ID: 1144955942

View in Genome Browser
Species Human (GRCh38)
Location 17:19018865-19018887
Sequence GACACTAGGATTTTTCACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 110}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144955942_1144955952 20 Left 1144955942 17:19018865-19018887 CCAGTGTGAAAAATCCTAGTGTC 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1144955952 17:19018908-19018930 TCAGTCTGGCCCAGATCGGGGGG 0: 1
1: 0
2: 1
3: 8
4: 99
1144955942_1144955950 18 Left 1144955942 17:19018865-19018887 CCAGTGTGAAAAATCCTAGTGTC 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1144955950 17:19018906-19018928 AGTCAGTCTGGCCCAGATCGGGG 0: 1
1: 0
2: 0
3: 2
4: 81
1144955942_1144955949 17 Left 1144955942 17:19018865-19018887 CCAGTGTGAAAAATCCTAGTGTC 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1144955949 17:19018905-19018927 AAGTCAGTCTGGCCCAGATCGGG 0: 1
1: 0
2: 0
3: 11
4: 139
1144955942_1144955948 16 Left 1144955942 17:19018865-19018887 CCAGTGTGAAAAATCCTAGTGTC 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1144955948 17:19018904-19018926 GAAGTCAGTCTGGCCCAGATCGG 0: 1
1: 0
2: 2
3: 11
4: 178
1144955942_1144955951 19 Left 1144955942 17:19018865-19018887 CCAGTGTGAAAAATCCTAGTGTC 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1144955951 17:19018907-19018929 GTCAGTCTGGCCCAGATCGGGGG 0: 1
1: 0
2: 0
3: 11
4: 491
1144955942_1144955945 6 Left 1144955942 17:19018865-19018887 CCAGTGTGAAAAATCCTAGTGTC 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1144955945 17:19018894-19018916 TAACCACCAGGAAGTCAGTCTGG 0: 1
1: 0
2: 1
3: 14
4: 119
1144955942_1144955944 -6 Left 1144955942 17:19018865-19018887 CCAGTGTGAAAAATCCTAGTGTC 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1144955944 17:19018882-19018904 AGTGTCTTCAAATAACCACCAGG 0: 1
1: 0
2: 0
3: 16
4: 144
1144955942_1144955953 26 Left 1144955942 17:19018865-19018887 CCAGTGTGAAAAATCCTAGTGTC 0: 1
1: 0
2: 0
3: 11
4: 110
Right 1144955953 17:19018914-19018936 TGGCCCAGATCGGGGGGCAGTGG 0: 1
1: 0
2: 0
3: 62
4: 1588

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144955942 Original CRISPR GACACTAGGATTTTTCACAC TGG (reversed) Intronic
908614877 1:65908743-65908765 GGCAGTAGGAGCTTTCACACTGG - Intronic
909267737 1:73582561-73582583 TACACTAGTAATATTCACACTGG + Intergenic
912770842 1:112463139-112463161 GACACTAGGATGTGCCACATGGG + Intronic
917344683 1:174017152-174017174 GAAACTAGGAATATTCACAAAGG - Intronic
917415080 1:174800546-174800568 GATACAAGGAATTTTCACAGAGG - Intronic
917544984 1:175955569-175955591 TACATTAGGATTTTCCACATAGG - Intronic
918136551 1:181679346-181679368 GGGACTAGGATTTTTCACTTGGG + Intronic
919093697 1:193004047-193004069 AACCCTAGGATTTTTCAGAATGG + Intergenic
920287279 1:204889678-204889700 GAAACAAGGATATTGCACACTGG - Intronic
920785853 1:209040393-209040415 AACTCTGGGATTTTTTACACTGG - Intergenic
922165450 1:223112138-223112160 GACACCTGGATCTTTCACATGGG - Exonic
923271100 1:232355679-232355701 GACACTATGGATTTTCACAAGGG - Intergenic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1064903286 10:20317101-20317123 TCCAGTATGATTTTTCACACTGG - Intergenic
1070810473 10:79295141-79295163 GACACTGGGATTTTGAGCACAGG - Intronic
1070837760 10:79461212-79461234 GACACATGGAACTTTCACACTGG - Intergenic
1071853779 10:89602502-89602524 GCTACTTGGATTTTTCAAACAGG + Intronic
1073059101 10:100722902-100722924 GACACTAGGACATTTCAGAAGGG - Intergenic
1076064210 10:127436123-127436145 GACATCTGGACTTTTCACACTGG - Intronic
1078859400 11:15233436-15233458 CACACAAGGATGTTTCACAAGGG + Intronic
1079109014 11:17593654-17593676 GCGAGTGGGATTTTTCACACTGG + Exonic
1080400520 11:31931148-31931170 GACACTGGGATTTCTTACCCTGG + Intronic
1080703483 11:34666316-34666338 GACTTTATGATTTTTGACACTGG + Intergenic
1085578542 11:77629279-77629301 GACACTTGAAGTTTTCACAATGG - Intronic
1088276961 11:108097390-108097412 GAAACTGGGATTGGTCACACAGG - Intronic
1095897512 12:47294736-47294758 GACACTGGGATTTTTAGCAGGGG - Intergenic
1098503697 12:71224571-71224593 GACACAAGAATTTTTCAAAGAGG + Intronic
1100483662 12:95003952-95003974 TACACGAGGCTTTCTCACACGGG + Intergenic
1101277830 12:103221913-103221935 GACACTATGTTTGTTGACACAGG - Intergenic
1102018371 12:109663627-109663649 GACACAGGGACTTATCACACAGG - Intergenic
1105637615 13:22230649-22230671 GGCACTAGGTTTTATCACAAAGG - Intergenic
1105637646 13:22230997-22231019 GGCACTAGGTTTTATCACAAAGG - Intergenic
1105932374 13:25064906-25064928 GAACCTGGGATTTTTCTCACTGG - Intergenic
1108556509 13:51598505-51598527 GCAACAAGGATCTTTCACACAGG + Intronic
1109988723 13:70024893-70024915 CAGACTAGAATTTTTCACACTGG - Intronic
1112640376 13:101267404-101267426 GCCACTGGGTTTTTTCACACAGG - Intronic
1114034945 14:18615209-18615231 GTCACTAGGGTTTTTCAAATAGG + Intergenic
1114419631 14:22570465-22570487 GAAACTAGGTTTTTTAACACAGG + Intronic
1128628263 15:69234440-69234462 GGCACTAGGATTATTTACAAAGG - Intronic
1129026719 15:72582709-72582731 GACACTAGCATTTGTCACTTTGG - Intronic
1141061190 16:80872612-80872634 TACAGTAGGATTTCTTACACAGG + Intergenic
1144693109 17:17281715-17281737 GACACTAAGATTTTACAGATGGG - Intergenic
1144955942 17:19018865-19018887 GACACTAGGATTTTTCACACTGG - Intronic
1147417288 17:40301879-40301901 GAGAAAAGGATTTTTCACACTGG - Intronic
1148800179 17:50220295-50220317 GATACTAGCATTTTCCTCACTGG - Intergenic
1149030444 17:52076950-52076972 GACACCTGGATTTTTCCCAGGGG - Intronic
1150982756 17:70161765-70161787 GACACTTGGATTCTTTACACAGG - Intergenic
1153696572 18:7649060-7649082 GGCCCTAGGATTTTTCAAAATGG - Intronic
1159613747 18:70555396-70555418 CCCACTAGGATTTTCCCCACTGG + Intergenic
1160729991 19:637314-637336 GACAGGAGGAGATTTCACACAGG - Intergenic
1162662620 19:12182225-12182247 GACACAAAGCTTTTTCACAATGG - Intronic
1162715798 19:12632395-12632417 GTAACTAGGATTTTTCCTACTGG + Intronic
1162784801 19:13027922-13027944 GAAGGTAGGATTTTTCTCACTGG + Intronic
1164530196 19:29042667-29042689 TTCTCTGGGATTTTTCACACTGG + Intergenic
925728305 2:6895972-6895994 TACTCTAGGAGTTTTCCCACTGG - Exonic
931104772 2:59043287-59043309 GACCCCAAGATTTTTCAGACAGG - Intergenic
932643395 2:73475147-73475169 GACATTTGGATTTTCCACTCTGG + Intronic
933814728 2:86056700-86056722 GGCCCTAGGATTTTTCACAATGG - Intronic
938276304 2:130027640-130027662 GTCACTAGGGTTTTTCAAATAGG - Intergenic
938327262 2:130418401-130418423 GTCACTAGGGTTTTTCAAATAGG - Intergenic
938362677 2:130703076-130703098 GTCACTAGGGTTTTTCAAATAGG + Intergenic
940281791 2:151996780-151996802 GACACTAGGATTTTAGAAACTGG - Intronic
1169278042 20:4246661-4246683 GACACTATGAATATTTACACTGG - Intronic
1169607274 20:7336509-7336531 CACACTACGTTTTCTCACACTGG + Intergenic
1171262492 20:23746717-23746739 GACACTCGATTTTTTCACAAAGG - Intergenic
1171520090 20:25769157-25769179 GACACTAGGGTGATTCAGACAGG + Intronic
1171556829 20:26087336-26087358 GACACTAGGGTGATTCAGACAGG - Intergenic
1176654222 21:9575433-9575455 GACACTAGGGTGATTCAGACAGG + Intergenic
1177286357 21:19056542-19056564 GGCCCTAGGATTTTTCAGAATGG - Intergenic
1180459065 22:15542257-15542279 GTCACTAGGGTTTTTCAAATAGG + Intergenic
953002183 3:38946040-38946062 GACACTAGGAAGTTTTAGACAGG - Intronic
953611676 3:44452062-44452084 GACACTGCCATTTTTTACACTGG - Intronic
958941867 3:100325739-100325761 GTCACTGGTATGTTTCACACAGG + Intergenic
959950320 3:112174323-112174345 GACCTTAGGATTTTTCATGCTGG + Intronic
960401584 3:117206129-117206151 GGGACTAGGATTTTTCAGAATGG - Intergenic
963323478 3:143835359-143835381 GAGGCTGAGATTTTTCACACTGG - Intronic
963697440 3:148578727-148578749 GACAACATGATTTTTCACATAGG + Intergenic
963887000 3:150594058-150594080 GACATTTGGATTTTAAACACTGG + Intronic
965300096 3:166997844-166997866 GGCACTGGGATTTTTAACACAGG - Intergenic
968009909 3:195267503-195267525 GAAACTAGAATTTCTCACTCTGG - Intronic
971390029 4:26177048-26177070 GACACTGTGAGTTTACACACAGG + Intronic
971490080 4:27202989-27203011 GACAGTAGGAATTTTGATACAGG + Intergenic
974878818 4:67729660-67729682 GAAAATAGGGATTTTCACACAGG + Intergenic
980146231 4:128987356-128987378 CACTCTAGGATTGGTCACACTGG - Intronic
982440858 4:155434075-155434097 GAAACTGTGATTTTTCATACAGG + Intergenic
982861646 4:160458680-160458702 GACACTAAGATTGTGCCCACAGG + Intergenic
984254368 4:177373314-177373336 GACACAAGGAATCTTCACAAAGG + Intergenic
986625659 5:9721467-9721489 GACACCAGGGACTTTCACACAGG - Intergenic
986724242 5:10582328-10582350 GACTCTAGGATTGTAAACACGGG - Intronic
989201634 5:38770007-38770029 GACACTAGGGCTCTTCTCACGGG - Intergenic
990975897 5:61561592-61561614 GACACTTGGATTGTCCACTCTGG + Intergenic
991655581 5:68901024-68901046 GACACTAGAATATATGACACAGG - Intergenic
992640773 5:78766832-78766854 GAAACTGGGATTATTCATACTGG + Intronic
997816050 5:137018226-137018248 TACACTAGGGTTTTTCAACCTGG - Intronic
997969339 5:138387750-138387772 GACACTATGATGATTTACACTGG - Intronic
999154926 5:149451207-149451229 GACACTGGGACTTTTTACACAGG - Intergenic
1000674197 5:164100722-164100744 GCCAAGAGGATTTTCCACACAGG - Intergenic
1001426117 5:171623792-171623814 GACCCTAGGAGTTTTGAGACAGG + Intergenic
1008754322 6:54776341-54776363 GACATTGGGGTTTTTAACACAGG - Intergenic
1009910470 6:69919321-69919343 AACACGAGGATTTTCCAGACAGG + Intronic
1025195982 7:56934062-56934084 GGCCCTAGGATTTTTCAGAATGG - Intergenic
1025280573 7:57624101-57624123 GACACTAGGGTGATTCAGACAGG + Intergenic
1025304157 7:57841406-57841428 GACACTAGGGTGATTCAGACAGG - Intergenic
1025675966 7:63642874-63642896 GGCCCTAGGATTTTTCAGAATGG + Intergenic
1025953261 7:66162821-66162843 GAGACTAGGTTTTTTGACACTGG + Intergenic
1037387384 8:18357933-18357955 GACACCAGAATTCTTCACCCTGG + Intergenic
1041131456 8:54706538-54706560 TCCAGTAGGATTTTTCAGACTGG - Intergenic
1047235265 8:123035963-123035985 TAAACTAGCATTTGTCACACAGG - Intronic
1048824218 8:138408076-138408098 GACCCTAGGATTTTTGGAACGGG + Intronic
1051889353 9:21926768-21926790 GACACTAGATTTTCTCACAGAGG + Intronic
1056890435 9:90486992-90487014 GACACTGGGATTTCTAACATGGG + Intergenic
1057491083 9:95520215-95520237 GACAATAGGACTTTTGAAACAGG + Intergenic
1058504647 9:105655813-105655835 GAAACTAGGATTTTTCAGGATGG - Intergenic
1060522525 9:124301709-124301731 GTCACTAGGATTATCCCCACTGG - Intronic
1061586130 9:131569966-131569988 CACAGCAGGATTATTCACACTGG - Intergenic
1062411093 9:136424920-136424942 AACACTAGGATGTTTCTAACAGG - Intergenic
1203631943 Un_KI270750v1:78891-78913 GACACTAGGGTGATTCAGACAGG + Intergenic
1186894409 X:13991590-13991612 GACATTTGGATTTGTAACACTGG - Intergenic
1194361159 X:92952152-92952174 GAGACTAGGTTTTTTCACTGTGG + Intergenic
1196177132 X:112651492-112651514 TCCACTTGGATTTCTCACACAGG + Intronic
1197606023 X:128586459-128586481 GGCACTAGGATTTGCCACAGTGG + Intergenic
1200409443 Y:2846938-2846960 GACACAAGGTTTTTACACCCTGG - Intronic