ID: 1144956867

View in Genome Browser
Species Human (GRCh38)
Location 17:19023073-19023095
Sequence GTGGTGAACAGGGAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1054
Summary {0: 1, 1: 1, 2: 11, 3: 118, 4: 923}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144956856_1144956867 9 Left 1144956856 17:19023041-19023063 CCTCACACTCTTCCAAGGCAGAG 0: 1
1: 0
2: 1
3: 16
4: 282
Right 1144956867 17:19023073-19023095 GTGGTGAACAGGGAGGAGGATGG 0: 1
1: 1
2: 11
3: 118
4: 923
1144956853_1144956867 21 Left 1144956853 17:19023029-19023051 CCATCCTGGCTTCCTCACACTCT 0: 1
1: 0
2: 3
3: 70
4: 1291
Right 1144956867 17:19023073-19023095 GTGGTGAACAGGGAGGAGGATGG 0: 1
1: 1
2: 11
3: 118
4: 923
1144956859_1144956867 -3 Left 1144956859 17:19023053-19023075 CCAAGGCAGAGCTGGCCCAGGTG 0: 1
1: 0
2: 6
3: 51
4: 415
Right 1144956867 17:19023073-19023095 GTGGTGAACAGGGAGGAGGATGG 0: 1
1: 1
2: 11
3: 118
4: 923
1144956854_1144956867 17 Left 1144956854 17:19023033-19023055 CCTGGCTTCCTCACACTCTTCCA 0: 1
1: 0
2: 2
3: 52
4: 503
Right 1144956867 17:19023073-19023095 GTGGTGAACAGGGAGGAGGATGG 0: 1
1: 1
2: 11
3: 118
4: 923
1144956851_1144956867 29 Left 1144956851 17:19023021-19023043 CCCTAGCTCCATCCTGGCTTCCT 0: 1
1: 0
2: 2
3: 36
4: 455
Right 1144956867 17:19023073-19023095 GTGGTGAACAGGGAGGAGGATGG 0: 1
1: 1
2: 11
3: 118
4: 923
1144956852_1144956867 28 Left 1144956852 17:19023022-19023044 CCTAGCTCCATCCTGGCTTCCTC 0: 1
1: 0
2: 7
3: 57
4: 558
Right 1144956867 17:19023073-19023095 GTGGTGAACAGGGAGGAGGATGG 0: 1
1: 1
2: 11
3: 118
4: 923

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144956867 Original CRISPR GTGGTGAACAGGGAGGAGGA TGG Intronic
900117732 1:1035669-1035691 TTGCTGAACAGGGAGAAGGGAGG - Intronic
900172026 1:1273888-1273910 GCGGTGAGGAGGGAGGGGGAGGG + Intergenic
900178158 1:1299722-1299744 GTGGGAGACAGGCAGGAGGAAGG + Intronic
900321829 1:2088318-2088340 GGGAGGAACAGGGAGGCGGAGGG - Intronic
900552851 1:3265176-3265198 GTGGTGGACAGGGATGAGACAGG + Intronic
900743802 1:4346507-4346529 GGGGTGGACAGGGCTGAGGAAGG + Intergenic
900829087 1:4951301-4951323 GTTGTGTTCAGGGACGAGGAGGG + Intergenic
900862275 1:5242138-5242160 GTCCTGAGCAGGGAGGAGGGGGG + Intergenic
901143952 1:7052889-7052911 GAGGGGAGCAGGGTGGAGGAGGG - Intronic
901186490 1:7376692-7376714 GTTGTGAACATGGAGGATGGTGG + Intronic
901522803 1:9798142-9798164 GAGGGGAAGAGGGAGGGGGAGGG + Intronic
901522812 1:9798160-9798182 GAGGGGAAGAGGGAGGGGGAGGG + Intronic
901755953 1:11441723-11441745 TGGGTGAGCAAGGAGGAGGAGGG + Intergenic
901876303 1:12168730-12168752 GTGGGGAGCAGGGATGAGGGAGG - Intronic
902337233 1:15760604-15760626 GTAGGGAACAAGGAGTAGGAAGG + Intronic
902361076 1:15942991-15943013 GTGGGGAGCAGGGGGAAGGAAGG - Intronic
902480465 1:16708761-16708783 GTCTTCAAGAGGGAGGAGGATGG - Intergenic
902562884 1:17288883-17288905 GTGGGGAACAGGGAAAAGGCAGG + Intergenic
902629669 1:17697141-17697163 TTGGAGCACAGCGAGGAGGACGG + Exonic
902721747 1:18308755-18308777 GTGGTGGGAAGGCAGGAGGATGG + Intronic
902808764 1:18876470-18876492 GGGGTGGGCAGGGAGGAGGGAGG + Intronic
903320345 1:22539264-22539286 TTGGTGGATGGGGAGGAGGATGG - Intergenic
903453491 1:23470794-23470816 GTGGGAAGCAGGGAGGAAGAGGG + Intronic
903521069 1:23950161-23950183 GTTGTAATCAGGGAGGAAGAAGG + Intergenic
903698955 1:25232186-25232208 CTGGTGGACAGCGCGGAGGAGGG - Exonic
903748842 1:25606333-25606355 GTGGTTATCAGGGGCGAGGAGGG + Intergenic
903760376 1:25693731-25693753 GTGATGGACAGAGAGGAGAATGG + Intronic
903763154 1:25713245-25713267 GTGGGGAACAAGGAGATGGAGGG + Intronic
904390744 1:30184252-30184274 GTGGGAAAGAGGGAGGGGGAGGG - Intergenic
904619647 1:31767519-31767541 GTGGTGAACAGGGCTGAGTGAGG - Intergenic
904927836 1:34062538-34062560 GTGGTGAAGAGGGCAGAGGGAGG + Intronic
904945961 1:34198914-34198936 CTGGAGAAGAGGTAGGAGGAAGG - Intronic
905174215 1:36125859-36125881 GAGGTGCACAGTGAGGGGGAAGG + Intergenic
905405310 1:37728520-37728542 GTGGGACACAGGGAGGAGAAAGG + Intronic
905537508 1:38734611-38734633 TTGGTGCACAAGGATGAGGAGGG + Intergenic
905562907 1:38941577-38941599 GTGCTGTGCAGGAAGGAGGAGGG - Intronic
905602970 1:39269794-39269816 GTGGTGAGCAGTGAGGATGTTGG + Intronic
906077089 1:43059819-43059841 GTGGTGAACAAGGAAGGGAAAGG - Intergenic
906302282 1:44691584-44691606 GTAGAGAAGAGGGACGAGGATGG - Intronic
906306598 1:44723925-44723947 GGGCTGAAGGGGGAGGAGGAAGG - Intronic
906782675 1:48586460-48586482 CAGGTGAGGAGGGAGGAGGAGGG + Intronic
906901902 1:49844610-49844632 GTGGTGAGATGGGAAGAGGAAGG - Intronic
907036822 1:51223390-51223412 GTGGGGAAAAGGGAGGATCAGGG + Intergenic
907425364 1:54375946-54375968 GAGGAGAGCAGGGAAGAGGAAGG + Intronic
907713483 1:56906255-56906277 ATGATGGAAAGGGAGGAGGAGGG + Intronic
908662207 1:66448985-66449007 TTGGTGCACAAGCAGGAGGAGGG + Intergenic
909086447 1:71174281-71174303 GTGGGGAGCTGGAAGGAGGATGG + Intergenic
910220570 1:84885753-84885775 GTGGTGGACACAGAGGAGGCAGG + Intronic
910278739 1:85475323-85475345 GAGGAGAAGGGGGAGGAGGAGGG + Intronic
910420201 1:87052631-87052653 GTGGCGAGCAGTGAGGAAGATGG + Intronic
910556939 1:88544766-88544788 ATGGTGAGCAGGGAGGAAGACGG + Intergenic
911044762 1:93619282-93619304 GTGGAAAAGAGGGATGAGGAAGG + Intronic
911102767 1:94107167-94107189 GAGGTTAACAGGGATGAGAAAGG - Intronic
911665255 1:100543964-100543986 ATGGTGAGGAGGGAGTAGGATGG + Intergenic
911905574 1:103564532-103564554 ATGGGGTACAGGGAGTAGGAAGG - Intronic
912369035 1:109158653-109158675 ATTGTGCACAGGGAGGGGGAAGG + Intronic
912406988 1:109447602-109447624 GTGGTAAAAAGGGAGTGGGAGGG + Intergenic
912410595 1:109478305-109478327 GTGTAGAACAGGCAGGAGGAGGG - Intronic
912903219 1:113675175-113675197 GTGGTGTGCAGGAAGGATGAAGG + Intronic
913481674 1:119294774-119294796 TTGGAGAACAGGCAGGAGGGTGG - Intergenic
913528183 1:119713220-119713242 GTGGTGGACAGGGCTGAGGCGGG - Intronic
914401070 1:147320416-147320438 GTAGTGAACAGTGAGGTGGCTGG - Intergenic
914995015 1:152535735-152535757 GAGGTGACCAGGGAAGAGCAGGG + Intronic
915038393 1:152947442-152947464 GGGCTGAGCAGGGAGAAGGAGGG + Intergenic
915073975 1:153294008-153294030 GTGATGAGCAGGGAGGAGCCAGG - Intergenic
915098202 1:153478987-153479009 CTGGAGACTAGGGAGGAGGAAGG - Intergenic
915106271 1:153536737-153536759 ATGGTGAAGAGGGAGGGGGCTGG + Intergenic
915901179 1:159847635-159847657 GAGGTCCACAGGGAGGGGGACGG - Intronic
916008198 1:160680854-160680876 AGGGTGAGCAGGGAGAAGGAAGG - Intronic
916685168 1:167137668-167137690 GTGGGGAGCAGGGAGGGGAATGG + Intergenic
917223810 1:172760475-172760497 GCTGTGAACAAGAAGGAGGATGG + Intergenic
917416435 1:174815131-174815153 GTGGGGAACGGGGAGGTGGTAGG - Intronic
917510705 1:175667094-175667116 GTGGTGAAGAAGGATGAGGAAGG - Intronic
917737656 1:177935113-177935135 GTGGAGATCAGGGTGGAGCATGG - Intronic
918070816 1:181132189-181132211 GAGGTGAACAGGTGGGTGGAGGG - Intergenic
918125612 1:181580790-181580812 GTGGGGACCTGGAAGGAGGAGGG + Intronic
918416933 1:184319687-184319709 TAAGTGTACAGGGAGGAGGAGGG - Intergenic
919673626 1:200360368-200360390 GTGGTGAACAGAGTGCATGAGGG - Intergenic
920073535 1:203320862-203320884 GTGGGGGACTGAGAGGAGGATGG + Intergenic
920081168 1:203373803-203373825 GTGGTGAAGAGGAAGGAGAGTGG - Intergenic
920098690 1:203503035-203503057 GTGATAAACAGCGTGGAGGATGG + Intronic
920647127 1:207811986-207812008 GGGGTGCTCAGGGAGGAGGAGGG - Intergenic
920666441 1:207966051-207966073 GTGGTGAAGAGGGAGGATAAAGG - Intergenic
920817485 1:209348537-209348559 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
920947065 1:210539526-210539548 CTGGTAAACAGGGATGAGGTGGG + Intronic
921277263 1:213532556-213532578 GTGGAGAACGGGGAGGAAGACGG - Intergenic
921284040 1:213593141-213593163 GTGGGGCACAGCGAGGTGGAAGG + Intergenic
921334867 1:214075961-214075983 GAGGTGATTAGGGAGGAGGAGGG + Intergenic
921590867 1:217001719-217001741 GTGGAGGTCAGGGAGGAGGTAGG + Intronic
921914838 1:220595732-220595754 GTGGATAACAGGTTGGAGGATGG + Intronic
922026765 1:221757067-221757089 GTGGTGATGGGGGAGGGGGATGG - Intergenic
922322605 1:224501940-224501962 GTGGTGAGGAGGCTGGAGGAAGG + Intronic
922468317 1:225860019-225860041 CTGGGGTACAGGAAGGAGGAAGG + Intronic
922729495 1:227942345-227942367 GTGCAGAGCAGGAAGGAGGAAGG + Intronic
923072378 1:230577679-230577701 GAGGAGAAGAAGGAGGAGGAAGG - Intergenic
923072397 1:230577757-230577779 GAGGAGAAGAAGGAGGAGGAGGG - Intergenic
923740919 1:236654458-236654480 TTGGTGAACACGGAGGAGCTGGG - Intergenic
923854482 1:237830860-237830882 GAGGTGGACAGGGAGGAGCAGGG + Intronic
1063280873 10:4628237-4628259 GTGGGGAAGAGGGTGTAGGAAGG + Intergenic
1063305124 10:4891304-4891326 GTGGTGAACAGGGAGGACTTGGG + Intergenic
1063500931 10:6553610-6553632 GTGGAGGAGAAGGAGGAGGAAGG - Intronic
1063505020 10:6589991-6590013 GGGGTGGACAGGGAGGAAGCAGG - Intergenic
1063587834 10:7368608-7368630 GTGATTAAAAGGGAGGTGGAAGG + Intronic
1063605202 10:7517464-7517486 GTGGTGAACAGAAAGGGAGAGGG - Intergenic
1063667262 10:8070572-8070594 GGGCTGAACAGGGAGGAGACAGG + Intronic
1063830024 10:9942120-9942142 GTGCTAAGCAAGGAGGAGGATGG - Intergenic
1064007417 10:11709506-11709528 GTGGGGAAGAGAGAGGAGGATGG + Intergenic
1064008301 10:11715152-11715174 GAGGGAAAGAGGGAGGAGGAAGG + Intergenic
1064407312 10:15075625-15075647 GTGGTTGCCAGGGAGGAGGGAGG - Intergenic
1064443601 10:15373996-15374018 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1066008568 10:31171070-31171092 GTGGAAAAGAGGGACGAGGAAGG - Intergenic
1066051775 10:31643181-31643203 GTGAAGACCAGGGAGGAAGAAGG - Intergenic
1066067896 10:31775497-31775519 GAGGAGAACAGGGGAGAGGAAGG + Intergenic
1066164549 10:32772432-32772454 GCAGTGAACAGGGAGGAGTGTGG - Intronic
1067012589 10:42728348-42728370 GTGGAGAAGAGGGTGGAGGGAGG + Intergenic
1067062745 10:43086325-43086347 ATGTTGAACAGGGATGAGAAGGG + Intronic
1067079544 10:43205365-43205387 GAGGTGAAAAGGGAGGATTAGGG + Intronic
1067437280 10:46287129-46287151 CTGGTGAAAGGGCAGGAGGAGGG + Exonic
1067490832 10:46700338-46700360 GGGATGATGAGGGAGGAGGATGG + Intergenic
1067506344 10:46854171-46854193 GGGATGATGAGGGAGGAGGATGG + Intergenic
1067524937 10:47032732-47032754 GTGGTCACCAGGGACCAGGAAGG - Intergenic
1067578816 10:47426211-47426233 GTGGTGATCAGGGAGGGGCAGGG - Intergenic
1067603831 10:47640029-47640051 GGGATGATGAGGGAGGAGGATGG - Intergenic
1067665354 10:48273372-48273394 GAGGTGAACAGGGGAGAGCAAGG - Intronic
1068643425 10:59437143-59437165 TTGGTGAAGAGAGAGGATGAGGG - Intergenic
1069404799 10:68087728-68087750 GTGGGGAGCAGGGAGGGGAAGGG + Intergenic
1070051655 10:72895542-72895564 GGGGTGATGAGGGAGGAGGATGG + Intronic
1070351116 10:75592997-75593019 GTGTTCAGCAGAGAGGAGGAGGG - Intronic
1070817134 10:79331695-79331717 GAGGGGAATAGGGAGGAGGTGGG - Intergenic
1071541812 10:86492025-86492047 GTGGATACCAGGGATGAGGAGGG - Intronic
1071730559 10:88244265-88244287 CTGAGGAACAAGGAGGAGGAGGG - Intergenic
1071971919 10:90916115-90916137 ATGGGGGACAGGGAGGGGGAGGG + Intronic
1072308977 10:94136214-94136236 GTGGTTACCGGGGATGAGGAAGG + Intronic
1072713608 10:97734848-97734870 GGGGTGGACAGGGTGGGGGATGG + Intergenic
1072954029 10:99873215-99873237 GTAGGGGACAGGGAGGAAGAGGG + Intergenic
1073027057 10:100495749-100495771 GTGGAAAACCGGGATGAGGAAGG + Intronic
1073236041 10:102017226-102017248 CTGGTGATCATGGAGTAGGAAGG - Intronic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073321478 10:102618816-102618838 GTGGAGAACAGGGAGGGAGCAGG + Intronic
1073483370 10:103800990-103801012 GTGGTGAAGAGGCGGGAGGATGG - Intronic
1073533372 10:104253446-104253468 GTGGGGAACAGGGAGAAAGGAGG + Intronic
1073582448 10:104680953-104680975 GCGGGGAACAGAGAGCAGGAGGG + Intronic
1074126783 10:110534950-110534972 ATGATGAAGAAGGAGGAGGAGGG + Intergenic
1074145935 10:110717344-110717366 CTGGAGAGGAGGGAGGAGGAGGG - Intronic
1074600642 10:114909901-114909923 TTGGGGGACAGGGAGCAGGATGG + Intergenic
1074761387 10:116669810-116669832 GAGGTGGGCAGGGAGGAGGGTGG + Intronic
1075075742 10:119349153-119349175 CTGGAGAAGAGGCAGGAGGAAGG + Intronic
1075313520 10:121433853-121433875 GTGGAGAGCATGGAGGAAGATGG + Intergenic
1075694320 10:124422407-124422429 TTGGTGCACTGGGAGCAGGAAGG - Intergenic
1076238531 10:128884285-128884307 GTTGTGATGAGGGAGGAGGAAGG - Intergenic
1076426177 10:130369253-130369275 CTGGGGAAGAGGGAGCAGGAGGG + Intergenic
1076740052 10:132478474-132478496 GTGGGGTACAGGGGGGAGAAAGG + Intergenic
1076989831 11:267288-267310 GTGGGGAGAAGTGAGGAGGAGGG + Intergenic
1077187689 11:1242830-1242852 GTGGTGCCCAGGGAGGAAGAGGG - Exonic
1077188111 11:1244501-1244523 GTGGTGCCCAGGGAGGAGGAGGG - Exonic
1077188648 11:1246601-1246623 GCGGTGCCCAGGGAGGAAGAGGG - Exonic
1077189066 11:1248272-1248294 GTGGTGCCCAGGGAGGAGGAGGG - Exonic
1077189629 11:1250456-1250478 GTGGTGCCCAGGGAGGAGGAGGG - Exonic
1077189797 11:1251140-1251162 GTGGTCCACAGGGTGGAGGAGGG - Exonic
1077255239 11:1578744-1578766 ATGGTCCACAGGGAGGAGGAAGG + Intergenic
1077315944 11:1919409-1919431 GGGCTGAGGAGGGAGGAGGAAGG - Intergenic
1077416831 11:2427863-2427885 GTGGAGGACAGGGAGGCAGAGGG + Intergenic
1077493311 11:2872124-2872146 GGGGTGAGCAGGAAGGAAGATGG - Intergenic
1077611590 11:3646261-3646283 GGGGAGATCAGCGAGGAGGAAGG + Intronic
1077746365 11:4911133-4911155 GTGGTAAACTGAGAGAAGGAGGG - Intronic
1077755817 11:5026089-5026111 GTGATGAGCAGGGAGGTGGTTGG - Intergenic
1077839399 11:5958784-5958806 GAGGTGATCAGGGAGGAGGAGGG - Intergenic
1078059223 11:8032663-8032685 GAGGTGCAAAGGGAGGAGGGAGG - Intronic
1078397894 11:10998091-10998113 GTGTTTACCTGGGAGGAGGAAGG - Intergenic
1078451370 11:11443298-11443320 GGGGTGGAGAGGTAGGAGGAGGG - Intronic
1078553831 11:12301644-12301666 GTGTTTTACAGGGAGAAGGAGGG + Intronic
1078633574 11:13028492-13028514 GATGTGCAGAGGGAGGAGGAGGG + Intergenic
1079129937 11:17741470-17741492 ATGGTGAACATGGAGGTGGAGGG - Intronic
1079445542 11:20553561-20553583 GGGAGGAAGAGGGAGGAGGAAGG - Intergenic
1079641896 11:22816159-22816181 GAGGTGGGCGGGGAGGAGGAGGG - Intronic
1080049735 11:27847296-27847318 GCAGAGAACTGGGAGGAGGAAGG + Intergenic
1080316866 11:30959376-30959398 CATGTGAACAGGGAGGAGAATGG - Intronic
1080575706 11:33597371-33597393 GAGGGGAGAAGGGAGGAGGAGGG + Intronic
1080620222 11:33981098-33981120 GTAGTGAACAAAGAGGAAGAAGG - Intergenic
1081700600 11:45150206-45150228 GATGTGAAGATGGAGGAGGAAGG - Intronic
1081716798 11:45256232-45256254 GTGGAGAAGAGGAGGGAGGAAGG - Intronic
1081997866 11:47376659-47376681 GAGGAGGACAGGGAGGAGGGAGG - Intronic
1083254427 11:61487427-61487449 GTGGAGAAGAGGGATGAGGGAGG + Intronic
1083619027 11:64039882-64039904 GGAGAGGACAGGGAGGAGGATGG + Intronic
1083637414 11:64128110-64128132 GAGGTGAGGATGGAGGAGGAGGG - Intronic
1083670354 11:64296765-64296787 GGGGAGAACAGGGAGGAGCAGGG + Intronic
1083883796 11:65560913-65560935 GTGGGGAAGAGCCAGGAGGACGG + Intergenic
1083958656 11:66001858-66001880 GGGATAGACAGGGAGGAGGAAGG - Intronic
1084164577 11:67369495-67369517 GTGAGGAGCAGGGAGGAGAAAGG - Intronic
1084178909 11:67437107-67437129 GTGGTGGGGAGGGAGGAAGAGGG - Intronic
1084413697 11:69018219-69018241 GAGGTGGACAGGGCAGAGGAGGG - Intergenic
1084443851 11:69192011-69192033 GTGGCAAACTGGGATGAGGATGG + Intergenic
1084702506 11:70796515-70796537 CTGGAGGACAGGGAGAAGGAAGG + Intronic
1085178163 11:74508729-74508751 GTGGAGAACAGGCTTGAGGAAGG + Intronic
1085266404 11:75240512-75240534 GTGCTGGAGAAGGAGGAGGAAGG + Intergenic
1085502660 11:77037978-77038000 AGGGGGAAGAGGGAGGAGGAGGG + Intronic
1086586293 11:88456293-88456315 ATGATGAAGAGGGAAGAGGAGGG - Intergenic
1086651924 11:89302169-89302191 GTGGAGGAGTGGGAGGAGGATGG + Intergenic
1087062423 11:93993255-93993277 ATGGCGAACAGGGAAAAGGAGGG - Intergenic
1087528778 11:99352769-99352791 GTGTTGAAAAGGGAAGAGGAAGG + Intronic
1088183201 11:107135341-107135363 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1088343953 11:108801577-108801599 GTGGTGAAAAGAAAGTAGGAAGG - Intronic
1088797425 11:113275172-113275194 GGGGACAGCAGGGAGGAGGAGGG - Intronic
1089004278 11:115077955-115077977 GTAGTGAAAGTGGAGGAGGATGG - Intergenic
1089097829 11:115934233-115934255 GGGGAGAACTGGCAGGAGGAAGG - Intergenic
1089706243 11:120279974-120279996 GTGGAGAACAGTGAGAATGAAGG + Intronic
1089708035 11:120294734-120294756 GAGTTCAACAGGAAGGAGGAAGG - Intronic
1089763716 11:120748095-120748117 GTGGTGAACAGAGAGGCTGAAGG - Intronic
1089926529 11:122264057-122264079 TTGGGTAACAGGGAGGAGGAAGG - Intergenic
1090246778 11:125221805-125221827 GGGGTGGTCGGGGAGGAGGAGGG - Intronic
1090376100 11:126290835-126290857 TTGGTGAAGGGGGAGGAGGGAGG - Exonic
1090407968 11:126488759-126488781 GTGGGGAACAGGTAGGAGCAGGG - Intronic
1090696898 11:129254383-129254405 GTGGAGAATGGGAAGGAGGAAGG - Intronic
1090739135 11:129641328-129641350 GAGGTCAACAGGGAGTAGCAGGG - Intergenic
1090996069 11:131866981-131867003 ATGGAGAACAGGGAGGAGGTGGG + Intronic
1091155549 11:133368259-133368281 GAGAAGAACAGGGAGGAGAAGGG + Intronic
1091356111 11:134938853-134938875 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1091446363 12:546136-546158 GTCGGGAAGAGGGAAGAGGAGGG + Intronic
1091750199 12:3017571-3017593 CTTCTGAACAGGGAGGAGGGAGG - Intronic
1092218129 12:6696423-6696445 CTGGTAAGCTGGGAGGAGGAAGG - Exonic
1092288304 12:7142818-7142840 GAGGTGAGAAGAGAGGAGGATGG - Intronic
1092483383 12:8880624-8880646 CTGGTGAACGGGGAGTGGGAGGG + Intronic
1092509938 12:9144212-9144234 GTGAGGATGAGGGAGGAGGAGGG + Intergenic
1092540234 12:9416145-9416167 CAGGTGGACAGGGAGGGGGAGGG + Intergenic
1092605531 12:10114145-10114167 GAGGTGAAAAGGGAGGGGGAGGG + Intergenic
1092611010 12:10173428-10173450 ATAGGAAACAGGGAGGAGGAGGG - Intronic
1092882734 12:12900568-12900590 GTGGGGAAGAGGGAGAGGGAAGG - Intronic
1093262021 12:16950393-16950415 GTGGTGAAAAGAGAGAAGGGAGG - Intergenic
1093477625 12:19573408-19573430 GTGGTGAACAGGGGGGCCGATGG + Intronic
1093679170 12:21981320-21981342 GTGATACAGAGGGAGGAGGAGGG + Intergenic
1094334607 12:29334641-29334663 GTGGTCAACAGGGAGAGGGATGG + Exonic
1094606694 12:31955474-31955496 GTGGGGGAGAGGGAGGAGGTGGG + Intergenic
1094635975 12:32227369-32227391 GTGGGAAACAGGGAGGTGGGAGG + Intronic
1095252137 12:39991365-39991387 GGGGTGAACACGGAAGATGATGG - Intronic
1096114996 12:49050509-49050531 GTGGCGAACACTGAGGAGGAAGG + Exonic
1096146482 12:49282456-49282478 GTGGTGGAAAGAGGGGAGGAGGG - Intergenic
1096218249 12:49810122-49810144 GCTGTGGACAGGGAGCAGGAGGG - Intronic
1096884007 12:54698894-54698916 GTGGGGAAGGGGGAGGGGGAGGG - Intergenic
1096984343 12:55746010-55746032 GTGGTGTGCAGGGAGGGGGTTGG + Intronic
1097236178 12:57541389-57541411 GTGGTGAGGAGGGAGGATGGGGG + Intronic
1097624879 12:61988038-61988060 GTGGATAACAGCCAGGAGGAAGG + Intronic
1098079330 12:66767291-66767313 GGGATGAAGAGTGAGGAGGAGGG + Intronic
1098359159 12:69638412-69638434 GTCCTGAGCAGGCAGGAGGATGG + Intergenic
1099982944 12:89628075-89628097 GGGGTAGAGAGGGAGGAGGAAGG + Intronic
1100671408 12:96816959-96816981 GGAGTGAAGAGGGTGGAGGAAGG - Intronic
1101317054 12:103638886-103638908 TTGCTGCACAGGTAGGAGGAAGG + Intronic
1101611622 12:106297962-106297984 GTGGTGCCCAGGTAAGAGGAAGG + Intronic
1101650381 12:106672218-106672240 GTGGTGTATGGGGAGGAGAACGG + Intronic
1101754505 12:107610385-107610407 GTGATGCACATGGAGGAGGTGGG - Intronic
1101782751 12:107850059-107850081 GTGGAGAAGAAGGAGGAGCAGGG - Intergenic
1101799824 12:108011508-108011530 GTGGTGAACAGGAGTGAGGAAGG - Intergenic
1102394484 12:112574942-112574964 GTGATGAAGATGGAGGAGGGAGG + Intronic
1102451495 12:113045058-113045080 GGGGGGAAAAGGAAGGAGGAGGG + Intergenic
1102509209 12:113402859-113402881 GTTGTGCCCGGGGAGGAGGAGGG + Intronic
1103072622 12:117957437-117957459 ATGGTGGCCAGGAAGGAGGATGG - Intronic
1103554562 12:121758398-121758420 GTGGTCACCATGGAGGAGGACGG + Intronic
1103554573 12:121758435-121758457 GTGGTCACCATGGAGGAGGATGG + Intronic
1103554581 12:121758472-121758494 GTGGCCACCATGGAGGAGGACGG + Intronic
1103554593 12:121758509-121758531 GTGGTCACCATGGAGGAGGATGG + Intronic
1103554601 12:121758546-121758568 GTGGCCACCATGGAGGAGGACGG + Intronic
1103554613 12:121758583-121758605 GTGGTCACCATGGAGGAGGACGG + Intronic
1103554624 12:121758620-121758642 GTGGTCACCATGGAGGAGGACGG + Intronic
1103554635 12:121758657-121758679 GTGGTCACCATGGAGGAGGATGG + Intronic
1103554643 12:121758694-121758716 GTGGTCACCATGGAGGAGGACGG + Intronic
1103554652 12:121758731-121758753 GTGGTCACCATGGAGGAGGACGG + Intronic
1103554662 12:121758768-121758790 GTGGTCACCATGGAGGAGGACGG + Intronic
1103554672 12:121758805-121758827 GTGGTCACCATGGAGGAGGACGG + Intronic
1103554679 12:121758842-121758864 GTGGTCACCATAGAGGAGGACGG + Intronic
1103554690 12:121758879-121758901 GTGGTCACCATGGAGGAGGACGG + Intronic
1103554700 12:121758916-121758938 GTGGTCACCATGGAGGAGGACGG + Intronic
1103639246 12:122335861-122335883 GTAATGAACAGCGAAGAGGAAGG + Intronic
1104001723 12:124864260-124864282 GAGGAGGAGAGGGAGGAGGAGGG - Intronic
1104055927 12:125230036-125230058 GCCGGGAACAGGGCGGAGGATGG + Intronic
1104547222 12:129723378-129723400 GTGCAGAGCAGGGCGGAGGAGGG - Intronic
1104702438 12:130917532-130917554 GTGGTAAACAGGGTGGAGGTAGG - Intergenic
1104707436 12:130958061-130958083 GAGGGGAACAGTGAGGAGGAAGG - Intronic
1104854038 12:131894128-131894150 GAGGGGAACAGGGAAGGGGAGGG + Intergenic
1104863855 12:131941261-131941283 GAGGTGGTCAGGGAGGAGAAAGG - Intronic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1107062930 13:36180275-36180297 GTGGTGAAGGGGGAGGAGGCTGG - Intronic
1107333740 13:39330890-39330912 GGGTAGAACAGGGAGGAGGCAGG + Intergenic
1107411369 13:40161644-40161666 GTGGTGTAAAGGGGAGAGGATGG - Intergenic
1108550947 13:51543332-51543354 GTGGTGGCCAGGGAGAAGGGTGG + Intergenic
1109001444 13:56810960-56810982 CTGGTGAACAGGGAGGGGTGTGG + Intergenic
1109221043 13:59641376-59641398 GTGGAGAGCAAGGAGGAGTACGG - Intergenic
1109946310 13:69436545-69436567 GTGGGGTACGGGGAGGGGGAGGG + Intergenic
1110080999 13:71311622-71311644 GTGGAGAAAAGGGTGAAGGAGGG + Intergenic
1110189351 13:72713617-72713639 TTGGGGAACAGGGGGAAGGATGG - Intronic
1110192382 13:72745333-72745355 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1110277323 13:73654716-73654738 CTCTAGAACAGGGAGGAGGAGGG - Intergenic
1110427737 13:75388145-75388167 GTTCTTAACAGGGAAGAGGAAGG - Intronic
1111213248 13:85108571-85108593 CTGGTGCACAGGGCGGAGGCAGG - Intergenic
1111717473 13:91897049-91897071 TTGATGAAAAAGGAGGAGGAGGG - Intronic
1112009146 13:95279591-95279613 GTGGGGAGCAGAGAGGAAGATGG + Intronic
1112462361 13:99614089-99614111 ATTAGGAACAGGGAGGAGGATGG + Intronic
1112567137 13:100561453-100561475 GGGGTGAAGAGGCAGGAGGCAGG - Intronic
1113036194 13:106052468-106052490 CTGGTGCACAGGGAGCAGGGAGG - Intergenic
1113932909 13:113977701-113977723 GGGGGGTACAGGGAGGAGGGTGG - Intergenic
1114146423 14:19982826-19982848 GTGGTTCTCTGGGAGGAGGAGGG - Intergenic
1114492541 14:23112530-23112552 GTGGTGAGAAGGCAGGAGGGAGG + Intergenic
1114551584 14:23535456-23535478 CTGGTGTTCAGGGAAGAGGATGG - Intronic
1114674445 14:24431004-24431026 GAGGAGAGCAGGGAAGAGGAGGG + Intronic
1115573168 14:34686236-34686258 GTGGAGAACAAGCAGGAGGTGGG + Intergenic
1115746327 14:36441431-36441453 GAGGTGAAGAGGGAGGATTAGGG + Intergenic
1116028069 14:39537870-39537892 GTGGTGATCAGGCAGGGGCAGGG - Intergenic
1116389383 14:44374926-44374948 TTGGTCAACAGGAAGCAGGAAGG - Intergenic
1116458041 14:45141521-45141543 GAAGGGAACAGGGAGGAGGAAGG - Intronic
1116867192 14:50040421-50040443 GTGGTGAGCAGGGGTGAGGGAGG - Intergenic
1117366976 14:55038767-55038789 GTGGAGAACAGGGTGGAACATGG - Intronic
1117558622 14:56912077-56912099 GTTAGGAACAGGAAGGAGGAAGG - Intergenic
1118126279 14:62908361-62908383 CGGGTGAACAGGAAGCAGGAAGG - Intronic
1118171654 14:63395295-63395317 GAGGAGAAAAGGGAGGAGAAAGG + Intronic
1118471170 14:66076712-66076734 GTGCTAAACAGGGTGCAGGAGGG - Intergenic
1118749168 14:68794141-68794163 GTGGGGAGGATGGAGGAGGAGGG - Intronic
1118870442 14:69736789-69736811 GGGGTGGACAGGGAGGAAGCAGG + Intronic
1119085472 14:71735025-71735047 GTGATGAGCAGGGAAGAGGGGGG + Intronic
1119545626 14:75469522-75469544 GTGACGAAGAGAGAGGAGGAGGG + Exonic
1119616669 14:76103319-76103341 GTGCAGAACAGGGAGGAGGCTGG - Intergenic
1119740776 14:77012448-77012470 GTGGTGAAGCCGAAGGAGGAGGG - Intergenic
1119884646 14:78130079-78130101 TAGGTGAAAAGGGAGGAAGAGGG - Intergenic
1119966444 14:78921453-78921475 TTAGTAAACTGGGAGGAGGAAGG + Intronic
1120021607 14:79537432-79537454 GTGGGGTGCAGGGAGGGGGAGGG - Intronic
1120840721 14:89082854-89082876 CTGGCAAACAGGGAGGAGGGAGG - Intergenic
1120876717 14:89382085-89382107 GAGGGGAATAGGGAGGAGAATGG - Intronic
1121592320 14:95125573-95125595 GTGGGGGAAGGGGAGGAGGAGGG + Intronic
1121695235 14:95907126-95907148 GTGGCAAAAAGGAAGGAGGAAGG - Intergenic
1121744097 14:96274431-96274453 GTGGGGAACAGGGGGGAAGGGGG + Intergenic
1121878166 14:97473838-97473860 GTGGGGAAGAGTCAGGAGGAGGG + Intergenic
1121898365 14:97670144-97670166 GTGGAGGTCAGGGAGAAGGATGG + Intergenic
1122223941 14:100261728-100261750 GGAGTGAAGAGGGAGGAGGCTGG + Intronic
1122406866 14:101505911-101505933 ATGGTGAAAAGGGGGCAGGAGGG - Intergenic
1122804748 14:104250644-104250666 GGGGTGAAAAGGGGGAAGGAGGG + Intergenic
1122835088 14:104426943-104426965 GGGGTGGGCGGGGAGGAGGAGGG - Intergenic
1123134258 14:106012492-106012514 GAGGTGAAAAGGGATGAGGGAGG + Intergenic
1123143741 14:106108363-106108385 TTGGAGAACAGCCAGGAGGAGGG + Intergenic
1123165942 14:106324823-106324845 GAGGTGAAAAGGGATGAGGGAGG + Intergenic
1123185048 14:106508672-106508694 GTGATGAGCTGGGAAGAGGAAGG + Intergenic
1123191841 14:106579133-106579155 TTGGAGAACAGCCAGGAGGAGGG + Intergenic
1123194896 14:106606687-106606709 CAGGTGAAAAGGGAGGAGGGAGG + Intergenic
1123197182 14:106627816-106627838 GAGGTGAAAAAGGAGGAGGGAGG + Intergenic
1123198526 14:106639692-106639714 GAGGTGAAAAAGGAGGAGGGAGG + Intergenic
1123217539 14:106825741-106825763 GTGGTGATAAGGGAGGAGGTGGG - Intergenic
1123539250 15:21271690-21271712 GTGGGGGAGAGGGAAGAGGAAGG - Intergenic
1123584286 15:21742935-21742957 GAGGTGAAAAGGGATGAGGGAGG + Intergenic
1123620937 15:22185538-22185560 GAGGTGAAAAGGGATGAGGGAGG + Intergenic
1124204305 15:27704045-27704067 GTGCGGAACAAGGAGGGGGAGGG + Intergenic
1124701840 15:31920879-31920901 GTGGTGAAGATAGGGGAGGAGGG - Intergenic
1125506090 15:40268484-40268506 GTGGTGGAGGAGGAGGAGGAAGG - Intronic
1125928764 15:43584730-43584752 GGGGTGAGCAGGGAGGAAAAGGG - Intronic
1125931732 15:43604937-43604959 GTGCTGAGCTGGGAGCAGGAGGG - Intronic
1125941930 15:43684565-43684587 GGGGTGAGCAGGGAGGAAAAGGG - Intergenic
1126056185 15:44731889-44731911 GTGGTGAACAATGATGAGGAGGG + Intronic
1126375628 15:47994137-47994159 GAAGAGAACAGGGAGGAAGATGG + Intergenic
1127722579 15:61717372-61717394 GCGGGGAGCAGGGAGGAGGAGGG + Intergenic
1128374508 15:67065677-67065699 GCGGCGAGCCGGGAGGAGGAGGG + Intronic
1128469915 15:67943552-67943574 GAGGAGCACAGAGAGGAGGAAGG + Intergenic
1128548233 15:68581368-68581390 GTGGGGAACAGAGAGCAAGAGGG + Intronic
1128567888 15:68713346-68713368 GTGGGGAACAGGGAGCGAGAGGG - Intronic
1128703544 15:69821765-69821787 GTGGTTAGCAGGGAGGAAGCAGG + Intergenic
1128978463 15:72169612-72169634 CAGGTGAGCAGGGAGGAGGCTGG + Intronic
1129197834 15:73981749-73981771 GGTGTGAAGAGGGAGGAGGAGGG - Exonic
1129247224 15:74286894-74286916 GAGGGGAAGAGGGAGGGGGAAGG - Intronic
1129394372 15:75236073-75236095 GTGGTGAACTGGGAGGAAGAGGG - Intergenic
1129415276 15:75373471-75373493 AGGCTGAAGAGGGAGGAGGAAGG - Intronic
1129589916 15:76905630-76905652 GTGGTGATAAGGCAGGAGGAGGG - Intergenic
1129653411 15:77507294-77507316 GTGGGGAGCAGGGAAGAGGAAGG - Intergenic
1130696502 15:86136768-86136790 GTGAGGAGCTGGGAGGAGGAAGG + Intergenic
1131094732 15:89648188-89648210 GTGGTGGAGAGGAAGGAAGAGGG - Intronic
1131395463 15:92082103-92082125 GAGGTGAACAGGGAAGGAGACGG - Intronic
1131464565 15:92645164-92645186 TTGGTGAACAGAGATAAGGAAGG - Intronic
1131666103 15:94572624-94572646 GTGGTGAGCAAGGAGGAACAAGG - Intergenic
1131838575 15:96414125-96414147 GGAGAGAAAAGGGAGGAGGAGGG + Intergenic
1132102150 15:99031692-99031714 GAGGTGAACAGGGAGAAGAGAGG + Intergenic
1132147416 15:99436992-99437014 GTGCTGGACAGAGGGGAGGAGGG - Intergenic
1133045660 16:3087091-3087113 GGGCTGAGCAGGAAGGAGGAAGG + Intergenic
1133283193 16:4678621-4678643 GTGGTGGGCAGGGAGCAGAATGG + Intronic
1133392625 16:5422328-5422350 GAGGAGAACGTGGAGGAGGAGGG + Intergenic
1133520157 16:6549194-6549216 GAGGGGAAAAGGGAGGAGGAGGG + Intronic
1133520202 16:6549315-6549337 GAGGGGAGGAGGGAGGAGGAGGG + Intronic
1133520260 16:6549463-6549485 GTGGGGAGGAGGGAGGAGGAGGG + Intronic
1133627813 16:7588440-7588462 GGGGTTAACAGGGAGAATGATGG + Intronic
1133828672 16:9301838-9301860 GTTGTGAACAGGGTGGGAGAAGG + Intergenic
1134111014 16:11515697-11515719 GAGCTGAGGAGGGAGGAGGAAGG + Intronic
1134235069 16:12459112-12459134 GGAGTGAAATGGGAGGAGGAGGG - Intronic
1134523598 16:14929069-14929091 GTGGTGGAGGGGGAGGGGGAAGG - Intronic
1134594407 16:15484306-15484328 GTGGTCAAGAGGCAGGAGAAGGG - Intronic
1134711192 16:16327554-16327576 GTGGTGGAGGGGGAGGGGGAAGG - Intergenic
1134719044 16:16370856-16370878 GTGGTGGAGGGGGAGGGGGAAGG - Intergenic
1134948382 16:18341029-18341051 GTGGTGGAGGGGGAGGGGGAAGG + Intergenic
1134955637 16:18381139-18381161 GTGGTGGAGGGGGAGGGGGAAGG + Intergenic
1135725987 16:24854189-24854211 GTGGGGCAGAGGGAGGAGGGAGG - Intronic
1135945415 16:26860625-26860647 GTGGTCAACAGGAATGAGGGAGG + Intergenic
1136075037 16:27811482-27811504 GTGGTGTTCCGGGATGAGGAGGG - Intronic
1136126412 16:28185425-28185447 GTGGTTACCTTGGAGGAGGAGGG + Intronic
1136364384 16:29802719-29802741 GTGGTGATGAGGGAGGAGGTAGG + Intronic
1136510850 16:30737540-30737562 GAGGGGTACAGGCAGGAGGAGGG - Exonic
1137238563 16:46635324-46635346 GTTGGGAACAGGAAGGAGGAAGG + Intergenic
1137320888 16:47380476-47380498 GTGATGGACAGGTAGGAGAAAGG + Intronic
1137522740 16:49208821-49208843 GTAGTGAACTTGGAGGTGGAAGG + Intergenic
1138318621 16:56091715-56091737 AAGTTGAACAGGGAGAAGGAAGG - Intergenic
1138354037 16:56363497-56363519 GTGGTCAACAGGGAGGACCTGGG + Intronic
1138423134 16:56912812-56912834 GGAGTGATCAGGGAGGAGGTGGG + Intronic
1138439205 16:57024201-57024223 GGGGTGAGCAGGGATGGGGAGGG + Intronic
1140266878 16:73428643-73428665 ATGGTGGGGAGGGAGGAGGAAGG - Intergenic
1140769622 16:78191269-78191291 CTGGTGAACAGGGTGCAGGCTGG + Intronic
1140838991 16:78821386-78821408 GTGGTGAGCAGGGGGAAAGAAGG - Intronic
1140960201 16:79904477-79904499 GTGAAGAACAGGGAGGACGGTGG - Intergenic
1141642010 16:85346913-85346935 ATGGTGAACAGGTGGGTGGATGG + Intergenic
1141677793 16:85526610-85526632 GTGGAGAGCAGGGATGGGGAGGG + Intergenic
1141715772 16:85725988-85726010 CTGGTGAGCAGCGAGGAGGCAGG - Intronic
1142134670 16:88446174-88446196 GTCGGGAACTGGGAGGAGGGTGG + Intergenic
1142137833 16:88459749-88459771 GAGGGGGAGAGGGAGGAGGAAGG - Intronic
1142203811 16:88773345-88773367 GTGGGGGCCAGGGAGGAGGTGGG + Intronic
1142329833 16:89444702-89444724 TTGGAAAACAGGAAGGAGGATGG + Intronic
1142642454 17:1292327-1292349 GTGGGGAACAGAGGGGAGGCAGG - Intronic
1143125562 17:4639342-4639364 GTGGAGAAGAGGGCGCAGGATGG - Intronic
1143250988 17:5522837-5522859 GTAGAGAACAAGGAGGAGGAAGG + Intronic
1143254652 17:5546730-5546752 GTGGTTATCAGGGGCGAGGAGGG + Intronic
1143402914 17:6657470-6657492 GTGGAGAAGAGGGCGCAGGATGG + Intergenic
1143526907 17:7478442-7478464 GTGGTGAAGAGGGCGATGGATGG - Intronic
1143651502 17:8266611-8266633 GTAGGGATCAGGGAGGATGAGGG - Intronic
1143727522 17:8859632-8859654 TAGGAGAAGAGGGAGGAGGAAGG + Intronic
1143953747 17:10653411-10653433 GTGGTGAAGGGGGAAGAGGTGGG - Intronic
1143974030 17:10816825-10816847 GTGGTGGACAGGGAAGAGTGGGG - Intergenic
1144083177 17:11783203-11783225 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1144143670 17:12376363-12376385 GGGGTGAAGGGGGAGGAGGGAGG + Intergenic
1144956867 17:19023073-19023095 GTGGTGAACAGGGAGGAGGATGG + Intronic
1144994893 17:19260745-19260767 GTGGTTACCAGGGAGGAGGGAGG - Intronic
1145094280 17:20010457-20010479 GTGTTGAAGATGGGGGAGGAGGG + Intronic
1145969579 17:28949308-28949330 GGAGGGAAGAGGGAGGAGGAAGG + Intronic
1146343526 17:32041778-32041800 TTGGGGAGCAGGGAGGAGGCCGG - Intronic
1146433606 17:32822518-32822540 GCAGTGAACGGGGAGGAGGCGGG - Intronic
1146937329 17:36820321-36820343 GTGGGGGGCAGGGTGGAGGATGG - Intergenic
1146967772 17:37047498-37047520 CTGGGGAACAGGGAGGAGAGGGG - Intronic
1147050792 17:37793157-37793179 GTGGTGAATGGGGAGGAGTCAGG + Intergenic
1147255192 17:39177174-39177196 GCAGGGAACATGGAGGAGGAAGG - Intronic
1147338330 17:39739878-39739900 GGGGTGAGCAGGGAGGAGGAAGG - Intronic
1147363018 17:39943318-39943340 GAGGAGGACGGGGAGGAGGAGGG + Intronic
1147754677 17:42760824-42760846 GTGGAGAAGAGGGAGGGGGCTGG - Intronic
1148002145 17:44395638-44395660 GTACTGAACAGGTAGGAGGGTGG + Intronic
1148528487 17:48365908-48365930 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1148541273 17:48482542-48482564 GTGGTGAACAGAGAGGAGGAGGG + Intergenic
1148693565 17:49546280-49546302 GTGGTGAGCTGGGTGGAGGTGGG + Intergenic
1149461356 17:56832687-56832709 GTGTTTAAGAGGGAGGAGGAGGG - Intronic
1150006909 17:61475616-61475638 GTGGATGACAGTGAGGAGGAGGG + Intronic
1150118560 17:62578232-62578254 ATGGAGAGGAGGGAGGAGGAGGG + Intronic
1151439636 17:74119866-74119888 CTGGTGAACAAGGACAAGGAGGG + Intergenic
1151448478 17:74182403-74182425 CTGGCAAGCAGGGAGGAGGAAGG - Intergenic
1151513518 17:74577497-74577519 GTGGTAATCAGGGAGAAAGAGGG - Intergenic
1151586016 17:75008978-75009000 GTGGTGATCAGGAGGGAAGAAGG - Intergenic
1152336715 17:79703100-79703122 GAGGAGGAGAGGGAGGAGGAGGG - Intergenic
1152368320 17:79870220-79870242 GAGGGGAAGTGGGAGGAGGAAGG - Intergenic
1152371885 17:79893389-79893411 GTGGAGCACAGGGAGGAAGGAGG - Intergenic
1152434112 17:80264682-80264704 GTGCTGAGCAGGAAGCAGGAAGG - Intronic
1152583282 17:81178447-81178469 GTGGTGAGCAGGGAGGGCCAAGG - Intergenic
1152699348 17:81811358-81811380 GCAGAGGACAGGGAGGAGGACGG + Intronic
1153525859 18:5994089-5994111 CTGGTGGACAGGGAGGTAGATGG - Intronic
1153590886 18:6673271-6673293 CTGGTGGCCAGGGAGGAAGATGG + Intergenic
1154199365 18:12288506-12288528 GTGGTGGGCAGGGAGGTGGATGG - Intergenic
1154334733 18:13456359-13456381 AAGGTGCACAGGGAGCAGGAGGG - Intronic
1155337796 18:24783202-24783224 GTGGAGATCTGGCAGGAGGAGGG - Intergenic
1155517717 18:26640025-26640047 GTGGTTTACAGGGAGGAGGTAGG + Intronic
1155576399 18:27252488-27252510 GTGGTAAACTGGGAGGAGGGGGG + Intergenic
1155829244 18:30492227-30492249 GTGGGGAAGAGGGAGGGAGAGGG + Intergenic
1156117378 18:33802257-33802279 GTTGTGAACAAGGGGGAGAATGG + Intergenic
1156461920 18:37326069-37326091 GCCCTGAAGAGGGAGGAGGATGG + Intronic
1156491374 18:37498403-37498425 GGGGAGAAGAGGGAAGAGGAGGG - Intronic
1157479185 18:48042193-48042215 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1157618764 18:49003325-49003347 GAGGGGAAAAGGGAGGAGGATGG - Intergenic
1157733496 18:50025358-50025380 GTTGTGAACTGGTTGGAGGAAGG - Intronic
1157993415 18:52525343-52525365 GTGGTGCAGAGGGTGGAAGATGG - Intronic
1158270763 18:55713295-55713317 GGGCTGAGCAGGAAGGAGGAAGG - Intergenic
1159200450 18:65176952-65176974 GAGGAGAAAAGGGAGGTGGAGGG + Intergenic
1159469435 18:68832578-68832600 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1160110482 18:76024900-76024922 GTGGTGAAGAGGGCAGAGGGCGG - Intergenic
1160237675 18:77098955-77098977 GAGGAGAAGAGGGAGGGGGAAGG - Intronic
1160378104 18:78429389-78429411 GTGCTGGGGAGGGAGGAGGAGGG - Intergenic
1160408354 18:78658642-78658664 GTGGTGGAGAGAAAGGAGGAGGG + Intergenic
1160433075 18:78825543-78825565 GTGGGGAGCAGGGAGGATGGTGG + Intergenic
1160459621 18:79028473-79028495 TGGGTGAGGAGGGAGGAGGATGG - Intergenic
1160487895 18:79310090-79310112 GTGGAGAAGAGGCAGGAAGAAGG + Intronic
1160550898 18:79693202-79693224 GTGGTGACCGGGAGGGAGGATGG + Intronic
1160689856 19:456486-456508 GTGTTGCTGAGGGAGGAGGAGGG - Intronic
1160755929 19:757196-757218 TCGGAGAACAGGGAGGATGAGGG + Exonic
1161241521 19:3225896-3225918 GGGGTGGACAGGGAGGAGGAGGG + Intronic
1161370524 19:3908610-3908632 GAGGAGGACAGTGAGGAGGAGGG - Intronic
1161370553 19:3908696-3908718 GAGGAGAAAAGGGAGGAGGAGGG - Intronic
1161404047 19:4081945-4081967 GGGGTGAGTAGGGAGGAAGAAGG - Intergenic
1161550169 19:4908505-4908527 GAGGTGTCCAGGGAGCAGGAAGG - Intronic
1161550733 19:4910649-4910671 GTGTTGAAGATTGAGGAGGAAGG - Intronic
1161836296 19:6649356-6649378 GAGGTGAAGAGTGAGGAGGAGGG - Intergenic
1161957982 19:7506802-7506824 CTGGGGAAGAGGGAGGAGGTGGG - Intronic
1162006599 19:7784469-7784491 ATGGTACAGAGGGAGGAGGAAGG - Intergenic
1162021940 19:7872103-7872125 GTGGAGCAGAGGGAGAAGGAGGG + Exonic
1162024192 19:7884522-7884544 GAGGAGGAGAGGGAGGAGGAGGG + Intergenic
1162059934 19:8088240-8088262 GTGGTCAACAGGCAGGCAGATGG - Intronic
1162098763 19:8326979-8327001 GTGAGGAACAGGGACCAGGATGG - Intronic
1162467747 19:10852691-10852713 ATGGTGAACAAGGAGGAAAATGG + Intronic
1163092673 19:15031799-15031821 GTGGTCAGCAGGGAGAAGGAAGG + Intergenic
1163283297 19:16330536-16330558 GGTGTGAAGTGGGAGGAGGAAGG + Intergenic
1163496215 19:17647902-17647924 GTGGAGATCAGAGACGAGGAGGG - Intronic
1163595334 19:18218085-18218107 CTGGTGGACAGGGTGGAGGCAGG + Intronic
1163779705 19:19239901-19239923 GGAGAGAAGAGGGAGGAGGAAGG - Intronic
1164235003 19:23324039-23324061 GAGATGGACAAGGAGGAGGAGGG - Intronic
1164902318 19:31938596-31938618 GCTGAGAACAGGGAGGAGAAAGG + Intergenic
1165097342 19:33416830-33416852 GTGGTGAATAACGAGGTGGATGG + Intronic
1165101991 19:33444526-33444548 GGGGTGGAAGGGGAGGAGGAGGG - Intronic
1165227609 19:34365653-34365675 GAGCTGCACGGGGAGGAGGAGGG - Intronic
1165355050 19:35299464-35299486 GAGGTGGACAAGGAGGAGGGTGG + Intronic
1165876187 19:39008660-39008682 GCGGTTGCCAGGGAGGAGGAGGG - Intronic
1165951391 19:39475625-39475647 GTGGGGAAGAGGCAGGAGGCAGG + Intronic
1166279900 19:41784963-41784985 GTAGGGAACAGGAAGGAGCAGGG + Intergenic
1166412853 19:42568241-42568263 GTAGGGAACAGGAAGGAGCAGGG - Intergenic
1166503050 19:43355040-43355062 GGGGTGGGCAGGGTGGAGGAGGG - Intronic
1166507402 19:43379692-43379714 GGGGTGGGCAGGGTGGAGGAGGG + Intergenic
1166556364 19:43702738-43702760 GAGGTGAGGAGGGAGGAAGAGGG - Intergenic
1166695362 19:44848682-44848704 GAGGAAAACAGGGAGGGGGAGGG - Intronic
1167354043 19:48992683-48992705 GTCCTGAACAGGGAAGGGGATGG - Intronic
1167469213 19:49666092-49666114 GGGGTGAGGAGGGAAGAGGAGGG + Intronic
1167588308 19:50387646-50387668 GTGCTGAAGCTGGAGGAGGAAGG - Intronic
1167633189 19:50638527-50638549 GAGGTGAACAGGCAGGCAGAAGG + Intronic
1167667894 19:50833313-50833335 GTGGTGGGGAGGGAGGGGGATGG - Intronic
1167703835 19:51066496-51066518 GTGGGGGAGAGGAAGGAGGAAGG + Intergenic
1168059811 19:53884446-53884468 GTGGGGCACAGAGAGGAGGCCGG + Intronic
1168099990 19:54136280-54136302 GAGGTGAACGTGAAGGAGGATGG - Intergenic
1168243119 19:55097027-55097049 GTGGTGAACTGCGCGGAGAAGGG - Intronic
1168243156 19:55097190-55097212 GTGGTGAACTGCGCGGAGAAGGG - Intronic
1168243213 19:55097442-55097464 GTGGTGAACTGCGCGGAGAAGGG - Intronic
1168399753 19:56078551-56078573 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1168647106 19:58066660-58066682 GTGGTGAGATGGGAAGAGGAAGG - Intronic
1202714507 1_KI270714v1_random:34669-34691 GTCTTCAAGAGGGAGGAGGATGG - Intergenic
925185169 2:1842267-1842289 CACCTGAACAGGGAGGAGGATGG - Intronic
925414678 2:3661094-3661116 CTAATGAACAGGGAGGGGGACGG - Intronic
925746791 2:7050546-7050568 ATGGTGAGAAGGGAGGAGGCTGG - Intronic
925862601 2:8194478-8194500 GGGGAGAGGAGGGAGGAGGATGG - Intergenic
925863119 2:8199681-8199703 GTGGTGTGCAGGGTGGAGGCTGG + Intergenic
925920499 2:8634573-8634595 CTGGTGAGCAGGGAGGACCAGGG - Intergenic
925946428 2:8868173-8868195 GTGGTGATCAGAGAGGGGTAAGG - Intronic
926123665 2:10258251-10258273 AAGGTGAGCAAGGAGGAGGAAGG - Intergenic
926226052 2:10967656-10967678 GTCCTGAGCAAGGAGGAGGAGGG - Intergenic
926266823 2:11330828-11330850 GGGAGGAAGAGGGAGGAGGAGGG + Intronic
926266832 2:11330850-11330872 GGGAGGAAGAGGGAGGAGGAGGG + Intronic
926700085 2:15797738-15797760 TTGGTGAGCAGTGAGGAGCATGG - Intergenic
927756729 2:25714365-25714387 GTGGTGAAGATGGAGGTGGTGGG + Intergenic
927908073 2:26876234-26876256 CTGGTGAACAGAATGGAGGAAGG + Intronic
928370729 2:30738349-30738371 GTTGCCAGCAGGGAGGAGGATGG + Intronic
929937441 2:46303866-46303888 GTGAAGAATGGGGAGGAGGAAGG + Intronic
930250967 2:49033685-49033707 ATAGGGAACAGGGGGGAGGAGGG - Intronic
930569781 2:53070709-53070731 GTGGGGTAGGGGGAGGAGGAAGG + Intergenic
932498168 2:72157873-72157895 GTGAGGGAGAGGGAGGAGGATGG + Intergenic
933283765 2:80361656-80361678 GTGATGAATAGGGAGGTGCAAGG + Intronic
933309451 2:80642187-80642209 ATGGTTAACAGTGACGAGGAAGG - Intronic
933432235 2:82197755-82197777 GTGGTGAACATTGACAAGGATGG + Intergenic
933505782 2:83175653-83175675 GTTCTGAAAAGGAAGGAGGAGGG - Intergenic
933789647 2:85873463-85873485 GTGGGGACAAGGGAGGAGGGAGG + Intronic
934524578 2:95043748-95043770 CTGGGGGACAGGGCGGAGGAGGG - Intronic
934987295 2:98896824-98896846 GTGGAAAAGAGGGATGAGGAAGG + Intronic
935096512 2:99949398-99949420 CTGGAGAGCAGGGGGGAGGATGG + Intronic
935196596 2:100820062-100820084 GAGGTGGAGAGGGAGGAGGGTGG + Intergenic
935515094 2:104026675-104026697 GAGGTGAACAGGGAGGGGTGAGG + Intergenic
935609629 2:105007808-105007830 GTGGAAAACAAGGATGAGGAAGG + Intergenic
936012806 2:108936020-108936042 GTGGTGACCAGTAGGGAGGACGG - Intronic
936061956 2:109300680-109300702 GTGGTGAAGGAGGAAGAGGAAGG - Intronic
936286714 2:111186911-111186933 GTGGTGTAGAGGGATGAGCATGG + Intergenic
936487275 2:112936962-112936984 GAGGGGTACAGGGAGGAGGTGGG - Intergenic
936664270 2:114576345-114576367 GTCTTGAAGAGGGAAGAGGAGGG + Intronic
937024804 2:118689248-118689270 GGTGTTAACAGGGAGGAGGTGGG - Intergenic
937225913 2:120368570-120368592 GAGGGGAAGAGGGAGGAGGGTGG + Intergenic
937478444 2:122235980-122236002 GGGGTGAGCAGGGAGCAGTAAGG + Intergenic
937490232 2:122359471-122359493 GAGGAGAAGACGGAGGAGGAGGG - Intergenic
938143283 2:128813254-128813276 GTGGGGAATAGTGAGGAGGGAGG - Intergenic
938240910 2:129741733-129741755 CTGGGGAACAGGCAGGAGGAAGG - Intergenic
938655699 2:133430859-133430881 GGGGTGGAGAGGGAGAAGGAAGG + Intronic
938662159 2:133498394-133498416 AGGATGAAAAGGGAGGAGGAAGG + Intronic
938887326 2:135664582-135664604 TTGGTGGATAGGGAGGAGGATGG + Intronic
938977762 2:136495584-136495606 GTCCTGAAAAGGGAGAAGGAGGG - Intergenic
939218021 2:139265190-139265212 GTGTTGAACGGGGAGCAGGGTGG + Intergenic
939348822 2:141004924-141004946 GTGGTGAAGAGCAAGGAGGGAGG - Intronic
939958543 2:148546572-148546594 GTGAGGAACATGGGGGAGGAGGG - Intergenic
940055422 2:149507921-149507943 GTTGGGAACAGGGGTGAGGAGGG - Intergenic
940369915 2:152889758-152889780 GTGGGGAGCGGGGAGGGGGAGGG - Intergenic
940829458 2:158452257-158452279 GTGGAGAACAGGGGTGAGGGGGG + Intronic
940856424 2:158731853-158731875 GTGGTGAGGAGGGAGAGGGATGG + Intergenic
941225117 2:162838766-162838788 GTGGGGAACGGGAAGGAGGCGGG + Intergenic
941292867 2:163698000-163698022 GTGGTGCACTGTGAGCAGGAAGG - Intronic
941396474 2:164980257-164980279 GTGGGGAAGAAGGAAGAGGAAGG - Intergenic
941406673 2:165098572-165098594 GTGGAAAAGAGGGATGAGGAAGG - Intronic
941591148 2:167422123-167422145 GAGGAGAAGGGGGAGGAGGAGGG + Intergenic
942252629 2:174060510-174060532 GTGGGGAAGAAGGAGGAGAAAGG - Intergenic
943033914 2:182716626-182716648 GTGAATAACAGGGAGGAGGAAGG - Intronic
944243497 2:197508432-197508454 GTGGTGTGCAGGGAGAAGAATGG - Intronic
944416192 2:199482043-199482065 GTGGTGAAAAGTGAGGTGGATGG + Intergenic
945138831 2:206661535-206661557 GAGAAGAAGAGGGAGGAGGAGGG - Intronic
945205637 2:207329024-207329046 GTTGATAACAGGGTGGAGGAGGG + Intergenic
946142887 2:217706587-217706609 GAGGAGAAAGGGGAGGAGGAAGG + Intronic
946312196 2:218888502-218888524 GTGTTGAACATGGAGAAGGAAGG - Intronic
946347659 2:219124197-219124219 GTGAGGAACTGGGAGGAGTAGGG + Intronic
946514585 2:220397779-220397801 GAGCAGGACAGGGAGGAGGATGG + Intergenic
946559304 2:220894976-220894998 ATGGTGAAAAGGGAGGAGAGTGG - Intergenic
947289689 2:228559079-228559101 GAAGAGAAAAGGGAGGAGGAGGG + Intergenic
947341810 2:229148466-229148488 AGGGTGAAGAGGGAGGAGCAAGG + Intronic
947701853 2:232241011-232241033 GTGGGGAGCTGGGTGGAGGAAGG + Intronic
947732105 2:232436979-232437001 GTGGGGAGCAGGGAGGAGAGAGG + Intergenic
948045662 2:234941585-234941607 GTGGGAGACAGGGAGGAAGACGG + Intergenic
948671514 2:239571560-239571582 GCCGTGAACAGGGTGGAGGTGGG + Intergenic
948725336 2:239930656-239930678 GTGGGAAACAGGGAGGTGGAAGG + Intronic
948883577 2:240872251-240872273 TTCGTGAACATGCAGGAGGAGGG + Intronic
948883602 2:240872408-240872430 TTCGTGAACATGCAGGAGGAGGG + Intronic
948943397 2:241207462-241207484 GTGGTGGACAGAGAGGACAAGGG + Intronic
948989815 2:241548109-241548131 GGGGTAAAGTGGGAGGAGGATGG - Intergenic
949032244 2:241802631-241802653 GCGGGGCAGAGGGAGGAGGAGGG + Intronic
1168876099 20:1173341-1173363 TTGGGGATCAGGGAGGAGGAGGG - Intronic
1169279738 20:4256809-4256831 ATGGTGAACTAGGAGGAGTAGGG + Intergenic
1169624358 20:7547251-7547273 ATGGTTAACAGAGAGTAGGAAGG + Intergenic
1169651321 20:7870892-7870914 GTGGAGAAGAGGGAAGAGAAGGG - Intergenic
1170460249 20:16571142-16571164 GAGGTGAACAGGTTTGAGGAAGG - Intronic
1170634398 20:18092263-18092285 GGTGGGGACAGGGAGGAGGAAGG - Intergenic
1170773208 20:19352062-19352084 GGGCTGCACAGGGAGGATGAGGG + Intronic
1170809379 20:19661830-19661852 GTGCTCAACATGGAGGAGCAGGG - Intronic
1170993296 20:21325561-21325583 GTGTTGACAAGGGAGGAAGAAGG + Intronic
1171209899 20:23309233-23309255 GTGGGGGAAGGGGAGGAGGAGGG - Intergenic
1171209913 20:23309272-23309294 GTGGGGGAAGGGGAGGAGGAGGG - Intergenic
1171209927 20:23309307-23309329 GTGGGGGAAGGGGAGGAGGAGGG - Intergenic
1171279400 20:23883350-23883372 GTTGGGAGCAGGGAGGGGGAAGG - Intergenic
1172114073 20:32563302-32563324 GTAGAGAACAGGGAGGGTGAAGG + Intronic
1172240781 20:33411301-33411323 GGGGTGGAAAGGGAGGAGGCTGG - Intronic
1172588991 20:36104549-36104571 GTGGGGACCAGGGAGGTGGGGGG + Intronic
1172702135 20:36860269-36860291 GGGGTGCACAGGGAGGCTGAGGG - Intronic
1172773911 20:37396509-37396531 GAGGGGGACAGGGAGGAGGGGGG - Intronic
1173397741 20:42696262-42696284 GGAGAGAAGAGGGAGGAGGAAGG - Intronic
1173437623 20:43047073-43047095 GAGGGGAAGAGGGAGGAGGGAGG - Intronic
1173511293 20:43630885-43630907 GTGGTGAGCAGAGTGGAGGAAGG + Intronic
1173537685 20:43828546-43828568 GTGGAGAAGAGGGAGGAAAAGGG + Intergenic
1173909430 20:46653431-46653453 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1174117078 20:48233779-48233801 ATGGTGAGAAGTGAGGAGGAAGG + Intergenic
1175298807 20:57928507-57928529 GAGGAGAAAAGGGAGGAGGAAGG - Intergenic
1175400552 20:58697722-58697744 GTGGGGAACAGGGTGGGGAAGGG + Intronic
1175460190 20:59146588-59146610 GTGCTGAAAGGTGAGGAGGAGGG - Intergenic
1175531199 20:59675016-59675038 GGGAGGAACAGGGAGGAGAATGG - Intronic
1175639217 20:60613521-60613543 GTGCTGAGCAGGGAGGAACAGGG + Intergenic
1175891474 20:62317889-62317911 GGGGTGAGGAGGGGGGAGGAGGG + Intronic
1175975451 20:62708466-62708488 GCGGAGAACAGGGAAGAGGGTGG + Intergenic
1176057181 20:63154945-63154967 GTGGGGAGGAGGGAGGAGGGAGG - Intergenic
1176253994 20:64141084-64141106 GAAGTGGAGAGGGAGGAGGAGGG - Intergenic
1176264778 20:64203508-64203530 GAGGGGAAGAGGGAGGAAGAGGG - Intronic
1176266283 20:64211142-64211164 GTGGTGAGCAGAGAGGGGGCAGG - Intronic
1176548881 21:8213184-8213206 GTGGTGGTGGGGGAGGAGGAAGG + Intergenic
1176550546 21:8219116-8219138 GCGGTGAACGGGGAGGAGGCGGG - Intergenic
1176556776 21:8257397-8257419 GTGGTGGTGGGGGAGGAGGAAGG + Intergenic
1176567812 21:8396219-8396241 GTGGTGGTGGGGGAGGAGGAAGG + Intergenic
1176569476 21:8402157-8402179 GCGGTGAACGGGGAGGAGGCGGG - Intergenic
1176575715 21:8440438-8440460 GTGGTGGTGGGGGAGGAGGAAGG + Intergenic
1176577388 21:8446386-8446408 GCGGTGAACGGGGAGGAGGCGGG - Intergenic
1177198175 21:17924519-17924541 GAGGTGAACAAGGAAGAGAAAGG + Intronic
1177861705 21:26462247-26462269 GTGGTGGCAAGGGATGAGGAGGG + Intergenic
1178094292 21:29197488-29197510 ATGGGGAGCTGGGAGGAGGATGG - Intronic
1178394706 21:32232730-32232752 GTGGTTACCAGGAAGGTGGAAGG + Intergenic
1178793511 21:35722170-35722192 GGTCTGAGCAGGGAGGAGGATGG - Intronic
1178880652 21:36447489-36447511 GCTGTGACCAGGGAGGAAGACGG - Intergenic
1179208580 21:39306446-39306468 GTGGTAAAGACAGAGGAGGAAGG + Intronic
1179305598 21:40151339-40151361 GTGGAGACCAGGGAGGGAGAAGG - Intronic
1179410230 21:41156778-41156800 GAGCTTAACAGGGAGGGGGAAGG - Intergenic
1179437859 21:41374460-41374482 CTGGTGAGCAGGGACGGGGAAGG + Intronic
1180001464 21:44997240-44997262 GTGGTGCTCCGGGAGGAGGGTGG + Intergenic
1180012159 21:45058481-45058503 GTGGGGCTCAGGGAGGGGGAGGG + Intergenic
1181442736 22:22945032-22945054 CAGGTGACCAGGAAGGAGGAGGG + Intergenic
1181489092 22:23250448-23250470 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1181609611 22:24003840-24003862 GTGGTGACCTGGGAGGGGCAGGG + Intergenic
1181837607 22:25623785-25623807 GTGGTGGAAATGGAGGATGATGG - Intronic
1181865405 22:25850925-25850947 GTGGGGAACTGGGAAGAGAAGGG - Intronic
1181959976 22:26616066-26616088 GAGGAGAAGAAGGAGGAGGAGGG + Intronic
1182003886 22:26943142-26943164 GTGGTGAAAGGGGATGAAGAGGG + Intergenic
1182023994 22:27103026-27103048 GAGGTGAGCAGGGAGGGGGCAGG + Intergenic
1182269657 22:29145438-29145460 GCGGGGAACAGGGGTGAGGATGG - Intronic
1182437364 22:30339327-30339349 CTGGTGTGCAGGGAGGAGGCTGG + Intronic
1182692058 22:32171102-32171124 TTGGGGGATAGGGAGGAGGATGG + Intergenic
1182844423 22:33418720-33418742 GGAGTGAGCAGGGAAGAGGAGGG + Intronic
1183034860 22:35133921-35133943 ATGGAGACAAGGGAGGAGGAAGG + Intergenic
1183132509 22:35852571-35852593 GAAGTGTACAGGGAGGAAGAAGG - Intronic
1183351144 22:37335313-37335335 GCGGGGAGCGGGGAGGAGGACGG - Intergenic
1183463597 22:37967958-37967980 CTGGGGAACAGGGAGATGGAGGG - Exonic
1183851824 22:40596059-40596081 GTGGGTAATGGGGAGGAGGAGGG - Intronic
1183961341 22:41413610-41413632 GAGGAGAAAAAGGAGGAGGAGGG + Intergenic
1184321796 22:43747594-43747616 GGGGTGAACGGGGAGGACGTAGG - Intronic
1184387134 22:44182632-44182654 GGGCTGAAAAGGGAGGAAGAGGG + Intronic
1184638378 22:45854394-45854416 GGGGGGAAAAGGGAGGTGGAGGG + Intergenic
1184647500 22:45904015-45904037 GTTGTGAACAGGGAGGAGCATGG + Intergenic
1184688829 22:46108377-46108399 CTGGTGCTCAGGGAGGAGGAGGG + Intronic
1184797009 22:46738383-46738405 GGGGAGAAGAGGGAGGAGGAAGG + Intergenic
1184889321 22:47369844-47369866 AGGGTGGACAGGGAGAAGGAGGG - Intergenic
1184900803 22:47445342-47445364 CAGGTGGACAGGCAGGAGGATGG - Intergenic
1185311799 22:50160199-50160221 GGGGAGAAGGGGGAGGAGGAAGG - Intronic
1185333162 22:50260682-50260704 GTGGTGGAGGGGGAGGAGGGGGG - Intronic
1203253766 22_KI270733v1_random:129492-129514 GTGGTGGTGGGGGAGGAGGAAGG + Intergenic
1203255445 22_KI270733v1_random:135459-135481 GCGGTGAACGGGGAGGAGGCGGG - Intergenic
1203261822 22_KI270733v1_random:174571-174593 GTGGTGGTGGGGGAGGAGGAAGG + Intergenic
949530634 3:4951773-4951795 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
949537188 3:5005082-5005104 GAGGTGAGCAGGCAGGAGCATGG - Intergenic
950358820 3:12435812-12435834 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
950534088 3:13569410-13569432 GTGGTGGGCAGGGAGGTGGCGGG + Intronic
951601207 3:24377776-24377798 TCAGTGTACAGGGAGGAGGAGGG - Intronic
952513467 3:34079853-34079875 GTGGGGTAGAGGGAGGGGGAAGG - Intergenic
952657160 3:35800609-35800631 GAGGAGACCAGGGAGGAAGAAGG + Intergenic
953099377 3:39809924-39809946 GGGGAGAAGAGGGAGGCGGACGG - Intronic
953450439 3:43001087-43001109 CTGGTGGACAGGGAGGGGCAGGG - Intronic
953472778 3:43181054-43181076 GTGGAGAACATGGGGGAGGGAGG + Intergenic
953606640 3:44416978-44417000 GTGATGGGCAGGGAGCAGGATGG - Intergenic
953905411 3:46866072-46866094 GGGGTGAACAGGAGGCAGGAAGG + Intronic
954388664 3:50257799-50257821 GGGGTGAACCTGGAGGGGGAGGG + Intronic
954425068 3:50438848-50438870 GTGGGGAAAAGCAAGGAGGAAGG + Intronic
954733848 3:52688396-52688418 TTGGTGAAAAGGTGGGAGGAGGG - Intronic
954748114 3:52798490-52798512 GAGGAGAAAGGGGAGGAGGAGGG - Intronic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
956054461 3:65283917-65283939 GTGGTAAAGAGGAAGGAGGCAGG - Intergenic
956198835 3:66684146-66684168 GAGGAGGAGAGGGAGGAGGAGGG - Intergenic
956320968 3:67995835-67995857 GGGCTGAGCAGGGAGGAGGCTGG - Intergenic
957350540 3:79018359-79018381 GGGGCGAACAGGGAGGATCAAGG + Intronic
958795374 3:98701516-98701538 GTGTGGAAAAGGGAGGAAGAAGG + Intergenic
959015821 3:101132886-101132908 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
961001999 3:123380259-123380281 GTGGTGAACAGGCTTGAGTAGGG + Intronic
961110283 3:124277694-124277716 GTGGAGAACAGAATGGAGGAAGG + Intronic
961168722 3:124780778-124780800 GAGGGGAAGAGGGAGGAGGAGGG - Intronic
961372224 3:126438479-126438501 GTCATGAAGAGGGAGGAGGGAGG + Intronic
961428561 3:126864348-126864370 GTGGTGATGAAGGAGGAGGAGGG - Intronic
961722890 3:128908004-128908026 GGAGTGCACAGGGATGAGGAGGG - Intronic
961805296 3:129485004-129485026 GTGGGGACCAGGCAGGAGGGAGG - Intronic
962308478 3:134309443-134309465 GTGGTGAACTGAGAGAAGAATGG + Intergenic
962308571 3:134310203-134310225 GAAGAGAAAAGGGAGGAGGAAGG + Intergenic
962507017 3:136057484-136057506 GTGGTTAACAGAGACCAGGAAGG + Intronic
962747845 3:138410797-138410819 CTGGGGAACTGGGAGGAGAAGGG - Intergenic
962770946 3:138609323-138609345 GTCGCGAACAGGCCGGAGGAGGG - Intronic
963063490 3:141243427-141243449 TCAGTGAACAGGGTGGAGGAGGG - Intronic
963843569 3:150132334-150132356 GTGTTGGAGAGGGAGGAAGAAGG - Intergenic
963909671 3:150805526-150805548 GTGATGAACTGGGAGAAGAATGG - Intergenic
965172184 3:165279927-165279949 GAGGTGAAGAAGAAGGAGGAGGG - Intergenic
966513457 3:180790563-180790585 GGAGAGAATAGGGAGGAGGAAGG - Intronic
966863727 3:184244724-184244746 GGGGTGAGCAGGGGAGAGGAAGG + Intronic
966924439 3:184635236-184635258 GTCGGGAAGAGGGAGGAGGAGGG + Intronic
967086266 3:186097748-186097770 TTGGAGAACAGGGAGCAGCAGGG + Intronic
967206694 3:187129802-187129824 GTGGTGACCTGGGAGTAGGGAGG - Intronic
967996880 3:195173631-195173653 GTGGTGGGGAGGGTGGAGGAAGG - Intronic
968052189 3:195662811-195662833 CTGGAGCACAGGGAGGAGGCAGG - Intergenic
968549350 4:1214296-1214318 ATGGTGGACAGGGAAGAGCAGGG + Intronic
968652501 4:1765846-1765868 GTGGGGAGAAGGGAGGAGGGAGG + Intergenic
969495237 4:7522791-7522813 GGAGAGAAAAGGGAGGAGGAAGG - Intronic
969496824 4:7530990-7531012 GTGGTGGCCAGGGTGGAGGATGG + Intronic
969584101 4:8082098-8082120 GTAATGGACAGGGAGGAAGAGGG + Intronic
969704547 4:8784692-8784714 GTGCAGAACAGGGAGGGGGTGGG - Intergenic
971002693 4:22340360-22340382 GAGGAGAACGAGGAGGAGGAGGG + Intergenic
971358140 4:25913377-25913399 GTGGTGCAGAGGGCGGAGGATGG + Intronic
971631706 4:29000678-29000700 ATGGTGAAGAGGGAAGATGATGG + Intergenic
971661698 4:29426112-29426134 GAGAGGAAGAGGGAGGAGGAAGG - Intergenic
973530897 4:51835961-51835983 GTGGAGCAGTGGGAGGAGGAAGG - Intergenic
974844204 4:67331575-67331597 GTGGTGAGCAGGTGGGAGGCAGG + Intergenic
974858867 4:67495525-67495547 GTGGAAAAGAGGGATGAGGAAGG + Intronic
975104615 4:70553763-70553785 GTGGTGAACAGGAAAGACAATGG - Intergenic
975228950 4:71908177-71908199 GTGAATAAAAGGGAGGAGGAAGG + Intergenic
975740884 4:77427749-77427771 TTGGTGTCTAGGGAGGAGGAAGG + Intronic
976280948 4:83326474-83326496 GGGAGGAACAGGGAGGAGAAGGG + Intronic
976504204 4:85827679-85827701 GGAGTGTACAGGGAAGAGGAGGG - Intronic
976538982 4:86251320-86251342 GTGGTGGGGAGGGAGGAGGGGGG - Intronic
977937974 4:102827580-102827602 GCGGTGAAGAGGCAGGAGGAGGG - Intronic
978268570 4:106859061-106859083 AGGGTGAAGGGGGAGGAGGAGGG + Intergenic
978397190 4:108293998-108294020 GTGGTTTACATGGAGGTGGAAGG + Intergenic
978776949 4:112514790-112514812 TTGGAGGACACGGAGGAGGACGG + Exonic
979001074 4:115220597-115220619 GTGGAAAACAGGGATAAGGAAGG + Intergenic
979477891 4:121179809-121179831 GTGGTGGCCAGGGTGGGGGAGGG + Intronic
980963943 4:139502524-139502546 GTGGAGCACAGGAAGGAAGAGGG + Intronic
981025324 4:140071967-140071989 GTGGTGGACGTGGGGGAGGAAGG + Intronic
982324802 4:154119394-154119416 AAGGTGAGCTGGGAGGAGGAAGG + Intergenic
983117798 4:163841107-163841129 ATGGGGACCAGGGAGGAGGCAGG + Intronic
983388152 4:167092378-167092400 GAGGTGATCAGGGAGCAGGTTGG - Intronic
985822275 5:2168482-2168504 GTGGTGGACAAGGAGCAGGCAGG + Intergenic
986322261 5:6641538-6641560 GTGGTGGACAGGGGAGAGGAGGG - Intronic
986452501 5:7880648-7880670 TTGGTGTTTAGGGAGGAGGATGG + Intronic
988260613 5:28882301-28882323 GGGATGGACAGGGAGGAGCATGG + Intergenic
988457621 5:31400641-31400663 ATGGGGAGCAGGAAGGAGGAGGG - Exonic
988698665 5:33650082-33650104 CTGATGAAAAGGGAGAAGGAAGG - Intronic
988926436 5:35995223-35995245 GTGGTAGACATGGAGGAGAAGGG - Intergenic
989097235 5:37792732-37792754 GGGGTGGAGAGGGAGGAAGATGG + Intergenic
989308047 5:39980329-39980351 GTGGTAAATAGAGATGAGGAAGG - Intergenic
989728000 5:44610486-44610508 GTGGTGAATTGTGAGGAAGAGGG + Intergenic
990448002 5:55910791-55910813 TTGGTGAACAGAGAGCAGGATGG - Intronic
990545138 5:56815288-56815310 GAGGTGGACTGGGAGGCGGAGGG - Intergenic
990805460 5:59655679-59655701 GTGGAAAAGAGGGATGAGGAAGG + Intronic
990825627 5:59894193-59894215 GTGGGGAGCAGTGTGGAGGAGGG - Intronic
991198087 5:63959658-63959680 GGGGAGAGCAAGGAGGAGGAGGG - Intergenic
991398999 5:66234450-66234472 GGGGTTAGGAGGGAGGAGGAAGG - Intergenic
992431761 5:76716636-76716658 GTGTTGGATATGGAGGAGGATGG + Intronic
992644315 5:78797852-78797874 GAAAAGAACAGGGAGGAGGATGG + Intronic
992657480 5:78924523-78924545 GTTGGGAACAGGGAGAAGGTGGG - Intronic
992849904 5:80796846-80796868 GAGGTGGGCAGGGTGGAGGAGGG - Intronic
992868009 5:80977166-80977188 CAGGTAAACAGGAAGGAGGATGG - Intronic
993340376 5:86718249-86718271 ATGGGGAAGAGGGAGGAGGAAGG - Intergenic
993430438 5:87826057-87826079 GTGGCAGACAGGAAGGAGGATGG - Intergenic
993654296 5:90558751-90558773 GGGGAGAAAGGGGAGGAGGATGG + Intronic
994182278 5:96780787-96780809 GGGCTGAACTGTGAGGAGGAAGG + Intronic
995069668 5:107904925-107904947 GGGGTGAAGCAGGAGGAGGAGGG + Intronic
995570666 5:113477658-113477680 GTGGTGCAGAGGGAAGAGGAAGG + Intronic
995682620 5:114737397-114737419 GTAGTGCACAGGAAGGTGGAAGG - Intergenic
995907168 5:117139242-117139264 TTGGTGAACATGGAAGAGGAAGG + Intergenic
997677303 5:135722505-135722527 ATGGTGAACAGGCAGGAACATGG + Intergenic
997879107 5:137573924-137573946 GTGATGAACTGGGAGCAGGCTGG - Intronic
998011631 5:138699886-138699908 GTGGAGAACAGCCAGGAGAAAGG + Intronic
998400005 5:141843675-141843697 GTGGTGAAAAGGGGGAAAGAGGG - Intergenic
998511842 5:142720332-142720354 GTGGCGATAAGGCAGGAGGAAGG + Intergenic
999429153 5:151511093-151511115 CTGGAGAACAGGGAGGAGGCTGG + Intronic
999767069 5:154749388-154749410 GGGGTGGTCAAGGAGGAGGACGG - Intronic
1000444866 5:161307119-161307141 GTGGTGAGGAAGGAGGAAGAAGG - Intronic
1001310063 5:170604102-170604124 GTGGGAACCAGGGAAGAGGAGGG + Intronic
1001545982 5:172570805-172570827 GAGGGGAAAAGGAAGGAGGAAGG + Intergenic
1001594807 5:172891341-172891363 ATGGAGAAGAGGGAAGAGGATGG - Intronic
1001938787 5:175726815-175726837 GTGGAAGACAGGGAGGAGGGAGG + Intergenic
1002458450 5:179359785-179359807 GAGGTGACCAAGGAGAAGGATGG - Intergenic
1003148740 6:3530976-3530998 TTGGTGAAGAGGCAGGAGTATGG + Intergenic
1003417837 6:5928801-5928823 GTGGAGAACAGGGAACAGAAGGG - Intergenic
1003442414 6:6155437-6155459 GTGGGGAGCAGGGAGAAGGATGG + Intronic
1003508554 6:6760092-6760114 ATGATGAGCAGTGAGGAGGAGGG - Intergenic
1003551299 6:7104473-7104495 GTGGGAGACAGGGAGGGGGAAGG + Intergenic
1004178925 6:13364630-13364652 GTGGGGATCAGGGAGGTGGAGGG - Exonic
1004188644 6:13445152-13445174 AGGCTGAACAGGGAGGAGGGAGG + Intronic
1004204029 6:13574777-13574799 CTGGAGACCAGGGAGGGGGATGG + Intronic
1004233330 6:13852048-13852070 GTGGAGGGCAGGGAAGAGGAGGG - Intergenic
1004266431 6:14152007-14152029 GAGGAGAAGGGGGAGGAGGAGGG - Intergenic
1004561071 6:16751439-16751461 GTGGGGGACAAGGTGGAGGAGGG - Intronic
1004607263 6:17206398-17206420 GAGGGGAGCAGGGAGGAGGGGGG + Intergenic
1004722022 6:18276027-18276049 GAGGTGAAGAGGGAGGAGGGAGG - Intergenic
1004732345 6:18370138-18370160 GTGGGGAAAAGTGAGTAGGAGGG + Intergenic
1005887679 6:30109178-30109200 GTGGGGAGAGGGGAGGAGGATGG - Intronic
1005960666 6:30690802-30690824 AGGATGAACTGGGAGGAGGAAGG - Intronic
1006174267 6:32112481-32112503 GTGGGGAGAAGGGAGGAGGAAGG + Intronic
1006202734 6:32311110-32311132 GTAGTGAGCAGGGAGAAAGAAGG - Intronic
1007070864 6:39037346-39037368 GAGGGGGAGAGGGAGGAGGAGGG - Intergenic
1007287109 6:40755567-40755589 CAGGTGAAGGGGGAGGAGGAGGG - Intergenic
1007468489 6:42072394-42072416 GTGGGTAACAGGGAACAGGATGG - Intronic
1007515327 6:42406281-42406303 GAGATGAAGAGGGAAGAGGAAGG - Intronic
1007594804 6:43044889-43044911 GGGGTGAGAATGGAGGAGGAAGG + Intronic
1007645873 6:43380643-43380665 GTGGATAACAGGCAGTAGGAGGG - Intergenic
1008063879 6:47026891-47026913 GTGGGGAACAGGGAAAAGGATGG + Intronic
1008619507 6:53258149-53258171 GTGGTGAGCAAGGAAGAGGATGG + Intergenic
1008848843 6:55999353-55999375 TTGGAGCACAGGGAGGAGGGAGG + Intergenic
1008863258 6:56176978-56177000 GGGAGGAAGAGGGAGGAGGAAGG + Intronic
1009192961 6:60651704-60651726 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1010019116 6:71139283-71139305 GTGGTGATCAGGCAGGGGCACGG - Intergenic
1010153333 6:72762301-72762323 GAGGTGAAAAGGGAGGAGGGAGG + Intronic
1011361322 6:86527949-86527971 GTGGAGTAGAGGGAGGGGGAGGG - Intergenic
1012826799 6:104156430-104156452 GTGGGGAGTAGGGAGGGGGAGGG - Intergenic
1013178417 6:107697774-107697796 GTGGTTTAGAGGGAGGAGAAAGG - Intergenic
1014158282 6:118137477-118137499 GGGGTGAACTGGGAGTAGGAGGG - Intronic
1014529001 6:122537308-122537330 GTGGGGTGCAGGGAGGGGGAGGG - Intronic
1014992261 6:128095492-128095514 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1015178191 6:130334227-130334249 GTGGTGGGAAGAGAGGAGGAGGG + Intronic
1015226760 6:130865846-130865868 GTGGAGAAAAGAGAGGAGAATGG + Intronic
1015389699 6:132667762-132667784 GGGATGAACAGGAAAGAGGAAGG - Intergenic
1015503033 6:133953032-133953054 TTGGGGACCAGGAAGGAGGAAGG + Intronic
1016099952 6:140086853-140086875 TTGATTAACAGGGAGGAGGTTGG + Intergenic
1016582321 6:145642794-145642816 GTGGTGAACAAGGAAGAATATGG + Intronic
1016958971 6:149653522-149653544 CTGGTGAAAAGAGAGGGGGAGGG - Intergenic
1017570754 6:155741999-155742021 GGGGTGAAGAGGGATGAGAATGG - Intergenic
1018020946 6:159761955-159761977 GTGGTGCGCGGGGAGGTGGAGGG + Exonic
1018380495 6:163254309-163254331 CTGATGAAGGGGGAGGAGGATGG + Intronic
1018534941 6:164809870-164809892 TTGGGGAACAGGTAGGTGGATGG - Intergenic
1019146167 6:169976793-169976815 AGTGTGACCAGGGAGGAGGAGGG - Intergenic
1019494936 7:1333395-1333417 GAGGAGAAGGGGGAGGAGGAGGG - Intergenic
1019666128 7:2253033-2253055 GGGGTGAGGAGGGAGCAGGAGGG - Exonic
1020207614 7:6131044-6131066 GGGGTGCACAGGCAGGTGGATGG + Intronic
1020279353 7:6642563-6642585 GTGGTGGAGGAGGAGGAGGAGGG + Exonic
1020870617 7:13624735-13624757 ATGATGAACAGTGAGGAGCAAGG + Intergenic
1021510139 7:21426180-21426202 TTGGTGAACTGGGAGGAGGAGGG + Intergenic
1021813317 7:24424556-24424578 GTGGTGATCATGGAAGAGGAGGG + Intergenic
1021879664 7:25082438-25082460 AAGGTGAAGAGGGAGGAGGCAGG + Intergenic
1022325418 7:29326535-29326557 CTGGTGAACAGGGACAAGGGAGG - Intronic
1022374047 7:29796945-29796967 GTGGAGAAGAGTTAGGAGGAGGG + Intergenic
1022658155 7:32340158-32340180 GAGGGGATCAGGGAGCAGGATGG + Intergenic
1023093077 7:36634042-36634064 ATGGGAAACAGGGCGGAGGAGGG + Intronic
1023367175 7:39475508-39475530 GTGCTGAGAAGGGAAGAGGAAGG + Intronic
1023754335 7:43402064-43402086 GTGGTGAGCTGGAAAGAGGATGG - Intronic
1023809671 7:43902115-43902137 GAGGAGGAGAGGGAGGAGGAGGG + Intronic
1023809687 7:43902159-43902181 ATGGTGGAGAGGGAGGAGGAGGG + Intronic
1024297506 7:47857137-47857159 CTGGTGAGCAGGGAGGATGGGGG + Intronic
1024324629 7:48099467-48099489 GGGGTTAAGAGGGAGGAGAAGGG + Intronic
1024806511 7:53147815-53147837 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1025111859 7:56223807-56223829 GTAGTGAAGAGGGAGAAGGTAGG - Intergenic
1025995331 7:66524083-66524105 TTGGTGGACATGGAGGTGGATGG - Intergenic
1026525512 7:71150109-71150131 ATGGTGAACAGGAATGAGAAGGG - Intronic
1027229980 7:76267129-76267151 ATGGTGAAAAGGCAGGTGGAGGG + Intronic
1027814704 7:82953695-82953717 GTGGTGGAGGAGGAGGAGGAGGG + Exonic
1027993800 7:85397682-85397704 TGGGTGTGCAGGGAGGAGGAGGG - Intergenic
1028285177 7:88987901-88987923 GGGAAGAAAAGGGAGGAGGAGGG - Intronic
1028300348 7:89192258-89192280 GGGGTGAAAAGAGAGAAGGAAGG - Intronic
1028384952 7:90244451-90244473 GACGTGAAAAGGGAGGAGGTAGG + Intergenic
1028898511 7:96069073-96069095 AGGGTGTACAGGGATGAGGATGG - Intronic
1028987272 7:97018275-97018297 CCGGTGAATAGGGATGAGGAAGG + Intergenic
1029067977 7:97871801-97871823 GGGGTGAGAGGGGAGGAGGAGGG + Exonic
1029147394 7:98456570-98456592 GAGGGGCTCAGGGAGGAGGAGGG + Intergenic
1029173439 7:98646783-98646805 GTGGTCAGCCTGGAGGAGGAGGG - Intergenic
1029192965 7:98784880-98784902 GGGGTGGCCAGGGATGAGGAGGG + Intergenic
1029293817 7:99523250-99523272 CTGGGGTACAGGAAGGAGGAAGG + Intronic
1029600057 7:101558181-101558203 GTGGGGAAGGGGGATGAGGAAGG - Exonic
1029637363 7:101793944-101793966 CTGGGGAGCAGGGAGGAGGGAGG + Intergenic
1031693444 7:124818730-124818752 GTGGGGAACTGGAAGGGGGATGG - Intergenic
1031837625 7:126697213-126697235 GTGGTTATCAGGGACAAGGAGGG + Intronic
1031959488 7:127976023-127976045 AAGGAGAACAGGGTGGAGGAGGG - Intronic
1032095236 7:128935001-128935023 GTGGGGAGCAGGGGGGAGGAGGG - Intergenic
1032142267 7:129342770-129342792 GTGGTGAACAGAGGTGAGTAGGG - Intronic
1032335057 7:131017478-131017500 GTTGAGAACAGGGAGGAAGGCGG - Intergenic
1033148039 7:138887958-138887980 AAGGAGAACAGGGAAGAGGACGG + Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1033807488 7:144971378-144971400 GTGGTGATGGAGGAGGAGGATGG + Intergenic
1033838734 7:145347831-145347853 GTGGGGTAGAGGGAGGGGGAGGG - Intergenic
1034119280 7:148611984-148612006 GTGGTGGACAGGGAGGGAGCAGG - Intronic
1034276683 7:149826841-149826863 GTGGGGAGCAGGGATGAGGAAGG + Intergenic
1034820717 7:154213923-154213945 CTGGTGAGCAGGGAGGAGAGTGG - Intronic
1034850492 7:154488852-154488874 GTGATGCACAGGATGGAGGATGG - Intronic
1034919962 7:155071491-155071513 GTGGAGAACACGGCGTAGGAAGG - Exonic
1035018935 7:155789009-155789031 GTGGCAAGCAGGGAGAAGGACGG - Intergenic
1035062039 7:156076427-156076449 GTGGTAAGCAGGGAGGTGGTGGG + Intergenic
1035280841 7:157776907-157776929 GAGGAGAAGAGCGAGGAGGAGGG - Intronic
1035746895 8:1967481-1967503 GGGGTGCCCAGGGAGGAGGGGGG - Intergenic
1036213333 8:6860239-6860261 GAGGTGGACAGGGAGGAGCAGGG + Intergenic
1036553597 8:9837696-9837718 GTTTTGAAGATGGAGGAGGAAGG - Intergenic
1036665389 8:10734059-10734081 GAGGAGAAGAGGGAGGAAGAGGG + Intronic
1036698232 8:10993399-10993421 CTGGTGAGGAGGGAGGAGGCGGG + Intronic
1037098032 8:15008739-15008761 GAGGGGAAGAGGGGGGAGGAGGG + Intronic
1037178352 8:15973622-15973644 GGGGAGGAGAGGGAGGAGGAAGG + Intergenic
1037846258 8:22285255-22285277 ATTGTGAACAGAGAGTAGGAAGG - Intronic
1037864914 8:22435920-22435942 GATGTGAACAGCAAGGAGGAAGG - Intergenic
1038017631 8:23528948-23528970 GAGGTGGGCAGGGAGGGGGAGGG - Exonic
1038040730 8:23722239-23722261 GTGGGGGAGAGGGAGGAGGATGG + Intergenic
1038238385 8:25784452-25784474 GTGGTGATGGAGGAGGAGGAAGG - Intergenic
1038420261 8:27430058-27430080 GTGGTGGAGAGGGAGGCTGAAGG - Intronic
1038517610 8:28200604-28200626 GTGGGAAGCGGGGAGGAGGAGGG - Intergenic
1038664555 8:29526900-29526922 CAGGTGAAGAGGGAGGAAGAGGG - Intergenic
1039112264 8:34052834-34052856 GAGGGGGAGAGGGAGGAGGAGGG + Intergenic
1039475736 8:37838594-37838616 GGGGTGACCAGGAAGGAGAAGGG - Intronic
1039821082 8:41136121-41136143 GGGGTGGGCAGGGAGGAGGAAGG + Intergenic
1040443900 8:47473804-47473826 GTGAGGAACCAGGAGGAGGATGG + Intronic
1040899912 8:52407859-52407881 GGGGTGGAAATGGAGGAGGATGG - Intronic
1041005388 8:53492788-53492810 GTGGTGATGAGGGAGGCGGGAGG + Intergenic
1041111748 8:54489415-54489437 GTTCTGAACAGGAAGAAGGAAGG + Intergenic
1042568216 8:70134114-70134136 GTGGAGAAGAAGCAGGAGGAAGG - Intronic
1043052080 8:75396739-75396761 GTGGTGAGAAGGAAAGAGGAGGG - Intergenic
1043181815 8:77094283-77094305 GTGGTGTGCGGGGAGGGGGAGGG + Intergenic
1043517939 8:81013517-81013539 GTGGTAAACAGGGAGGACCTGGG - Intronic
1045352233 8:101352501-101352523 CTGGTGAGCAGGGAGGTGGCGGG - Intergenic
1045860668 8:106812063-106812085 GTAGAGAACAGAGAGGATGATGG + Intergenic
1046102979 8:109635777-109635799 GTGTTGGACAGGGAGGGGGCAGG - Intronic
1046578205 8:116058363-116058385 GAGGAGAATAGGCAGGAGGAAGG - Intergenic
1046708313 8:117480131-117480153 GTGGTGAAGGGGGAGGTGGGAGG + Intergenic
1046802053 8:118439310-118439332 GTGGTCAACAGGGAAATGGATGG + Intronic
1047009066 8:120651532-120651554 GTGGTGAAAAGAGATGAGAATGG + Intronic
1047203598 8:122785834-122785856 GGGGTGCACATGGAGGAGGCTGG + Intronic
1047572264 8:126111867-126111889 ATGGGCAAGAGGGAGGAGGAAGG - Intergenic
1047814877 8:128452542-128452564 GGGGAGAACATGGAGGAGGTGGG - Intergenic
1047852836 8:128877560-128877582 GTGGAGGAGAGGCAGGAGGAGGG + Intergenic
1048180669 8:132191742-132191764 GAGCTGACCAGAGAGGAGGAGGG + Intronic
1048262772 8:132959654-132959676 GTGGTGATTAGGAAGGAGTATGG + Intronic
1048865247 8:138755925-138755947 GTGGTGCACAGGGAGGGGTGTGG - Intronic
1049230675 8:141479644-141479666 GTGTTTAAGAAGGAGGAGGAGGG + Intergenic
1049243495 8:141550281-141550303 CAGGTGAGCAGGGAGGAGGATGG + Intergenic
1049356811 8:142193098-142193120 GGGGAGAGCAGGGAGGAGGAAGG + Intergenic
1049425694 8:142537011-142537033 GTGGTTGACCGGCAGGAGGAGGG + Exonic
1049674039 8:143881873-143881895 GAGGAGAAGGGGGAGGAGGAGGG + Intergenic
1049745227 8:144260451-144260473 GTGGGAGACAGGGAGGAGGGTGG - Intronic
1049765011 8:144351118-144351140 GAGGGGAACAGAGAGGAGCAAGG - Intergenic
1049832465 8:144710778-144710800 TTGGGGAAGAGGGATGAGGAAGG + Intergenic
1050022183 9:1295668-1295690 GTGATAAACAGAGAGAAGGATGG + Intergenic
1050421653 9:5471954-5471976 GTGGGGTACGGGGAGGAGGGAGG - Intergenic
1050874346 9:10615412-10615434 GTGGGGAGGAGGTAGGAGGAAGG - Intergenic
1051136863 9:13932638-13932660 GTGGTGGAGAGGGAGGATGAGGG + Intergenic
1051595170 9:18817963-18817985 GAGGTCAACAGGGACCAGGAAGG + Intronic
1051628278 9:19119061-19119083 GTTGGCAACAGGGAAGAGGAAGG - Intronic
1052223315 9:26054197-26054219 ATGGTGAAGATGGAGGTGGAGGG - Intergenic
1052820169 9:33132213-33132235 GTTGTGAAGTGGGAAGAGGAGGG + Intronic
1054723161 9:68623788-68623810 GTGGAGAAGGGGGAAGAGGAAGG + Intergenic
1054901158 9:70370779-70370801 GAGGGGAAAGGGGAGGAGGAGGG + Intergenic
1055096618 9:72420899-72420921 GTGCTGGAAAGGCAGGAGGAAGG + Intergenic
1055581454 9:77711079-77711101 AAGGGGGACAGGGAGGAGGAGGG - Intergenic
1055592516 9:77832428-77832450 GTGGTGCACTTGGAAGAGGATGG + Intronic
1055720789 9:79171881-79171903 GTGGAGTGGAGGGAGGAGGATGG + Intergenic
1055954781 9:81763459-81763481 GTGGGGAAGAGGGGGCAGGAAGG + Intergenic
1056243206 9:84669569-84669591 GGGGCGAGCAGGGAGGAGGGAGG - Intronic
1056411327 9:86330348-86330370 GTGGTGAACAGGGCCGGGCATGG - Intronic
1056701759 9:88917120-88917142 GTGGAAAAGAGGGACGAGGAAGG - Intergenic
1056719089 9:89058214-89058236 GTGGAGGACATGGTGGAGGATGG + Intronic
1056719113 9:89058315-89058337 GTGGAGGACATGGTGGAGGACGG + Intronic
1056719332 9:89059285-89059307 GTGGAGGACATGGTGGAGGACGG + Intronic
1056719432 9:89059696-89059718 GTGGAGGACATGGTGGAGGATGG + Intronic
1056719496 9:89059984-89060006 GTGGTGGACATGGTGGAGGATGG + Intronic
1057497998 9:95575304-95575326 GAGGAGAAGAGGGAGGAAGAAGG + Intergenic
1058424839 9:104867223-104867245 GTGGGGAACAGGAGAGAGGAAGG + Intronic
1058788518 9:108416809-108416831 GTGATGAAGAAGGAGAAGGAAGG - Intergenic
1059111170 9:111559558-111559580 CTGGTGAGCAGGAAGAAGGAGGG - Intronic
1059354246 9:113687123-113687145 GGAGGGAAGAGGGAGGAGGAAGG + Intergenic
1059354291 9:113687288-113687310 GGAGGGAAGAGGGAGGAGGAAGG + Intergenic
1059354319 9:113687392-113687414 GCAGAGAGCAGGGAGGAGGATGG + Intergenic
1060056479 9:120418320-120418342 GTGGTGGACAGGGCGAAGGGTGG + Intronic
1060085470 9:120696003-120696025 GTGGCAAACAGGGAGATGGATGG + Intronic
1060197195 9:121631439-121631461 GTGGTGCCCAGGGAGGAGCAGGG + Intronic
1061208397 9:129177244-129177266 GTGGTGACCACGGTGGAGAACGG - Exonic
1061246144 9:129402114-129402136 GTGGGGAGGAGGGAGGAGGGAGG - Intergenic
1061246152 9:129402132-129402154 TTGGGGAGCAGGGAGGAGGTGGG - Intergenic
1061280927 9:129597372-129597394 GGGGAGAGCGGGGAGGAGGAGGG - Intergenic
1061707726 9:132465912-132465934 GTGATGAACTGACAGGAGGAAGG + Intronic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1061842104 9:133364762-133364784 GGGGTGAGCAGGGAGGGGGTGGG + Intronic
1062530748 9:136998545-136998567 GTTGTGTCCAGGGAGAAGGACGG + Intergenic
1203793978 EBV:166390-166412 GTGGAGAGTAGGGAGGGGGAGGG - Intergenic
1203470166 Un_GL000220v1:112640-112662 GTGGTGGTGGGGGAGGAGGAAGG + Intergenic
1203471841 Un_GL000220v1:118594-118616 GCGGTGAACGGGGAGGAGGCGGG - Intergenic
1203477987 Un_GL000220v1:156612-156634 GTGGTGGTGGGGGAGGAGGAAGG + Intergenic
1185499333 X:585095-585117 GTGGAGAAGGGGGAGGAGGAGGG + Intergenic
1185774126 X:2788508-2788530 GTGATGGACAGGGAACAGGAGGG + Intronic
1186424052 X:9449457-9449479 CTGGTGAAGAGGGAGGGAGAGGG + Intergenic
1186608048 X:11111684-11111706 GTGGTGACCCGGGTGGAGGAGGG - Intronic
1187266872 X:17741735-17741757 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1189083082 X:37994760-37994782 GAGGAGAAGAAGGAGGAGGAAGG + Intronic
1189268663 X:39735493-39735515 CTGGGGAAGAGGGAGGGGGAGGG + Intergenic
1189684721 X:43551971-43551993 GTGGAAAACAGAGAGGAGGCAGG - Intergenic
1190066632 X:47245866-47245888 GTGTGGAGGAGGGAGGAGGAAGG - Intronic
1190093989 X:47464181-47464203 GTGGTGATCACTGAGGAGCAGGG - Intronic
1190154090 X:47973655-47973677 GTGGTGAACAGGGAAGAGTAGGG - Intronic
1190332497 X:49244493-49244515 GAGGTGGACAGAGAGGAAGAAGG - Intronic
1190332578 X:49244977-49244999 GAGGTGGACAGAGAGAAGGAGGG - Intronic
1190332615 X:49245166-49245188 GAGGTGGACAGAGAGGAAGAGGG - Intronic
1190633345 X:52410974-52410996 CTGGGAAACAGGGAGGTGGATGG - Intergenic
1190873790 X:54445779-54445801 GTGGGGAACTGGGTGGAGGCAGG + Exonic
1191049041 X:56171514-56171536 GTGGGGTTCAGGGAGGGGGAGGG - Intergenic
1191836619 X:65470205-65470227 GTGGAGAAAAAGGAGGTGGAGGG + Intronic
1191987426 X:66997391-66997413 GTGGGGTGCAGGGAGGGGGAAGG - Intergenic
1192195932 X:69028160-69028182 GTGGTGTAGAGGAAGGAGAAAGG + Intergenic
1192264403 X:69529179-69529201 CTGGGGAAGAGGGAGGAGGCCGG + Intronic
1192326050 X:70133353-70133375 GGGGTGAAGGGGGAAGAGGACGG + Intergenic
1192591207 X:72360967-72360989 CTTGTGAGCAGGCAGGAGGATGG + Intronic
1192756967 X:74056523-74056545 GAGGAATACAGGGAGGAGGAAGG - Intergenic
1197448541 X:126581259-126581281 GCGGTGAACGGGGAGGAGGCGGG + Intergenic
1197808290 X:130417701-130417723 GTGGAGGACAGAGAGAAGGAAGG + Intergenic
1197997395 X:132392739-132392761 ATGGTGAAGAGGAAAGAGGAAGG - Intronic
1198139501 X:133788686-133788708 GAGGAGGAGAGGGAGGAGGAGGG - Intronic
1198659665 X:138954396-138954418 GTGTTGAACAGGGATGAAAATGG - Intronic
1199472707 X:148212393-148212415 GTGGGGAAGAGAGAGGAGAAGGG - Intergenic
1199656432 X:149999616-149999638 GTGCTGAACAGGTCAGAGGAAGG - Intergenic
1199995397 X:153021598-153021620 GTGGTGAACAGGAGGGAGGAGGG - Intergenic
1200326553 X:155246723-155246745 GTGGTGGTCAGGGAGCAGAATGG - Intergenic
1200367634 X:155684151-155684173 GGGGTTGACAGGGAAGAGGAAGG + Intergenic
1200815792 Y:7531084-7531106 GTGTTGCAGAGAGAGGAGGATGG + Intergenic
1201295638 Y:12460889-12460911 GTGGTGGACAGGGAACAGGAGGG - Intergenic
1201529753 Y:14978867-14978889 GAGTTGAACAGGGAGGTGGTGGG + Intergenic
1201794741 Y:17882837-17882859 GTGGTCTTCAAGGAGGAGGAAGG - Intergenic
1201806814 Y:18023148-18023170 GTGGTCTTCAAGGAGGAGGAAGG + Intergenic
1201892149 Y:18954278-18954300 AGGGTGAACAGGAAGAAGGATGG + Intergenic
1201945435 Y:19505057-19505079 GTGGGGAACAGGGGTGAAGAAGG + Intergenic
1202356116 Y:24050616-24050638 GTGGTCTTCAAGGAGGAGGAAGG - Intergenic
1202514662 Y:25619493-25619515 GTGGTCTTCAAGGAGGAGGAAGG + Intergenic