACGCGCTGCGGACGGTCCCCAGG - Intronic
1153255464 18:3165987-3166009 ACCCACTGCCCACTGTGCCCAGG + Intronic
1154405238 18:14084580-14084602 AAGCTCTGCCCACCCTCCCCTGG - Intronic
1160532273 18:79572375-79572397 AGGCATTGCCCACGGCCCACGGG - Intergenic
1160537922 18:79604780-79604802 ACCCACGGCCCAGGTTCCCCTGG - Intergenic
1160809529 19:1007421-1007443 ACACACTGTCCAGGGTCCCCTGG - Intronic
1161125898 19:2556908-2556930 AGACACTGCCCCGGGTCCCCTGG + Intronic
1161126423 19:2560504-2560526 AGCCACCGCCCAGGGTCCCCTGG - Intronic
1161464266 19:4419305-4419327 ACGCAGAGCCCATGGTCACCAGG - Intronic
1162159714 19:8702697-8702719 ACGCACTGCCCCCGGCCCTATGG + Intergenic
1163102969 19:15108768-15108790 ACGCAGTACCTACGGGCCCCAGG + Intronic
1165162031 19:33822110-33822132 ACCCACTTCCCACCCTCCCCAGG + Intergenic
926195911 2:10763428-10763450 ACCCCCTGCCCAAGGTCCACAGG - Intronic
926395791 2:12440898-12440920 CAGCACTGCCCTCTGTCCCCTGG + Intergenic
929080748 2:38119770-38119792 ACCCCCTACCCACGGACCCCAGG + Intergenic
931267658 2:60674758-60674780 TCCCACTTCCCACAGTCCCCAGG + Intergenic
936398609 2:112149237-112149259 ACTCACTGCCCAATGCCCCCAGG - Intronic
938289461 2:130141746-130141768 TGGCACTGCCCACGGAGCCCTGG - Intronic
938341735 2:130540500-130540522 AGGCACTGCCTGTGGTCCCCAGG + Intronic
938348094 2:130580209-130580231 AGGCACTGCCTGTGGTCCCCAGG - Intronic
938370836 2:130767472-130767494 AGGCACTGACCAGCGTCCCCTGG - Exonic
938467067 2:131531192-131531214 TGGCACTGCCCACGGAGCCCTGG + Intronic
944529755 2:200655760-200655782 AAGCATGGTCCACGGTCCCCAGG + Intronic
1169293788 20:4375325-4375347 ACGCACTCCCCACAGCCTCCTGG + Intergenic
1169933368 20:10857612-10857634 ACTCCCTGCCCAGGGTCCCAGGG - Intergenic
1170297644 20:14846248-14846270 TCGCACTGCACACTGTCACCTGG + Intronic
1171132450 20:22666141-22666163 CCTCACTGCCCATGGTCACCTGG - Intergenic
1172039962 20:32036834-32036856 ACTCCCTGCCCGCCGTCCCCAGG + Intergenic
1174297730 20:49561029-49561051 AAGCAATGGCCATGGTCCCCGGG + Intronic
1175815378 20:61880756-61880778 ACGCACTGCCCAGCGTGCCTGGG - Intronic
1175886132 20:62291907-62291929 AGGCACTCCCCGCCGTCCCCAGG - Intronic
1176036939 20:63044144-63044166 CCGCAGTGCCCGCGTTCCCCTGG - Intergenic
1176126754 20:63478972-63478994 ACGTCCTGCCCACGCTCACCAGG + Intergenic
1176229342 20:64023828-64023850 GGGCACTGCCCACTGTGCCCAGG - Intronic
1176231682 20:64036246-64036268 ACACCCTGCCCAAGGACCCCAGG + Intronic
1179167246 21:38944624-38944646 GGGCACTGCCCACTGTCCCCCGG - Intergenic
1179218316 21:39385794-39385816 ACGCACTGCACAGGTGCCCCAGG + Intronic
1180061724 21:45388716-45388738 CTGCACTCCCCACAGTCCCCAGG + Intergenic
1180149391 21:45939959-45939981 GCGCACTGCCCACAGTCTTCAGG + Intronic
1180831998 22:18911231-18911253 GGGCACTGCCCACCCTCCCCAGG + Intronic
1181108704 22:20589381-20589403 TGGCACTGCCCACGGAGCCCTGG - Intergenic
1183474903 22:38030811-38030833 AACCACTGACCACGCTCCCCAGG - Intronic
1183504708 22:38202565-38202587 ACGCACCGCCCGCGGGCGCCGGG - Intronic
1184653702 22:45930852-45930874 ACGCGATGCTCACGGCCCCCAGG - Intronic
1203282076 22_KI270734v1_random:136502-136524 GGGCACTGCCCACCCTCCCCAGG + Intergenic
953406970 3:42664477-42664499 ACGCACTGCCCCTGCTCCCGGGG + Exonic
953666561 3:44930012-44930034 ATGCACTGCCCCCGCTCCCAGGG + Intronic
959896221 3:111609861-111609883 AGGCACTGCCAAAGGTCCTCTGG - Intronic
969845628 4:9918020-9918042 AGGCATTGCCCAAGGTCCCAGGG - Intronic
970604616 4:17667526-17667548 ATCCACTGCCCACTGTGCCCAGG + Intronic
970846384 4:20543312-20543334 CTGCACTGCCCACGCTCCCTTGG + Intronic
979552048 4:122002344-122002366 ACTCACTGTCCACTGTCCCTTGG + Intergenic
993496195 5:88611739-88611761 AGGCTCTGCCCACAGTCTCCAGG - Intergenic
1000957567 5:167560860-167560882 AGGCAATGCCAACTGTCCCCTGG - Intronic
1006628583 6:35414965-35414987 ACCCACTTGCCAGGGTCCCCTGG + Intronic
1007582424 6:42967409-42967431 CCTCACTGCCCACCTTCCCCTGG - Exonic
1011029664 6:82908290-82908312 ACGCATTGCCAAATGTCCCCTGG - Intronic
1014272531 6:119349841-119349863 ACGCGCCGCCCAGGGTCCCGCGG + Intergenic
1015376110 6:132512718-132512740 ACGCACCCGCCGCGGTCCCCTGG - Intronic
1018508269 6:164494683-164494705 ATTCACTGCCCACAGTCACCTGG + Intergenic
1020257449 7:6510106-6510128 AGGCACGACCCACGGTACCCAGG + Intronic
1029490952 7:100869655-100869677 AAGAACTGCCTACGGGCCCCTGG + Intronic
1033307227 7:140233833-140233855 AGGCACACCCCACCGTCCCCTGG + Intergenic
1034243239 7:149625068-149625090 CCACACTGCCCGCGGTCACCGGG - Intergenic
1034280703 7:149852077-149852099 AGGCCCTGCCCATAGTCCCCAGG - Intronic
1035828339 8:2668334-2668356 ACGCCCTGCTCCCGGTCCTCTGG - Intergenic
1038612938 8:29071037-29071059 AGGCACTCCCCAGGGCCCCCAGG - Intronic
1039451030 8:37675256-37675278 AGGCACTTCCCAGAGTCCCCAGG - Intergenic
1045259491 8:100559680-100559702 AGGCGCTGCCCACAGGCCCCGGG + Intronic
1046886310 8:119371112-119371134 ACACCCTGGCCATGGTCCCCTGG + Intergenic
1047024596 8:120811925-120811947 ACGCACTCTCCTCGCTCCCCCGG - Exonic
1048306033 8:133285462-133285484 CCGCACTGCCCAAGGCCCCTCGG + Intronic
1048982753 8:139711878-139711900 TAGCACTTCCCACTGTCCCCTGG + Intergenic
1057794693 9:98146750-98146772 ACACACTGCACAGGGTCCTCTGG + Intronic
1058813334 9:108661910-108661932 AGGCACTTCCCAAGGTCACCTGG + Intergenic
1062270546 9:135706393-135706415 CCGCATGGCCCACGGCCCCCAGG + Intronic
1196925702 X:120631214-120631236 AGCCACTGCGCACGGCCCCCAGG + Intergenic
1197684689 X:129427146-129427168 ACCCACTGCCCAAGGGCCCAAGG - Intergenic
1200120096 X:153786118-153786140 ATGCACTGACCACAGCCCCCAGG - Intronic