ID: 1144959353

View in Genome Browser
Species Human (GRCh38)
Location 17:19036129-19036151
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1898
Summary {0: 2, 1: 0, 2: 24, 3: 277, 4: 1595}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144959353_1144959364 -1 Left 1144959353 17:19036129-19036151 CCAGCCTCCCACCCCGTGCCAGG 0: 2
1: 0
2: 24
3: 277
4: 1595
Right 1144959364 17:19036151-19036173 GTGTTCAAGGTCTGAGACAAGGG 0: 2
1: 0
2: 2
3: 7
4: 149
1144959353_1144959365 28 Left 1144959353 17:19036129-19036151 CCAGCCTCCCACCCCGTGCCAGG 0: 2
1: 0
2: 24
3: 277
4: 1595
Right 1144959365 17:19036180-19036202 GATTGCACCCATTTTACAGATGG 0: 2
1: 1
2: 22
3: 134
4: 817
1144959353_1144959366 29 Left 1144959353 17:19036129-19036151 CCAGCCTCCCACCCCGTGCCAGG 0: 2
1: 0
2: 24
3: 277
4: 1595
Right 1144959366 17:19036181-19036203 ATTGCACCCATTTTACAGATGGG 0: 2
1: 8
2: 70
3: 452
4: 1560
1144959353_1144959363 -2 Left 1144959353 17:19036129-19036151 CCAGCCTCCCACCCCGTGCCAGG 0: 2
1: 0
2: 24
3: 277
4: 1595
Right 1144959363 17:19036150-19036172 GGTGTTCAAGGTCTGAGACAAGG 0: 2
1: 0
2: 2
3: 8
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144959353 Original CRISPR CCTGGCACGGGGTGGGAGGC TGG (reversed) Intronic
900004176 1:33674-33696 CCTGTCAGTGGGTGGGGGGCTGG - Intergenic
900023903 1:204190-204212 CCTGTCAGTGGGTGGGGGGCTGG - Intergenic
900084344 1:882827-882849 CCTGTCATGGGGTGAGAGGCTGG - Intergenic
900096945 1:943676-943698 CCTGGAAGGGGGAGGGAGGGAGG - Exonic
900381367 1:2385653-2385675 CTTGGCACTGGGGGGGTGGCGGG + Intronic
900746540 1:4364674-4364696 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
901059693 1:6466220-6466242 CCTGGCGGGCGGGGGGAGGCGGG + Exonic
901196827 1:7445034-7445056 CCTAGCACGGGGTAGGAGGTGGG + Intronic
901324951 1:8360436-8360458 CCTGTAGGGGGGTGGGAGGCAGG + Exonic
901657645 1:10779485-10779507 CCTGGCAAGGGGGAGGGGGCGGG - Intronic
901682313 1:10920312-10920334 CCTGGGACAGGCAGGGAGGCAGG + Intergenic
901875971 1:12167266-12167288 GCTGTCACGGGCTGGGAGGCTGG + Intronic
902049904 1:13554998-13555020 CCGGGCACGGGGCGGGAGGCGGG - Intergenic
902136951 1:14315554-14315576 CCTGGGCTGGGATGGGAGGCTGG - Intergenic
902612089 1:17603306-17603328 CCTTGGAGGGGGTGGGGGGCGGG + Intronic
902671789 1:17979718-17979740 GGTGGCACGGAGTGGGTGGCTGG + Intergenic
902690779 1:18109128-18109150 GGCGGCACTGGGTGGGAGGCCGG - Intronic
902966412 1:20007600-20007622 CCTGTCATGGGTTGGGGGGCAGG + Intergenic
903071061 1:20727182-20727204 CCTGGCAGGGGGTGGGGCCCTGG + Intronic
903180632 1:21603284-21603306 GCTGGCACGGGGTGGGACTTGGG - Intronic
903216413 1:21845953-21845975 CCTGGGACCGTGTGGGTGGCGGG + Intronic
903217217 1:21850029-21850051 CCCGGCACCAGGTAGGAGGCAGG - Exonic
903907362 1:26696330-26696352 CCCGGGGCGGGGTGGGAGGGGGG + Exonic
903996493 1:27308089-27308111 GCAGGCAGGGGGTGGGAAGCAGG - Exonic
904300338 1:29549872-29549894 CCTGGCACAGGGTTGGTGTCTGG + Intergenic
904368928 1:30036153-30036175 CATGGCACTGGGTGGGAAGCAGG - Intergenic
904494526 1:30879151-30879173 AGTGGCAGGGGGTGAGAGGCTGG - Intronic
904840395 1:33368535-33368557 CCTGGGCGGGGGTGGGGGGCCGG + Exonic
905075654 1:35268808-35268830 CCGGGGACGGGGTGGGGGCCGGG - Intergenic
905111641 1:35599190-35599212 CCAGGCTCGGGGTGGGAGGGGGG - Intergenic
905309984 1:37042536-37042558 CGGGGCAGGGGGTGGGGGGCTGG + Intergenic
905391642 1:37639525-37639547 GCTGGGACGGAGTGAGAGGCTGG - Intergenic
905627310 1:39497746-39497768 CCTGCCACGGGGTGGGGGGCAGG - Intronic
905836807 1:41131701-41131723 CCTGCTGGGGGGTGGGAGGCTGG - Intronic
905908079 1:41633076-41633098 CCTGCCACGGAGGGGGAGACTGG - Intronic
906411820 1:45584643-45584665 CCTTGCACGAGGAAGGAGGCTGG + Intronic
906549763 1:46654688-46654710 CCTGTCAGGGGGTGGAGGGCTGG - Intronic
906756615 1:48323411-48323433 CCTGTCGAGGGGTGGGGGGCTGG + Intronic
906939162 1:50240646-50240668 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
907016774 1:51023227-51023249 CCTGTCATGGGGTGGGGGGATGG - Intergenic
907247619 1:53118021-53118043 CCTGGCACTCCGGGGGAGGCTGG - Intronic
907384697 1:54118430-54118452 CCTGTTACAGAGTGGGAGGCAGG - Intergenic
907860254 1:58345884-58345906 CCCAGGACGGGGAGGGAGGCAGG - Intronic
907884127 1:58577347-58577369 CGTGGGACGGGGAGGGGGGCGGG - Exonic
908069271 1:60440526-60440548 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
908102252 1:60803666-60803688 CCTGTCGTGGGGTGGGGGGCAGG - Intergenic
908504498 1:64782878-64782900 CCTGTCGCGGGGTAGGGGGCTGG - Intronic
908732757 1:67243457-67243479 CCTGTCAAGGGGTAGGAGGCTGG - Intronic
908821133 1:68087744-68087766 CCTGTCATGGGGTGGGGGGATGG - Intergenic
908895713 1:68896045-68896067 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
909087609 1:71186355-71186377 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
909129750 1:71719774-71719796 CCTGCCAGGGGGTGGGGGCCTGG - Intronic
909228428 1:73056271-73056293 CCTGTCATGGGGTGGGGAGCTGG - Intergenic
909260735 1:73486442-73486464 CCTCTCAGGGGGTGGGGGGCTGG - Intergenic
909683220 1:78316012-78316034 CCTGTCACGGGGTGGGGGGTTGG + Intronic
909684928 1:78337141-78337163 CCTGGCAGGAGGTGAGGGGCTGG + Intronic
909698051 1:78489696-78489718 CCTGTTAGGGGGTGGGGGGCAGG + Intronic
910090015 1:83451232-83451254 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
910319386 1:85926660-85926682 CCTGTCATGGGGTGAGGGGCAGG + Intronic
910587097 1:88891939-88891961 CCTGACGCGGGGTGGGGGGCTGG - Intronic
910600649 1:89028667-89028689 CCTGTCGTGGGGTGGGGGGCAGG - Intergenic
910660157 1:89662970-89662992 CCTGTCAGGGGATGGGAGGCTGG - Intronic
910829729 1:91448146-91448168 CCTGTCATGGGGTGGGGGACTGG + Intergenic
910942356 1:92550340-92550362 CCTGTCATGGGGTGGGGGGAGGG + Intronic
910957398 1:92721520-92721542 CCTGTCAAGGGGTGGAGGGCTGG + Intronic
911017106 1:93345634-93345656 TCTGGGAAGGGGTGGGTGGCTGG - Intergenic
911028910 1:93465351-93465373 CCTGTTGGGGGGTGGGAGGCTGG - Intronic
911079153 1:93910881-93910903 CCTGTCATGGGGTGGGGGGTTGG - Intergenic
911212643 1:95158656-95158678 CCTGTCATGGGGTGGGGGGAGGG - Intronic
911392662 1:97266677-97266699 CCTGTCATGAGGTGGGGGGCAGG - Intronic
911400101 1:97363795-97363817 CCTGTCATGGGGTGGGGAGCAGG + Intronic
911433631 1:97825614-97825636 CCTGTCATGGGGTGGGGGGAGGG + Intronic
911649908 1:100376145-100376167 CCTGTCATGGGGTGGGGGGATGG + Intronic
911664655 1:100539305-100539327 CCTGCTACGGGGTGGGCTGCTGG + Exonic
911686008 1:100778464-100778486 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
911725537 1:101237982-101238004 CCTGGCTTGGGGTGGGGGGTGGG + Intronic
911991229 1:104699119-104699141 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
912126511 1:106545756-106545778 CCTGTCATGGGGTGGGGGGATGG - Intergenic
912464491 1:109861974-109861996 CCTGTCATGGGGTGGGGTGCAGG + Intergenic
912508407 1:110172235-110172257 GCAGGCACTGAGTGGGAGGCAGG + Intronic
912583617 1:110741790-110741812 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
912594515 1:110860642-110860664 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
912600775 1:110931132-110931154 CCTGTCAGGGGTTGGGGGGCTGG - Intergenic
912632672 1:111259803-111259825 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
912683080 1:111741067-111741089 CATGGCGCGGGGAGGGAGGAGGG + Intronic
912713175 1:111964126-111964148 CCTGGCCCTGGCTGGGAGCCTGG - Intronic
912750899 1:112286554-112286576 CCTGTCATGGGGTGGGGGGTTGG + Intergenic
912846281 1:113077883-113077905 CCTGTCATGGGGTGGGGGGAGGG - Intronic
913029709 1:114888852-114888874 CCTGTTGCGGGGTGGGGGGCTGG - Intronic
913053109 1:115134094-115134116 CCTGGCTCAGAGTGGGAAGCAGG + Intergenic
913102159 1:115578380-115578402 CCTATCATGGGGTGGGGGGCTGG - Intergenic
913289825 1:117261847-117261869 CCTGTCGTGGGGTGGGGGGCTGG - Intergenic
913649925 1:120903531-120903553 CTTGTCAGGGGGTGGGGGGCTGG + Intergenic
913962385 1:143350410-143350432 CCTGTCATGGGGTGGGGGGAAGG + Intergenic
914056740 1:144175986-144176008 CCTGTCATGGGGTGGGGGGAAGG + Intergenic
914076756 1:144359980-144360002 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
914102422 1:144606517-144606539 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
914122406 1:144790376-144790398 CCTGTCATGGGGTGGGGGGAAGG - Intergenic
914171203 1:145225556-145225578 CCTTTCAGGGGGTGGGGGGCTGG - Intergenic
914296474 1:146330681-146330703 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
914526312 1:148469529-148469551 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
914640088 1:149597588-149597610 CCTGTCAGGGGGTGGGGGGTTGG + Intergenic
914772573 1:150702737-150702759 CCTGTCAGGGGGTTGGAGGGAGG + Intronic
914977738 1:152381111-152381133 GCAGCCACGAGGTGGGAGGCGGG - Intergenic
915076796 1:153314388-153314410 CCTGTCAGGGGGTTGGGGGCTGG - Intergenic
915310488 1:155003836-155003858 CTTGGGATGGGGTGGGAGGAGGG - Intronic
915453141 1:156020735-156020757 CCTTGCAAGAGGCGGGAGGCGGG - Intronic
915922850 1:159990191-159990213 CCTGGCAAGGGGTGGGGTGTGGG - Intergenic
915990394 1:160509497-160509519 CCTGTCAGGGGGTGGGGAGCTGG + Intronic
916643864 1:166762447-166762469 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
916797346 1:168179221-168179243 GCTGGCCCAGGGCGGGAGGCAGG + Intronic
917040350 1:170799201-170799223 CTTGTCAGGGGGTGGGGGGCTGG + Intergenic
917129310 1:171724316-171724338 CCTGTCATGGGGTGGGGGGAGGG + Intronic
917289527 1:173457959-173457981 CCTGCCGGGGGGTGGGGGGCTGG + Intergenic
917331069 1:173881102-173881124 CCTGTCGTGGGGTGGGAGGAGGG - Intronic
917520359 1:175743226-175743248 CCAGGCTGGGGGTGGGCGGCCGG + Exonic
917803528 1:178592944-178592966 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
917854841 1:179091755-179091777 CTTGGCAGGGGCTGGAAGGCAGG - Intronic
917866640 1:179201935-179201957 CCTGGCTGGGGTTGGGTGGCAGG - Intronic
917933499 1:179840737-179840759 CCTGTCAGGGGGTGGGGGGCTGG + Exonic
918080179 1:181201576-181201598 CCTGTCAGGGGGTGGGGGGTTGG + Intergenic
918403133 1:184184585-184184607 CCTGTCATGGGGTGGGGGGATGG - Intergenic
918650301 1:186954432-186954454 CCTGTCAGGGTGTGGGGGGCTGG + Intronic
918713135 1:187756681-187756703 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
918816379 1:189190903-189190925 CCTGTCATGGGGTGGGGGGATGG - Intergenic
919048799 1:192487092-192487114 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
919084913 1:192910270-192910292 CCTGTCACGGGGTGCGGGGAGGG + Intergenic
919290239 1:195620845-195620867 CCTCTCAGGGGGTGGGAGCCTGG + Intergenic
919309629 1:195891839-195891861 CCTGTCATGGGGTGGGGGGAAGG - Intergenic
919377581 1:196814212-196814234 CCTATCATGGGGTGGGGGGCAGG - Intergenic
919387095 1:196936109-196936131 CCTATCATGGGGTGGGGGGCAGG - Intronic
919598719 1:199596442-199596464 CCTGGTGGGGGGTGGGAGGAGGG - Intergenic
919682650 1:200451765-200451787 CCTGTCGTGGGGTGGGGGGCAGG - Intergenic
920072754 1:203314772-203314794 CCTGTCAGGGGGTGGGGGACTGG + Intergenic
920181036 1:204131809-204131831 CCTGGCCTGGGGAAGGAGGCGGG - Exonic
920336079 1:205246283-205246305 CCTGGCAAGGGGTGTGAGGTGGG + Intronic
920342053 1:205281414-205281436 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
920375391 1:205505319-205505341 GCAGGCAGGGGGTGGGAGGCCGG + Intronic
920443182 1:205995102-205995124 CCTGTCACGGGGTGGGGGCAGGG + Intronic
920522962 1:206642768-206642790 CCTGTCGTGGGGTGGGAGGAGGG + Intronic
921138637 1:212285336-212285358 CCTCGCAAGGGGTGGGAAGGAGG - Intergenic
921161526 1:212475817-212475839 CCTGTCAGGGGGTTGGGGGCTGG - Intergenic
921239231 1:213160842-213160864 CCTGTCATGGGGTGGGGGGATGG + Intronic
921306693 1:213803954-213803976 CCTGTCGGGGGGTGGGGGGCTGG + Intergenic
921355599 1:214281537-214281559 CTTGGGGCGGGGTGGGGGGCGGG + Intronic
921702548 1:218284650-218284672 GCTAGCCCCGGGTGGGAGGCAGG + Intergenic
921830987 1:219727414-219727436 CCTGTCAGGGAGTGGGAGACTGG - Intronic
921915457 1:220605662-220605684 CCTGTCGTGGGGTGGGGGGCTGG - Intronic
922147909 1:222966956-222966978 CCTGGTATGGAGTGGGAGGGAGG + Intronic
922586492 1:226737868-226737890 CCTGGGGCGAGGTGGGGGGCGGG - Intronic
922611197 1:226930083-226930105 CCTGTCATGGGGTGGGGGGAGGG + Intronic
923066400 1:230521322-230521344 CCTGTCGGGGGGTGGGGGGCTGG - Intergenic
923084800 1:230695103-230695125 GCTGGCTTGGGGCGGGAGGCAGG - Intergenic
923219975 1:231884001-231884023 CCTTGCCCAGGGTGGGTGGCAGG + Intronic
923374389 1:233345575-233345597 CCTGTCATGGGATGGGGGGCAGG + Intronic
923416208 1:233764316-233764338 CCTGTCATGGGGTTGGGGGCAGG - Intergenic
923451455 1:234121711-234121733 CCTGTCAGGGGGTGGGAGGATGG - Intronic
923540042 1:234882063-234882085 CCTGCCTGAGGGTGGGAGGCTGG - Intergenic
923620265 1:235573317-235573339 CCTGTCAAGGGGTGGGGGGAGGG + Intronic
923870545 1:237988779-237988801 CCTGTCATGGGGTGGGAGGAGGG + Intergenic
923968092 1:239166314-239166336 CCTGTCATGGGGTGGGGGGATGG + Intergenic
924160140 1:241222812-241222834 CCTGTCAGGGGGTGGGGGGCTGG - Intronic
924249909 1:242121934-242121956 CCTGTCATGGGGTGGGGGGAGGG + Intronic
924302621 1:242654774-242654796 CCTGTCAGGGGGTGGGGGGCGGG + Intergenic
924506462 1:244690217-244690239 CCTGTCGCGGGGTGGGAGCCTGG - Intronic
924733300 1:246731861-246731883 CCTGTCGTGGGGTGGGGGGCAGG - Intronic
1062762175 10:31787-31809 CCTGTCAAAGGGTGGGAGGCTGG + Intergenic
1062916624 10:1245099-1245121 CAGGACACTGGGTGGGAGGCTGG + Intronic
1063305922 10:4900253-4900275 CCTGTCAGTGGGTGGGGGGCTGG + Intergenic
1063512878 10:6663331-6663353 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1063785578 10:9379503-9379525 ACTGGCGCGGAGTGGGGGGCGGG - Intergenic
1064003445 10:11682159-11682181 CGAGGCCCGGGGTGGGAGGGTGG + Intergenic
1064308299 10:14188237-14188259 CTTGGCACAGGGGGAGAGGCAGG - Intronic
1064314667 10:14244273-14244295 CCTGGAAGGGGGTGGAAGTCTGG - Intronic
1064367516 10:14720992-14721014 CCTGTCATGGGGTGGGGGCCTGG - Intronic
1065050273 10:21784893-21784915 CCTGTCATGGGGTGGGGGGCAGG + Intronic
1065118801 10:22508204-22508226 CCTGTCAGGGGATGGGGGGCTGG - Intergenic
1065161244 10:22924693-22924715 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1065192801 10:23229426-23229448 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1065229864 10:23587037-23587059 CCTGTCATGGGGTTGGGGGCTGG - Intergenic
1065414628 10:25471106-25471128 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1065450994 10:25856761-25856783 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1065647353 10:27849395-27849417 CCTGTCGTGGGGTGGGAGGAGGG + Intronic
1066153580 10:32650917-32650939 CCTGGGAGGGGCTGGCAGGCAGG + Intronic
1066169631 10:32827637-32827659 CCTGTCTGGGGGTGGGGGGCTGG + Intronic
1066701394 10:38133463-38133485 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1066714006 10:38266827-38266849 CCTGTCAAGGGGTTGGGGGCTGG + Intergenic
1067013009 10:42732039-42732061 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1067017025 10:42765266-42765288 CCTGTCATGGGGTGGGGGGATGG + Intergenic
1067127032 10:43527314-43527336 CCTGTCAGGGGATGGGGGGCTGG - Intergenic
1067310831 10:45112077-45112099 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1067346862 10:45443654-45443676 CCGGGCACGGGGTGGGCGCCGGG + Intronic
1067469064 10:46523260-46523282 CTTGACCCTGGGTGGGAGGCAGG + Intergenic
1067695523 10:48532634-48532656 CCTGTCATGGGGTGGGGGGTTGG - Intronic
1067898823 10:50216150-50216172 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
1068215169 10:53973284-53973306 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1068240182 10:54294307-54294329 CCTGTCAGAGGGTGGGGGGCTGG + Intronic
1068467891 10:57418416-57418438 CCTGTCATGGGGTGGAGGGCAGG + Intergenic
1068491808 10:57734046-57734068 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1068575704 10:58682015-58682037 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1068641047 10:59408473-59408495 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1068669677 10:59710109-59710131 CAGGGCACGTGGTGGGCGGCGGG - Intronic
1069226642 10:65953533-65953555 CCTGTCATGGGGTGGGTGGAGGG - Intronic
1069354206 10:67564486-67564508 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1069640248 10:69950297-69950319 ACTGTCTGGGGGTGGGAGGCAGG + Intronic
1069650889 10:70047420-70047442 CCTGTCATGGGGTGGGAGGAGGG + Intergenic
1069734013 10:70639628-70639650 CCTGCCAGGGGGTGAGGGGCTGG - Intergenic
1069776909 10:70932721-70932743 GGTGGCACAGGGTGGGAGGAGGG + Intergenic
1069828536 10:71268907-71268929 GCTGGCACGGGGAGTGAGGCTGG - Intronic
1069886562 10:71627564-71627586 CCTGGCAGGGGGTGTGAGGCAGG + Intronic
1070476954 10:76838179-76838201 CCTGTCATGGGGAGGGGGGCAGG + Intergenic
1070503189 10:77090558-77090580 CTTGCCAGGGGGTGGGATGCAGG - Intronic
1070705464 10:78634620-78634642 CCGGGCATGGGGCTGGAGGCTGG - Intergenic
1070852403 10:79576321-79576343 CCTGTCATGGGGTGGGGGGAAGG + Intergenic
1071004357 10:80865363-80865385 CCTGTCGTAGGGTGGGAGGCTGG - Intergenic
1071075146 10:81740897-81740919 CCTGTCACAGGGTGGGGGGAGGG + Intergenic
1071135295 10:82446628-82446650 CCTGTCACGGGGAGGGAGTACGG + Intronic
1071176018 10:82927491-82927513 CCTGTCAGGGGGTGGGGGCCAGG - Intronic
1071204479 10:83258179-83258201 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1071350293 10:84733736-84733758 CCTGTCGTGGGGTGGGGGGCAGG + Intergenic
1071642072 10:87319404-87319426 CCTGTCGGGGGGTGGGGGGCAGG + Intergenic
1071740257 10:88350379-88350401 CATGTCATGGGGTGGGAGGAGGG - Intronic
1072091785 10:92136004-92136026 CCTGTCATGGGGTGGGGGGCAGG + Intronic
1072346879 10:94516565-94516587 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1072407102 10:95165408-95165430 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1072492557 10:95921790-95921812 CCTGTCAGAGGGTGGGGGGCTGG + Intronic
1072817294 10:98521976-98521998 CCTGTCAGGGGGTGTGGGGCTGG + Intronic
1073321669 10:102619670-102619692 CCTGGCAGGGGGAGGAGGGCTGG - Intronic
1073367639 10:102956813-102956835 CCTGTCATGTGGTGGGGGGCAGG + Intronic
1073549154 10:104381412-104381434 CTAGGAATGGGGTGGGAGGCTGG + Intronic
1073563960 10:104519624-104519646 GCTGGCCCAGAGTGGGAGGCTGG + Intergenic
1073978746 10:109130124-109130146 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1074053560 10:109901253-109901275 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1074117551 10:110468289-110468311 CCTGTCGGTGGGTGGGAGGCTGG - Intergenic
1074179790 10:111049108-111049130 CCTGTTATGGGGTGGGAGGAGGG + Intergenic
1075296318 10:121278782-121278804 CCTGTCAGGGGGTGGGGGGAAGG + Intergenic
1075419180 10:122288237-122288259 CCTGCCACGGGGTGGATGGCAGG + Intronic
1075804811 10:125179138-125179160 CCTGTCATGGGGTGGGGGGCTGG - Intergenic
1075858601 10:125653480-125653502 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1075994302 10:126864564-126864586 CCTGTCAAGGGGTGGGGGGAGGG + Intergenic
1076158646 10:128223724-128223746 CCTGTCGCGGGGTGGGGGCCTGG - Intergenic
1076160966 10:128243955-128243977 CCTGTCGCGGGGTGGGAGGAGGG + Intergenic
1076192202 10:128490755-128490777 CCTAGCAGGGGCTGGGAGGGAGG + Intergenic
1076849836 10:133087345-133087367 CCTCGCTGCGGGTGGGAGGCTGG + Intronic
1076864361 10:133159950-133159972 CGGGGCCCGGGGTGGGGGGCGGG - Intergenic
1076864374 10:133159969-133159991 CGGGGCCCGGGGTGGGGGGCGGG - Intergenic
1077008395 11:369597-369619 GCGGGCCCGGGGTGGGCGGCGGG - Intergenic
1077009205 11:372769-372791 CCTGTAATGGGCTGGGAGGCAGG + Intronic
1077047445 11:552715-552737 CCAGGCACTGGGGGGCAGGCGGG - Intronic
1077081368 11:726035-726057 CCGGGCAGGTGCTGGGAGGCGGG + Intronic
1077155236 11:1088163-1088185 CAGGGCAGGGGGTGGGGGGCTGG - Intergenic
1077164688 11:1129750-1129772 ACAGGCCCAGGGTGGGAGGCTGG - Intergenic
1077317844 11:1927267-1927289 CCAGGCAATGGGTGGGATGCTGG - Intronic
1077328126 11:1972409-1972431 CCCGGCACGAGGTGGGGTGCGGG - Intronic
1077539938 11:3141791-3141813 CCCTGCACTGGGTGGGAGGCGGG - Intronic
1077608556 11:3628701-3628723 CCTGGCAGGGGGTGGGATGTGGG - Intergenic
1078032893 11:7771200-7771222 CCTGTCATAGGGTGGGGGGCTGG + Intergenic
1078119853 11:8495941-8495963 CCTGTCATGGGGTGGGGGGCTGG + Intronic
1078542343 11:12222361-12222383 CCAGGCAGGGGGAGGGATGCAGG - Intronic
1078661384 11:13289530-13289552 CCTGTCAGGGGCTGGGGGGCTGG - Intronic
1078875296 11:15388882-15388904 CCTGTTAGGGGGTGGGAGGCTGG - Intergenic
1079232864 11:18664749-18664771 CCTGTCATGGGGTGGGAGGAGGG + Intergenic
1079465583 11:20726744-20726766 CCTGTCATGGGGTGGGGGGATGG - Intronic
1079482744 11:20898413-20898435 CCTGTCATGGGGTGGGGGGAAGG + Intronic
1079558402 11:21791016-21791038 CCTGCCAGGGGGTGGGGAGCTGG - Intergenic
1079610628 11:22428638-22428660 CCTGTCAAGGGGTGGGAGGCAGG + Intergenic
1079708022 11:23646417-23646439 CCTGTCGTGGGGTGGGAGGAGGG - Intergenic
1080107830 11:28529596-28529618 CATAGCAGGGGGTGGGGGGCGGG + Intergenic
1080137855 11:28878853-28878875 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1080181185 11:29428472-29428494 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1080366479 11:31579778-31579800 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1081640320 11:44748862-44748884 CCTGGAAGTGGGTGGGAGGAGGG - Intronic
1081675332 11:44965274-44965296 CCTGGTATGAGGAGGGAGGCTGG + Intergenic
1081681851 11:45011958-45011980 CCTGTCAAGGAGTGGTAGGCTGG - Intergenic
1081989452 11:47329902-47329924 CCAGGCACGGGGTGTCAGGAGGG + Exonic
1082098506 11:48151595-48151617 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1082127199 11:48447439-48447461 CCTGTCAGGGGGTTGGGGGCTGG - Intergenic
1082560769 11:54618371-54618393 CCTGTCAGGGGGTTGGGGGCTGG - Intergenic
1082716563 11:56620849-56620871 CCTGTCAGGGGGTCGGGGGCTGG + Intergenic
1083078750 11:60068851-60068873 CCTGTCGTGGGGTGGGGGGCTGG - Intronic
1083258496 11:61510545-61510567 CCAGGCACATGCTGGGAGGCTGG - Exonic
1083502831 11:63127126-63127148 CCTGTCAGGGAGTGGGGGGCTGG - Intronic
1083640296 11:64141769-64141791 CTGGGCACAGGGTAGGAGGCAGG + Intronic
1083747715 11:64744870-64744892 CCTGGCGCGGGGGCGGGGGCGGG - Intronic
1083758341 11:64802994-64803016 CCTGCCGCGGGGTGCGGGGCTGG + Intronic
1083823098 11:65183413-65183435 CCTGCCCCGGGGGGGGAAGCGGG - Intronic
1083889895 11:65590443-65590465 CCTGACACGGGGCAGGGGGCAGG + Intronic
1083961115 11:66015564-66015586 GCAGGCACAGGGTGGGTGGCAGG + Intergenic
1084166087 11:67375343-67375365 GCTGGCTTGGGGTGGGGGGCAGG + Intronic
1084266306 11:68007124-68007146 CCAGGGAGGGGGTGGGAGGCAGG + Intergenic
1084956746 11:72695628-72695650 CCTGGGAAGGGGCGAGAGGCAGG + Exonic
1084978384 11:72815508-72815530 CCTGGGTCGGGGCGGGGGGCAGG - Intronic
1085013477 11:73157501-73157523 CCTTGCAAGGATTGGGAGGCAGG + Intergenic
1085042295 11:73333692-73333714 CCTGGAACAGGGTGGGAGTAGGG + Intronic
1085084330 11:73656649-73656671 CCTGGCATGGGGTGGGTGGCAGG + Intronic
1085135554 11:74084286-74084308 CCTGTCATGGGGTGGAGGGCAGG + Intronic
1085174426 11:74473818-74473840 CCAGGCAAGGGGTGGGAGGAAGG + Intergenic
1085206965 11:74740812-74740834 CCTGTCGTGGGGTGGGGGGCTGG - Intergenic
1085303093 11:75469844-75469866 TTTGGTACGGGGTGTGAGGCAGG - Intronic
1085318267 11:75559120-75559142 CCTGGCACGTGGAGGCTGGCTGG - Intergenic
1085389971 11:76177325-76177347 CCTGGCACAGGGCCTGAGGCAGG + Intergenic
1085456921 11:76670677-76670699 TCTGGCGCGGGGTGGGACCCGGG - Intronic
1085575518 11:77599417-77599439 CCTGTCATGGGGTGGGGGGCTGG - Intronic
1085609310 11:77932951-77932973 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
1085678681 11:78549843-78549865 ACTGGTAGGGGGTGGGAGGGAGG + Intronic
1085960573 11:81456749-81456771 CCTGTCATGGGGTGGGAGGCTGG + Intergenic
1086294869 11:85353831-85353853 CCTGTCATGGGGTGGGAGGAAGG + Intronic
1086457986 11:86978044-86978066 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1086528664 11:87758551-87758573 CCTGTCATGGGGTGGGTGGAGGG - Intergenic
1086531032 11:87785231-87785253 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1086575972 11:88339100-88339122 CCTGGGGCGGGGTTGGTGGCGGG + Intergenic
1086720380 11:90113999-90114021 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1086811519 11:91316447-91316469 CCTGTCGTGGGGTGGGGGGCAGG - Intergenic
1086910444 11:92465706-92465728 CCTGTCATGGGGTGGGGGGCAGG + Intronic
1086996639 11:93365126-93365148 GCTGGCAAGGGGAGGGATGCTGG - Intronic
1087005230 11:93464037-93464059 CATGTCGTGGGGTGGGAGGCTGG + Intergenic
1087175462 11:95091185-95091207 CCTGGGCAGGGGTGGGAGGCTGG - Intronic
1087356639 11:97102185-97102207 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1087422627 11:97949559-97949581 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1087485362 11:98753838-98753860 CCTGTCAAGGGGTAGGAGGCTGG + Intergenic
1087675095 11:101152529-101152551 CCTGTCAGCGGGTGGGAGTCAGG - Intergenic
1087898824 11:103617303-103617325 CCTATCAGGGGGTGGGGGGCTGG + Intergenic
1088122577 11:106387495-106387517 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1088578257 11:111293212-111293234 CCTGTCATGGGGTGGGTGGAGGG + Intergenic
1089503743 11:118949247-118949269 CCTGTCATGGGGTAGGGGGCAGG - Intronic
1089846966 11:121466265-121466287 CCTGGGAGTGGGTGGGAGGGTGG - Intronic
1089934790 11:122352885-122352907 CCTGTTAGGGGGTGGGGGGCTGG + Intergenic
1089944016 11:122448541-122448563 CCTGTCATGGGGTAGAAGGCAGG + Intergenic
1090081855 11:123618830-123618852 CATGGCACTGGGTGGGATGAAGG - Intronic
1090271175 11:125387421-125387443 CCTGGCAGGTGGTGGTGGGCAGG - Intronic
1090359358 11:126161784-126161806 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1090608190 11:128446296-128446318 CCTGTCATGGGGTGGGGGCCAGG + Intergenic
1090933257 11:131318509-131318531 CCTGTCATGGGGTGGGGGGATGG + Intergenic
1202811105 11_KI270721v1_random:27589-27611 CCCGGCACGAGGTGGGGTGCGGG - Intergenic
1091377599 12:35722-35744 CCTGTCAGTGGGTGGGGGGCTGG - Intergenic
1091421872 12:348754-348776 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
1091529660 12:1341654-1341676 CCTGTCATGGGGTGGGGGGTTGG + Intronic
1091684424 12:2551532-2551554 TCTGGGGCGGGGTGGGAGGTAGG - Intronic
1091867826 12:3857120-3857142 CCTGTCGGGGGGTGGGGGGCTGG + Intronic
1092072281 12:5641217-5641239 CCTGTCAGGGGGTGGGGGGCAGG + Intronic
1092126726 12:6079904-6079926 CCTGGCACAGTGTGTGAGGTGGG - Intronic
1092240555 12:6833672-6833694 CTTGGCCCGAGCTGGGAGGCTGG + Intronic
1092532341 12:9354956-9354978 CCTGTCAGGGAGTGGGGGGCTGG - Intergenic
1092548196 12:9469698-9469720 CCTGGCATGGGGTGGGAAGAAGG - Intergenic
1092549107 12:9478391-9478413 CTTGGGAAGGGGTGGGAGGGTGG + Intergenic
1092710714 12:11334558-11334580 CCTGTAATGGGGTGGGAGGATGG - Intergenic
1092903717 12:13083683-13083705 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1093011883 12:14115741-14115763 CCTGTCAGGGGGTGGGTGCCTGG + Intergenic
1093085333 12:14861194-14861216 CCTGTCATGGGGTGGGAGGCAGG - Intronic
1093128397 12:15358226-15358248 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1093372271 12:18379357-18379379 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1093678170 12:21968197-21968219 CCTGTTAGGGGGTGGGGGGCTGG + Intergenic
1093706391 12:22279339-22279361 CTTGGTATGGGCTGGGAGGCAGG - Intronic
1093802906 12:23394968-23394990 CCTGTCATGGGGTGGGGGGAAGG + Intergenic
1093822251 12:23635516-23635538 CCTGTCGTGGGGTGGGAGGAGGG + Intronic
1093899897 12:24619973-24619995 CCTGTCGGGGAGTGGGAGGCTGG - Intergenic
1094073339 12:26444476-26444498 CCTGGCATGGAGTTGGAGGCAGG - Intronic
1094234820 12:28151695-28151717 CCTGTCGTGGGGTGGGGGGCAGG - Intronic
1094402243 12:30074547-30074569 CCTGTCGGGGGGTGGGGGGCAGG + Intergenic
1094503888 12:31044076-31044098 CTTGGGAAGGGGTGGGAGGGTGG - Intergenic
1094504809 12:31052755-31052777 CCTGGCATGGGGTGGGAAGAAGG + Intergenic
1094804800 12:34079049-34079071 CCTGTCATGGGGTGGGGGGTAGG + Intergenic
1095297123 12:40539724-40539746 CCTGTCATTGGGTGGGAGGAGGG - Intronic
1095652883 12:44634320-44634342 CCTGTCATGGGGTGGGGGGCTGG - Intronic
1095799031 12:46252330-46252352 CCTGTCACAGGGTGGGGGCCTGG + Intronic
1095902571 12:47343213-47343235 CCTGCCATGGGGTGGGGGGTTGG + Intergenic
1096037670 12:48486755-48486777 CATGGCATGAGGTGGGAGGTGGG + Intronic
1096041182 12:48519127-48519149 CCTGTCATGGGGTGGGGGGCAGG - Intronic
1096187213 12:49589003-49589025 CCTGGCACTGGGTGAGGAGCTGG + Intronic
1096435131 12:51583387-51583409 CCTGTTGTGGGGTGGGAGGCTGG + Intergenic
1096523047 12:52194794-52194816 CCTGGCAGGGGTTGGGAGGTGGG + Intergenic
1096664538 12:53154499-53154521 CCTGGCTGGGGCTGGGTGGCAGG - Intergenic
1096735054 12:53646695-53646717 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
1096777348 12:53972407-53972429 CCAGGCACCGGCTGGGCGGCTGG + Intergenic
1096921463 12:55090979-55091001 CCTGTCGTGGGGTGGGAGGGAGG + Intergenic
1097246888 12:57611779-57611801 CCTGGACCGGGGTAGGAGGGAGG + Intronic
1097526029 12:60737362-60737384 CCTGTCATGGGGTGGGGGTCAGG + Intergenic
1097743145 12:63269205-63269227 CCTGTCGTGGGGTGGGAGGAGGG - Intergenic
1098133228 12:67373347-67373369 TCTGGAACAGTGTGGGAGGCTGG - Intergenic
1098291136 12:68957839-68957861 CCTGTCAGGGGGTGGGTGGCTGG - Intronic
1098798833 12:74927022-74927044 CCTGTCATGGGGTGGGGGCCTGG + Intergenic
1098820231 12:75218768-75218790 CCTGTCATGGGGTGGGGGGCAGG - Intergenic
1099100440 12:78433218-78433240 CCTGTCACGGGGTAGGGTGCAGG - Intergenic
1099426772 12:82533008-82533030 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1099427730 12:82545330-82545352 CCTGTCATGGGGTGGGGGGATGG - Intergenic
1099467693 12:83006931-83006953 CCTGTCATGGGGTCGGGGGCTGG + Intronic
1099490300 12:83280741-83280763 CCTGTTGCGGGGTGGGAGGCTGG + Intergenic
1099523037 12:83687525-83687547 CCTGTCGGGGGGTGAGAGGCTGG + Intergenic
1099575682 12:84377952-84377974 CCTGTCATGGGGTGGGGGGATGG + Intergenic
1099870819 12:88347156-88347178 CCTGTCATGGGGTGGAGGGCAGG - Intergenic
1099884048 12:88504963-88504985 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1100008192 12:89919783-89919805 CCGGGCGCTGGGCGGGAGGCGGG + Intergenic
1100073383 12:90749617-90749639 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1100166889 12:91926035-91926057 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1100248954 12:92794724-92794746 CCTGTCGGGGGGTGGGGGGCTGG + Intronic
1100399105 12:94212473-94212495 CCTGCCGGGGGGTGGGGGGCTGG - Intronic
1100417655 12:94395178-94395200 CCTGTCAGGGGGTGGGGGCCTGG + Intronic
1100472238 12:94903950-94903972 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1100749245 12:97678926-97678948 CCTGTCATGGGGTGGGGGGCTGG + Intergenic
1100797666 12:98199310-98199332 CCTGCCAGGGGCTGGGGGGCTGG - Intergenic
1100808836 12:98316748-98316770 CCTGTCAGGGGGTGGGGAGCTGG + Intergenic
1101196654 12:102390324-102390346 CCTGTCAAGGGCTGGGGGGCTGG + Intergenic
1101337930 12:103813225-103813247 GATGGCATGGGGTGGCAGGCAGG + Intronic
1101362363 12:104040140-104040162 CCTGTCATGGGGTGGGAGCAGGG + Intronic
1101730874 12:107426031-107426053 CCTTGCTGGGGGTGGGAGGGAGG - Intronic
1101743307 12:107518596-107518618 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1101768690 12:107728096-107728118 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1101875703 12:108595858-108595880 CTTGACTGGGGGTGGGAGGCAGG - Intronic
1102502045 12:113359365-113359387 CCTGGCACTGGAAGGGAGGCAGG - Intronic
1102615378 12:114149548-114149570 CCTGGGAAGGTGTGTGAGGCAGG + Intergenic
1102704247 12:114867511-114867533 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1103244047 12:119440055-119440077 CCTGTCGGGGGGTGGGGGGCCGG + Intronic
1103848180 12:123914307-123914329 CCTGGCACGGGAGGAGAGGGAGG - Exonic
1103995138 12:124824776-124824798 CCTGGCAGGAGCTGGGAAGCTGG - Intronic
1104031004 12:125065707-125065729 CCTGGCGCTGGGTGAGAGTCGGG + Exonic
1104127442 12:125861547-125861569 CCTGGCCCCTGGTGGGAGGCGGG - Intergenic
1104131877 12:125901976-125901998 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1104196256 12:126541429-126541451 CCTGTCAGGGGGTGGGAGGCTGG + Intergenic
1104408218 12:128536384-128536406 CCTGTCATGGGGTGGGGGGCTGG + Intronic
1104642912 12:130478874-130478896 CCGGGCGCGGCGTGCGAGGCAGG - Intronic
1104644136 12:130485103-130485125 CCAGGTACAGGGTGGGAGGGAGG + Intronic
1104855884 12:131902333-131902355 GCTGGCAGAGGGTGGGAGCCTGG + Intronic
1105316680 13:19271861-19271883 CCTGTCGGGGGGTGGGAGGCTGG - Intergenic
1105594288 13:21821556-21821578 CCTGGCAGTGGCTGGGAGCCTGG + Intergenic
1105644937 13:22307091-22307113 CCTGTCAGGGGCTGGGGGGCTGG - Intergenic
1106037403 13:26056537-26056559 CCTGTCAGGGGCTGGGAGGAAGG + Intergenic
1106470466 13:30049686-30049708 CCTGGCAGGGGATGGGAAGGGGG + Intergenic
1106633023 13:31496695-31496717 CCTGTCATGGGGTTGGGGGCTGG + Intergenic
1106638706 13:31559847-31559869 CCTGTCAGGGGGTGTGGGGCTGG - Intergenic
1106824457 13:33504598-33504620 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1106831688 13:33590692-33590714 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1107135344 13:36938284-36938306 CCTGGCTGGGGCTGGGAAGCAGG + Intergenic
1107197677 13:37673093-37673115 CCTGTCGCGGGGTGGGGGGAGGG - Intronic
1107316647 13:39139298-39139320 CCTGTCGTGGGGTGGGAGGAAGG + Intergenic
1107457839 13:40571215-40571237 CCTGTCATGGGGTGGGGGGAAGG + Intronic
1107567222 13:41617637-41617659 CCTGTCACAGGGCGGGGGGCTGG - Intronic
1108099838 13:46943061-46943083 CCTCTCACGGGGTGGGGGGTTGG + Intergenic
1108412793 13:50166943-50166965 CCTGTTAGGGGGTGGGGGGCTGG + Intronic
1108421715 13:50257275-50257297 CCTGTCAAGGGGTGGGAGCCTGG + Intronic
1108429950 13:50343489-50343511 CCTGTCATGGGGTGGGGGACAGG + Intronic
1109271000 13:60254812-60254834 CCTGTCATGGGGTGGGGGGCGGG + Intergenic
1109571211 13:64192707-64192729 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1110130867 13:72008405-72008427 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1110151870 13:72265628-72265650 CCTGTCATGGGGTGGGGGGAAGG - Intergenic
1110536123 13:76652615-76652637 CCTGTTGCAGGGTGGGAGGCGGG + Intergenic
1110663124 13:78081967-78081989 CCTGTCATGGGGTGGGGGACAGG + Intergenic
1110781716 13:79473802-79473824 CCTGTCAGGGGGTGGGGGACTGG - Intergenic
1110815696 13:79857960-79857982 CCTGTCAGGGGGTCGGGGGCCGG + Intergenic
1111103356 13:83614175-83614197 CCTGGCATGGGGTGAGGGGAGGG - Intergenic
1111194576 13:84857282-84857304 CCTGTCTGGGGGTGGGGGGCTGG - Intergenic
1111566422 13:90023027-90023049 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1111678581 13:91416606-91416628 CCTGTCAGGGGGTGGGAGGCTGG - Intronic
1111702754 13:91711447-91711469 CCTGTCAGGGGGTGGGGGACTGG + Intronic
1111722598 13:91965076-91965098 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1111792699 13:92878952-92878974 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1111815609 13:93148796-93148818 CCTGTCAGGAGGTGGGGGGCTGG + Intergenic
1112042891 13:95565773-95565795 CCTGTCAGGGGGTGGGGGGCTGG - Intronic
1112347518 13:98602753-98602775 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1112365855 13:98754818-98754840 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1112437670 13:99403160-99403182 CCTGTCAAGGGGTGGAGGGCTGG + Intergenic
1112541545 13:100318479-100318501 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1112581121 13:100677134-100677156 CCTGTCAGGGGGTGGGGTGCTGG - Intergenic
1112773569 13:102819596-102819618 CCTGTCGCGGGGTGGGAACCGGG + Intronic
1112828362 13:103418460-103418482 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1112830213 13:103440563-103440585 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1112937579 13:104820387-104820409 CCTGTCGGGGGGTGGGGGGCTGG + Intergenic
1113521898 13:110947332-110947354 CCTGGCACGTGGTGGGTGCTTGG + Intergenic
1113604163 13:111593494-111593516 CCTGTCATGGGGTGGGTGGCTGG - Intronic
1113647674 13:112010832-112010854 CCAGGCAGGGGGTCGGGGGCAGG - Intergenic
1113705995 13:112433367-112433389 CCTGGCACGTGGTGGGTGCTTGG - Intronic
1113766860 13:112887449-112887471 CCAAGCACGAGGTGGCAGGCAGG - Intergenic
1113803047 13:113096356-113096378 CCTGGAACCTGGTGGGAGACGGG - Exonic
1114040807 14:18676763-18676785 CCTGGAGAGGGGTAGGAGGCAGG - Intergenic
1114045845 14:18875267-18875289 CCTGGAGAGGGGTAGGAGGCAGG - Intergenic
1114118369 14:19644203-19644225 CCTGGAGAGGGGTAGGAGGCAGG + Intergenic
1114527384 14:23375376-23375398 CCTGGGACCGTGAGGGAGGCAGG - Intronic
1114679216 14:24470454-24470476 CCTGTCGTGGGGTGGGGGGCAGG - Intergenic
1114904133 14:27103437-27103459 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1115160142 14:30384488-30384510 CCTGTCGTGGGGTGGGGGGCGGG + Intergenic
1115728745 14:36245088-36245110 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1115750809 14:36487791-36487813 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1115767356 14:36637111-36637133 CCTGTTGTGGGGTGGGAGGCTGG - Intergenic
1115773843 14:36694060-36694082 CCTGTCAGGGGTTGGGGGGCTGG - Intronic
1115936425 14:38558316-38558338 CCTGTCAGGGAGTGGGGGGCTGG + Intergenic
1115947368 14:38677147-38677169 CCTGACAGGGGGTGGAGGGCTGG + Intergenic
1116165029 14:41324522-41324544 CCGGTCAGGGGGTGGGGGGCTGG - Intergenic
1116403744 14:44542499-44542521 CCTGTCATGGGGCGGGGGGCAGG + Intergenic
1116698328 14:48203792-48203814 CCTGTCAGGGGGTCGGGGGCTGG + Intergenic
1116754430 14:48928049-48928071 CCTGTCAGGGGGTAGGGGGCTGG + Intergenic
1116905189 14:50396960-50396982 CCGGGCCGGGGGTGGGAAGCTGG - Intronic
1116914467 14:50509225-50509247 CCTGTCATGGGGTGGGGGGCAGG + Intronic
1117612491 14:57499150-57499172 CCTGTCATGGGGTGGGGGGATGG - Intergenic
1117636197 14:57746076-57746098 CCTGTCATGGAGTGGGGGGCAGG + Intronic
1117875957 14:60249823-60249845 CCCGGCTCGGGGGAGGAGGCCGG - Intronic
1117932467 14:60857722-60857744 CCTGTCAGGGGATGGGGGGCTGG - Intronic
1117995571 14:61474549-61474571 CCTGGCAGGGGATGGGGGGCTGG + Intronic
1118300407 14:64610382-64610404 CCAGGGACTGGGTTGGAGGCTGG + Intergenic
1118492883 14:66278805-66278827 CCTGTCAGGGGGTGGGAGACTGG + Intergenic
1118529667 14:66688907-66688929 CCTGTCGGGGGGTGGGGGGCTGG + Intronic
1118551449 14:66955702-66955724 CCTGTCGTGGGGTGGGAGGAGGG - Intronic
1118781045 14:69007933-69007955 CCTGGCCCAGGATGGCAGGCAGG - Intergenic
1118991764 14:70803097-70803119 CATGTCACGTGGTGGGAGCCAGG - Intronic
1119037037 14:71239170-71239192 CCAGGGACTGGGTGGGAGGGAGG + Intergenic
1119075204 14:71631020-71631042 CCTGTCAGGGGCTGGGGGGCTGG - Intronic
1119079269 14:71676623-71676645 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1119093942 14:71811526-71811548 CCTGTCATGGGGTGGGGGGACGG + Intergenic
1119280837 14:73406242-73406264 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1119412024 14:74438421-74438443 CCTGGCAGGGAGTTGGCGGCAGG + Intergenic
1119683337 14:76609540-76609562 CCTGTTGCGGGGTGGGTGGCGGG + Intergenic
1119728006 14:76933761-76933783 CCTGGGTAGGGGTAGGAGGCAGG - Intergenic
1119777225 14:77256776-77256798 CCTGGCAAGGGGAGGCAGGAGGG + Exonic
1120167991 14:81220785-81220807 CTTGGCGCGGGGTGGGGAGCGGG - Exonic
1120349908 14:83342252-83342274 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1120462384 14:84813961-84813983 CCTGTCATGGGGTGGGGGGAAGG - Intergenic
1120568286 14:86086234-86086256 CCTGTCAGGGAGTGGGGGGCTGG - Intergenic
1120717915 14:87860003-87860025 CCTGTCAGGGGGTGGGGGGTTGG + Intronic
1120804405 14:88731217-88731239 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1120813088 14:88824886-88824908 CCAGCCCCGGGTTGGGAGGCCGG + Intronic
1120883045 14:89429359-89429381 CCTGGCACCATGTGGGAGCCTGG + Intronic
1121173147 14:91870997-91871019 CCTGCTTCAGGGTGGGAGGCAGG + Intronic
1121255116 14:92525345-92525367 CCTGGCAGGGTGTGGGGGGATGG + Intronic
1121314946 14:92955497-92955519 CCTGGCACAGGGTGGAGGGAGGG + Intronic
1121321896 14:92996426-92996448 CCTGTCGCGGGGTGGGGGGAGGG + Intronic
1121561822 14:94881677-94881699 CCTGGCATGTGGGTGGAGGCAGG - Intergenic
1121616891 14:95319568-95319590 CTTGCCTCGAGGTGGGAGGCTGG - Intronic
1121629731 14:95413496-95413518 CCTTGCAGGGGATGGGAGGCTGG - Intronic
1122070124 14:99200698-99200720 CCTGGCATGGCGCAGGAGGCTGG + Intronic
1122084231 14:99288734-99288756 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1122742558 14:103880680-103880702 CCTGGCCCGGGCTAGGAGGGTGG - Intergenic
1122789730 14:104179138-104179160 CCTGGCAGGTGAAGGGAGGCGGG + Intronic
1122891027 14:104732340-104732362 ACAGGCACGTGGTGAGAGGCTGG - Intronic
1122929727 14:104927747-104927769 CCTGGCCCCAGGTGGGAGGACGG - Exonic
1123411089 15:20060141-20060163 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1123520420 15:21066829-21066851 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1123786356 15:23678792-23678814 CCTGTCGAGAGGTGGGAGGCTGG - Intergenic
1124058785 15:26267820-26267842 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1124578489 15:30930339-30930361 ACTGGCAAGTGGTGGGAGACTGG - Intronic
1124914375 15:33954645-33954667 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1124936047 15:34171929-34171951 CCTGTCATGGGGTGGGGGGTGGG + Intronic
1124983912 15:34586681-34586703 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1125331471 15:38586705-38586727 CCTGTTATGGGGTGGGAGGAGGG + Intergenic
1125355620 15:38814612-38814634 CCTGTCATGGGGTGGGGGGCTGG + Intergenic
1125837920 15:42770095-42770117 CCTGTCGTGGGGTGGGGGGCAGG + Intronic
1126071812 15:44872132-44872154 CCTGTCATGGGGTGGGGGGCAGG + Intergenic
1126073959 15:44890693-44890715 CCTGTCAGGGGGTGGGGGCCTGG - Intergenic
1126084231 15:44996166-44996188 CCTGTCAGGGCTTGGGAGGCTGG + Intergenic
1126330711 15:47528023-47528045 CCAGACATGGGGTGGGAGGATGG + Intronic
1126336432 15:47590373-47590395 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
1126617694 15:50602376-50602398 CCTGTCATGGGGTAGGGGGCAGG + Intronic
1126617778 15:50603453-50603475 CCTGTCATGGGGTGGGGGGCAGG - Intronic
1126760377 15:51964393-51964415 CCTGTCATGGGGTGAGGGGCAGG + Intronic
1126820228 15:52495925-52495947 CCTGGCGTGGGGTGGGAGGCAGG + Intronic
1126856414 15:52843742-52843764 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1127057705 15:55149146-55149168 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1127368702 15:58315268-58315290 CCTGTCAGAGGGTGGGAGGTGGG - Intronic
1127391937 15:58512752-58512774 ACTGGAACGAGGTAGGAGGCGGG + Intronic
1127970640 15:63957504-63957526 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1128122999 15:65168591-65168613 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1128151051 15:65363652-65363674 CCTGGCAGGAGGCGGGTGGCGGG - Intronic
1128249014 15:66151950-66151972 CCTGCCATGGGGCGGGGGGCAGG + Intronic
1128300985 15:66566089-66566111 CTTGGCGCTGGGTGGGGGGCGGG + Intergenic
1128370411 15:67035600-67035622 CATGGCACGGGGTGGGGGTGGGG + Intergenic
1128493243 15:68172061-68172083 CCTGTCTTGGGGTGGGGGGCTGG - Intronic
1128720620 15:69945442-69945464 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1129092614 15:73167118-73167140 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1129555360 15:76502565-76502587 CCTGTCGTGGGGTGGGAGGAGGG + Intronic
1129675485 15:77630896-77630918 CGTGGCCCGAGGTGGGAGGGAGG - Intronic
1129843634 15:78758399-78758421 CCTGACCAGGGGCGGGAGGCTGG - Intergenic
1130124185 15:81079137-81079159 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1130258170 15:82335401-82335423 CCTGACCAGGGGCGGGAGGCTGG + Intergenic
1130548531 15:84874060-84874082 CCCGTCAGGGGGTGGGGGGCTGG - Intergenic
1130596759 15:85254559-85254581 CCTGACCAGGGGCGGGAGGCTGG - Intergenic
1130670867 15:85911394-85911416 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1130698315 15:86153502-86153524 CCTGTCGTGGGGTGGGGGGCAGG + Intronic
1130701354 15:86185749-86185771 CCTGTCGTGGGGTGGGGGGCTGG + Intronic
1130840777 15:87698839-87698861 CCTGTCGTGGGGTGGGGGGCAGG + Intergenic
1131498069 15:92932441-92932463 CCTGTCATGGGGTGGGGGGGAGG - Intronic
1131509123 15:93039543-93039565 CCTGTCAGTGGGTGGGGGGCTGG - Intronic
1131596183 15:93800625-93800647 GCTGGTACTGGGTGTGAGGCTGG + Intergenic
1131917031 15:97278878-97278900 CCTATCAGGGGGTGGGGGGCGGG - Intergenic
1131943495 15:97593250-97593272 CCTGTCACGGGGTGGGGGAAAGG + Intergenic
1132138032 15:99363300-99363322 CCAGGCAAGGGGTGGCAGGTGGG + Intronic
1132144198 15:99417531-99417553 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1132395531 15:101470978-101471000 CCTGGCACGGCAAGGTAGGCTGG - Intronic
1132406644 15:101545535-101545557 CCTGACACGAGGTGGGTGACAGG - Intergenic
1132449328 15:101957270-101957292 CCTGTCAGTGGGTGGGGGGCTGG + Intergenic
1132836179 16:1954503-1954525 CCTGTGAGGGGATGGGAGGCTGG - Intronic
1132875522 16:2135390-2135412 CCTGGCCCGGGACGGGAAGCAGG - Intronic
1132932880 16:2467842-2467864 CCCGGCCCGGGGGGCGAGGCGGG - Intergenic
1132978410 16:2721552-2721574 CCGGGTCGGGGGTGGGAGGCGGG + Intergenic
1132980908 16:2738272-2738294 CCCAGCACGGGGATGGAGGCTGG + Intergenic
1132999447 16:2841633-2841655 GCTGGCAGGGGATGGGAGGGAGG + Intergenic
1133092297 16:3413904-3413926 CCTGGGACGTGCTGGGAGGGAGG + Intronic
1133474297 16:6105234-6105256 ACTGGCACCTGGTGGCAGGCAGG + Intronic
1133475381 16:6116262-6116284 CCTGTCAGGGGGTGGGGGGCAGG + Intronic
1133628454 16:7594123-7594145 CCTGTCACGGGGTGGGGGGCTGG - Intronic
1133918939 16:10134470-10134492 CCTGTCAGGGGGTAGGGGGCTGG + Intronic
1133923568 16:10176692-10176714 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1134018868 16:10907781-10907803 CCAGGCAGCGGGCGGGAGGCTGG - Exonic
1134519465 16:14911970-14911992 CCTGGCCCGGGACGGGAAGCAGG + Intronic
1134554471 16:15154265-15154287 CCTGGCCCGGGACGGGAAGCAGG - Intergenic
1134707135 16:16310625-16310647 CCTGGCCCGGGACGGGAAGCAGG + Intergenic
1134769096 16:16789872-16789894 CCTGTCAGGGGTTGGGGGGCTGG - Intergenic
1134775280 16:16847755-16847777 CCTGTCATGGGGTGGGGGGATGG - Intergenic
1134803873 16:17108599-17108621 CCTCCCCCAGGGTGGGAGGCCGG + Exonic
1134960405 16:18401499-18401521 CCTGGCCCGGGACGGGAAGCAGG - Intergenic
1135152231 16:20018716-20018738 CCTGTCATGGGGTGGGGGACAGG + Intergenic
1135166570 16:20144393-20144415 CCTGTCATGGGGTGGGGGGATGG - Intergenic
1135184597 16:20304507-20304529 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1135811940 16:25595697-25595719 CCTGTCATAGGGTGGGGGGCTGG - Intergenic
1135865554 16:26098577-26098599 CCTGTCAGGGGGTGGCAGGCTGG + Intronic
1135953661 16:26938048-26938070 CCTGTCAGGGGTTGGGGGGCTGG - Intergenic
1135988332 16:27201276-27201298 CCTGGCAGGGGGTGGGGTCCTGG + Intergenic
1136087857 16:27898346-27898368 CCTCGCAGGGGGTGGGTGGGCGG - Intronic
1136229819 16:28879608-28879630 GCTGGCTGGGGGTGTGAGGCTGG + Intronic
1136282208 16:29220542-29220564 CCCGGCACGTGATGGGAGCCTGG - Intergenic
1136398488 16:30005476-30005498 GCTGGCACGGGGAGGGCGCCGGG - Exonic
1136613177 16:31379669-31379691 ACTGGGCTGGGGTGGGAGGCTGG + Intronic
1137460868 16:48662078-48662100 CCTGTCAGGGGGTGGGGAGCTGG - Intergenic
1137531507 16:49281513-49281535 ACTGGGACGGGGGGGGCGGCTGG - Exonic
1137569653 16:49557294-49557316 CCTGGCAGGAGGAGGGAGGGGGG + Intronic
1137669268 16:50269857-50269879 CCTTTCATGGGGTGGGAGGGAGG + Intronic
1137780146 16:51091079-51091101 CCTGTCATGGGGTGGGCGGAGGG + Intergenic
1138100414 16:54247717-54247739 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1138164689 16:54790102-54790124 CCTGTCAGGGAGTGGGGGGCTGG - Intergenic
1138326565 16:56176257-56176279 CCTGTCAGGGGGTGGGGAGCTGG + Intergenic
1138521736 16:57575124-57575146 CCTGGCAGGGGGTGTATGGCTGG + Intronic
1138676743 16:58656783-58656805 CTTGGGGCGGGGTGGGGGGCAGG + Intergenic
1138749961 16:59408000-59408022 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1138752681 16:59443097-59443119 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1138783368 16:59815336-59815358 CCTGTCATGGGGTGGGGGCCAGG + Intergenic
1138812219 16:60164254-60164276 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1139187126 16:64820145-64820167 GCAGGCACAGGGTGGGAGGGTGG - Intergenic
1139299297 16:65931396-65931418 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1140129557 16:72148363-72148385 CCTGTCGGGGGGTGGGGGGCTGG + Intronic
1140150053 16:72353639-72353661 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1140218637 16:73028016-73028038 CCTGGGAGGAGGTGGGAGGTGGG - Intronic
1141038097 16:80645978-80646000 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1141760588 16:86026280-86026302 CCTGGCACGTGCAGCGAGGCTGG - Intergenic
1141892340 16:86934760-86934782 CCTGGCTCGGGGTGGGCTGCCGG + Intergenic
1142032095 16:87843714-87843736 ACTGGCACGGAGCAGGAGGCCGG + Intronic
1142086580 16:88186460-88186482 CCCGGCACGTGATGGGAGCCTGG - Intergenic
1142114480 16:88349081-88349103 CATGGCTCTGGGCGGGAGGCAGG + Intergenic
1142425273 16:89999259-89999281 CCGGACACGTGGTGGTAGGCTGG + Intergenic
1142426038 16:90002854-90002876 TCTGGCAGAGGGAGGGAGGCAGG - Intergenic
1142806945 17:2376275-2376297 CGGGGCTCAGGGTGGGAGGCGGG + Intronic
1143181641 17:4987441-4987463 CCTGGCGCGGGGGAGGAGGACGG + Intronic
1143388438 17:6545883-6545905 CCTGGCACAGGATAGGAGCCTGG - Intronic
1143413287 17:6725700-6725722 CCTGTCGTGGGGTGGGGGGCAGG + Intergenic
1143423738 17:6816379-6816401 CCTGTCAGGGTGTGGGGGGCTGG - Intronic
1143542576 17:7578495-7578517 CCTGGCTGGGGCTGGGTGGCAGG - Exonic
1143706293 17:8699682-8699704 CTTGGCCCAGGGTGGCAGGCAGG + Intergenic
1144092732 17:11872364-11872386 CATTGCAGGGGGTGGGGGGCGGG - Intronic
1144222228 17:13110426-13110448 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1144443879 17:15308871-15308893 ACAGGCAAGAGGTGGGAGGCGGG - Intronic
1144950660 17:18991908-18991930 CCTGCCAGGGTGTGGGAGGATGG + Intronic
1144959353 17:19036129-19036151 CCTGGCACGGGGTGGGAGGCTGG - Intronic
1144960132 17:19040119-19040141 CCTGGCAATGGCTGGAAGGCTGG - Intronic
1144975028 17:19134405-19134427 CCTGGCAATGGCTGGAAGGCTGG + Intronic
1144975806 17:19138395-19138417 CCTGGCACGGGGTGGGAGGCTGG + Intronic
1145017912 17:19411102-19411124 CCTGGCAGAGGCTGGGATGCAGG - Intergenic
1145083908 17:19919074-19919096 CCTGTCGTGGGGTGGGGGGCTGG - Intronic
1145125344 17:20295168-20295190 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1145194855 17:20883014-20883036 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1145198477 17:20917592-20917614 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1145733178 17:27209058-27209080 CCTGTCATGGGGTCGGGGGCTGG + Intergenic
1145999825 17:29124504-29124526 CCAGACACAGGGTGGGAGCCTGG + Intronic
1146066683 17:29641368-29641390 CCTGGAAGGGGGTGGGAGGTGGG - Intronic
1146161447 17:30561328-30561350 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1146282608 17:31554744-31554766 CCTGGGAAAGGGTGGGAAGCAGG + Intergenic
1146425998 17:32739486-32739508 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1146862923 17:36320898-36320920 CCTGTCATGGGGTAGGGGGCTGG - Intronic
1146912517 17:36657867-36657889 CCTGGCTCGGGGTGGGGGCTCGG + Intergenic
1147093252 17:38124981-38125003 CCTGTCATGGGGTAGGGGGCTGG - Intergenic
1147103955 17:38195507-38195529 CCTGTCATGGGGTAGGGGGCTGG + Intergenic
1147360547 17:39927248-39927270 CTCGGCTAGGGGTGGGAGGCGGG - Intronic
1147488699 17:40843505-40843527 GCTGGCAGGGGGTGGGAGAGTGG - Intergenic
1147531412 17:41281599-41281621 CCTGTCATGGGGTGGGGGTCAGG + Intergenic
1148105328 17:45115582-45115604 GCTGGCTAGGGGTGGGAGGCAGG + Intronic
1148206791 17:45784441-45784463 GGCGGCACGGGGTGGGCGGCCGG - Intronic
1148354772 17:46968495-46968517 CATGGCAGGGGCTGGGTGGCTGG - Intronic
1148425536 17:47592902-47592924 CCTGTCATGGGGTAGGGGGCTGG - Intronic
1148547225 17:48527624-48527646 CCTGGCTCTGGGCGGGAGGGAGG + Intergenic
1148777178 17:50102257-50102279 CCTGGCCCTGTGAGGGAGGCTGG + Intronic
1148780893 17:50121197-50121219 GGTGGCAGGGGGTGGGAGGTGGG - Intronic
1148975056 17:51520309-51520331 CCTGTCAGGGGGTGGGGTGCTGG - Intergenic
1149054211 17:52343482-52343504 CCTGTCACGGGGTGGGGGCTAGG - Intergenic
1149064187 17:52460578-52460600 CCTGGCGTGGGGTGGGGGGATGG + Intergenic
1149180469 17:53930815-53930837 CCTGTCAGGGTGTGGGGGGCTGG + Intergenic
1149315915 17:55438527-55438549 CCTGTCGGGGGGTGGGGGGCTGG + Intergenic
1149321590 17:55487195-55487217 CCTGTCATGGGGTGGGGGGTAGG + Intergenic
1149455405 17:56783977-56783999 CCTGTCAGGGGGTGGGATGGGGG - Intergenic
1150134607 17:62688999-62689021 CCTGGCACCGGGCTGGATGCTGG + Intronic
1150148010 17:62786375-62786397 CATGTCATGGGGTGGGGGGCTGG + Intronic
1150172621 17:63015465-63015487 CCTGTCATGGGGTGGGAAGCGGG - Intronic
1150218646 17:63483824-63483846 GCAGGCACAGGGTGGGAGTCAGG - Intergenic
1150251788 17:63709275-63709297 ACTGGCAGCGGTTGGGAGGCTGG - Intronic
1150426872 17:65084110-65084132 CCTGTCATGGGGTGGGGGGCTGG + Intergenic
1150739941 17:67771394-67771416 CCTGTCGTGGGGTGGGGGGCTGG - Intergenic
1150932874 17:69604063-69604085 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1151143147 17:72014663-72014685 CCTGTCATGGGGTGGGGGGCAGG + Intergenic
1151147188 17:72052203-72052225 CCTGTCATGGGGTGGGGAGCTGG + Intergenic
1151266666 17:72961731-72961753 CCTGTCAGGAGGTGGGGGGCTGG + Intronic
1151344445 17:73492986-73493008 CCTGGGAGGGGGTGGAAAGCGGG + Intronic
1151353224 17:73543700-73543722 TCTGGAAGAGGGTGGGAGGCTGG - Intronic
1151502659 17:74501548-74501570 CCTGTCAAGGGGTGGGGGGCTGG - Intergenic
1151573311 17:74938017-74938039 CCTGGGTTGGTGTGGGAGGCAGG + Intronic
1151598659 17:75093365-75093387 CCTGGCAGGAGGTGGCAGGAAGG - Intronic
1151700738 17:75741268-75741290 GCTGGTACCGGGTGGGGGGCTGG - Intronic
1151852832 17:76701139-76701161 CCTGGCAGGGGTGGGGAGGACGG + Intronic
1151955210 17:77376696-77376718 CCTGGCATGGGGAAAGAGGCAGG + Intronic
1152016445 17:77754004-77754026 CAGGGCTGGGGGTGGGAGGCAGG - Intergenic
1152042504 17:77913645-77913667 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1152110800 17:78356723-78356745 CAAGGCACGGGGCGGGGGGCGGG + Intergenic
1152517528 17:80834546-80834568 CCAGCCCCGGGGTGGGAGGCGGG - Intronic
1152522248 17:80863298-80863320 CCTGGCATGGGGAGTGATGCTGG - Intronic
1152737935 17:82006644-82006666 CCTGGCACCGGCGAGGAGGCTGG + Intronic
1152750602 17:82060814-82060836 CCTTGCAGGGGGTGAGGGGCTGG - Intronic
1152800222 17:82327363-82327385 CCTGGCGGGGGCTGGGAGGCTGG + Intronic
1152858517 17:82680290-82680312 CCTGGCCCTGGGTCGCAGGCAGG + Intronic
1152955085 18:32117-32139 CCTGTCAAAGGGTGGGAGGCTGG + Intergenic
1153001091 18:456056-456078 CAAAGCACGTGGTGGGAGGCTGG + Intronic
1153094547 18:1385365-1385387 CCTGTCATGGGGTGGGAGGAGGG + Intergenic
1154370036 18:13751963-13751985 CCTGTCATGGGGTGGGGGCCTGG + Intronic
1155162336 18:23206158-23206180 TCTGGGACGGGGCGGGAGGACGG - Intronic
1155476327 18:26238737-26238759 CCTGTCGTGGGGTGGGAGGAAGG - Intronic
1155478411 18:26259431-26259453 CCTGTCGCGGGGTGGGAGGAGGG - Intronic
1155691529 18:28630586-28630608 CATGTCATGGGGTGGGGGGCAGG + Intergenic
1155932406 18:31721179-31721201 CCTGTCGGGGGGTGGGGGGCTGG + Intergenic
1156363002 18:36400711-36400733 CCTGGAACAGGGATGGAGGCTGG + Intronic
1156434201 18:37108926-37108948 CCTGTCAGGGGGTGGGGGGCTGG - Intronic
1156517476 18:37693092-37693114 CCTGTCATGGGGTAGGGGGCAGG - Intergenic
1156743651 18:40363526-40363548 CCTGTCGTGGGGTGGGGGGCGGG - Intergenic
1156905950 18:42352291-42352313 CCTGTCATGGGGTGGGGGGCTGG - Intergenic
1156923091 18:42546856-42546878 CCTGTCGTGGGGTGGGGGGCTGG - Intergenic
1157062315 18:44305834-44305856 CCTGTCATGGGGTGGGCGGAGGG + Intergenic
1157219236 18:45813758-45813780 CCTGTCATGGGGTGGGTGGAGGG + Intergenic
1157231606 18:45921805-45921827 CCTGTCATGGGGTGGGGGGCTGG + Intronic
1157290547 18:46406589-46406611 CCTGCCAGGAGATGGGAGGCTGG + Intronic
1157337020 18:46748064-46748086 CCTGTCAGGGGGTGGAGGGCTGG + Intronic
1157537662 18:48471902-48471924 CCTGCCACGGGGTGGTTGACAGG + Intergenic
1157854547 18:51092996-51093018 CCTGTCAGGGGGTGGGGGCCTGG - Intergenic
1157903277 18:51541694-51541716 CCTGGTACAATGTGGGAGGCAGG + Intergenic
1158086434 18:53656885-53656907 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1158342865 18:56485546-56485568 CCTGTTGTGGGGTGGGAGGCTGG - Intergenic
1158343826 18:56494428-56494450 CCTGGCACGGGGAGGGTCGAAGG + Intergenic
1158804831 18:60958212-60958234 CCTGTCGTGGGGTGGGAGGACGG - Intergenic
1158911146 18:62063921-62063943 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1158959231 18:62574818-62574840 CCTGGTAAGGGGTAGGAAGCTGG - Exonic
1159237974 18:65702167-65702189 CCTGTCATGGGGTGGGCGGAGGG - Intergenic
1159302843 18:66597885-66597907 CCTGTCATGGGGTGGGAGGAAGG + Intronic
1159337769 18:67091798-67091820 CCTGTCGTGGGGTGGGAGGTGGG + Intergenic
1159569695 18:70098791-70098813 CCTGTCATGGGGTAGGAGGAGGG - Intronic
1159610150 18:70515797-70515819 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1159943458 18:74426306-74426328 CCTGGCAAAGGCTGTGAGGCTGG - Intergenic
1159954187 18:74507800-74507822 CCTGACAAGGAGAGGGAGGCCGG - Intronic
1160242607 18:77133731-77133753 CCCGGCCCGCGCTGGGAGGCGGG + Intergenic
1160607293 18:80061136-80061158 CCTGTCATGGGGTGTGGGGCAGG - Intronic
1160616275 18:80131842-80131864 CCTGTCATGGGGTGGGGGGCAGG + Intronic
1160635928 19:75283-75305 CCTGTCAGTGGGTGGGGGGCTGG - Intergenic
1160710590 19:549288-549310 CCTGTCAGGGGCTGGGGGGCGGG + Intronic
1160778873 19:869042-869064 CCTGGCAGATGGTGTGAGGCCGG - Intronic
1160906369 19:1453471-1453493 CCGGGCCCAGGGTGGGCGGCTGG - Exonic
1160909703 19:1468942-1468964 CTGGGCAGGGGCTGGGAGGCGGG - Exonic
1160915441 19:1494315-1494337 CCTGGGGCGGGGTGGGGGGCAGG - Intronic
1160982593 19:1823236-1823258 CCTGGCATTGGGTGGGGAGCAGG - Intronic
1161313814 19:3608764-3608786 GCTGGCGGGGGGTGGGGGGCGGG - Intergenic
1161366305 19:3881687-3881709 GCTGGCAGGGGGTGGGGGTCGGG + Intronic
1161395626 19:4043609-4043631 CCTGGGGTGGGGTGGGGGGCGGG + Intergenic
1161401140 19:4066636-4066658 CCCGGCACGGGGTGCAGGGCGGG - Intronic
1161466034 19:4431083-4431105 TCTGGAAAGGGGTGGCAGGCAGG - Intronic
1161562999 19:4984081-4984103 CCTGGCGTGGGGTGGGTGGAGGG + Intronic
1161669779 19:5600070-5600092 CCTGGCACGGGTGGGGAGTGGGG - Intronic
1162414522 19:10527080-10527102 CTTGCCATGGGTTGGGAGGCGGG - Intergenic
1163102571 19:15107321-15107343 GCTGGCGCGGGGCGGGGGGCGGG + Intergenic
1163126244 19:15245741-15245763 CCTGCCACCAGATGGGAGGCCGG + Intronic
1163302620 19:16457489-16457511 CTTGCCACGGGGAGGGAGGGAGG + Intronic
1163380838 19:16967332-16967354 CCTGTCGGGGGGTGGGGGGCCGG + Intronic
1163441231 19:17323647-17323669 CCCGGCAGGGGCTGGGGGGCGGG + Exonic
1163462524 19:17447793-17447815 CTTGGAAGTGGGTGGGAGGCGGG - Intronic
1163667655 19:18610798-18610820 CCTGGCTGGGGGCGGCAGGCGGG - Intronic
1163869269 19:19804926-19804948 CCTGTCATGGGGTGGGGGGATGG + Intronic
1163963342 19:20718787-20718809 CCTGTCAGGGGGTTGGGGGCTGG - Intronic
1163976747 19:20859845-20859867 CCTGTCAGGGGGTGGGGGTCTGG + Intronic
1164085057 19:21893836-21893858 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1164151022 19:22551443-22551465 CCTGTCAGGGGGTGGGGAGCTGG + Intergenic
1164395896 19:27862651-27862673 CCTGTTATGGGGTGGGAGGAGGG - Intergenic
1164423244 19:28116358-28116380 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1164456410 19:28411306-28411328 CCTGGCACTGAGTGGGAACCTGG - Intergenic
1164568916 19:29354305-29354327 CCTGTTATGGGGTGGGAGGAGGG + Intergenic
1164688109 19:30184805-30184827 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1165358570 19:35319323-35319345 CCAGGGACAGGGTGGGAGGCGGG - Intronic
1165722298 19:38088163-38088185 CCTGGCACGGTGCTGAAGGCTGG + Intronic
1166097080 19:40547177-40547199 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1166251788 19:41576354-41576376 CCTGGGAGTGGGTGGGAGGAGGG + Intronic
1166266528 19:41688064-41688086 CCTGGGAGTGGGTGGGAGGAGGG - Intronic
1166270202 19:41708811-41708833 CCTGGGAGAGGGTGGGAGGAGGG + Intronic
1166371293 19:42302600-42302622 CCCGGCACGGGGTGGGGGGAGGG + Exonic
1166562208 19:43740352-43740374 CATGTCAGGGGGTGGGAGGCGGG + Intronic
1166663384 19:44661912-44661934 TCTGGCACAGGGAGGGAGGCTGG - Exonic
1166745576 19:45140411-45140433 CCTGGTGGGGGGTGGGAGGTTGG + Intronic
1166777403 19:45321571-45321593 CCTGGCATGGAGTTGGAGCCTGG + Intronic
1166794711 19:45419517-45419539 CATGGCTCGCGGTGGGAAGCAGG + Intronic
1166888223 19:45973874-45973896 CCCTGCTCGGGGTGGGGGGCCGG + Intergenic
1167862032 19:52292963-52292985 CCTGTCGGGGGGTGGGGGGCTGG - Exonic
1167909424 19:52689956-52689978 CCCGGCACGAGGAGGGAGGTGGG + Intronic
1167940437 19:52942161-52942183 CCCGGCACGAGGAGGGAGGTGGG + Intronic
1167987920 19:53334151-53334173 CCTGGAACGAGGAGGGAGGTGGG - Intronic
1168180466 19:54659244-54659266 CCTGTCACGGGCTGGGGGGCTGG + Intronic
1202696223 1_KI270712v1_random:128669-128691 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
925519167 2:4722481-4722503 CCTGTCGCGGGGTGGGGGGTTGG - Intergenic
925657235 2:6162862-6162884 CCTGTCTTGGGGTGGGGGGCAGG + Intergenic
925756537 2:7138287-7138309 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
925900385 2:8505189-8505211 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
925920114 2:8632545-8632567 CCTGTCCTGGGGTGGGGGGCGGG - Intergenic
926649138 2:15322231-15322253 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
926851653 2:17204734-17204756 CCTGTCGGGGGGTGGGGGGCAGG - Intergenic
927519555 2:23690606-23690628 CCGGGCTCAGGGTGGGAAGCAGG + Intronic
927610226 2:24531604-24531626 CCTATCAGGGGGCGGGAGGCTGG - Intronic
927652861 2:24922790-24922812 CCCTTCATGGGGTGGGAGGCTGG - Intergenic
927889566 2:26739858-26739880 CCTGGCCCAGGGGAGGAGGCTGG + Intergenic
928426093 2:31179219-31179241 CCTGTCAGGGGGTGGGGGGCAGG - Intronic
928493484 2:31807491-31807513 CCTGCCAGGGGGTGGGTGGAGGG + Intergenic
928736783 2:34300582-34300604 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
928755605 2:34521881-34521903 CCTGTCATGGGGTCGGGGGCTGG + Intergenic
928776345 2:34768416-34768438 CCTGTCGGGGGGTGGGGGGCTGG + Intergenic
929090294 2:38209957-38209979 CCTGTCATGGGGTGGGGGGCTGG + Intergenic
929111768 2:38410925-38410947 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
929248447 2:39727714-39727736 CCTGTCGAGGGGTGGGGGGCTGG - Intergenic
929454191 2:42054703-42054725 CCTGGGAAGGGTTGGGAAGCAGG + Intronic
929737270 2:44563621-44563643 CCTGTCATGGGGTGGGGGGAAGG - Intronic
930119957 2:47752444-47752466 CCTGGCTCTGGGTGCCAGGCTGG - Intronic
930384260 2:50673941-50673963 CCTGTCAGGGGGTGGGGTGCTGG + Intronic
930941621 2:57021406-57021428 CCTGTCATGGGGTGGGGGGCAGG - Intergenic
931204094 2:60130324-60130346 CCTGTCATGGGGTGGGGGGATGG - Intergenic
931258842 2:60599232-60599254 TCTGGGAGGTGGTGGGAGGCAGG - Intergenic
931332971 2:61307308-61307330 CCTGTCATGGGGTGGGGGGAGGG + Intronic
931802200 2:65769512-65769534 CCTGTCAGGGGCTGGGGGGCTGG - Intergenic
931885202 2:66609792-66609814 CCTGTCCTGGGGTGGGGGGCAGG - Intergenic
931885912 2:66617248-66617270 CCTGTCGTGGGGTGGGGGGCAGG - Intergenic
932141409 2:69281448-69281470 CCTGTCAGGAGGTGGGGGGCTGG - Intergenic
932310696 2:70737568-70737590 CCTGTCATGGGGTGGGGGGAGGG + Intronic
932376973 2:71245273-71245295 CCTGTCAGGAGGTGGGGGGCTGG - Intergenic
932493871 2:72137170-72137192 CAGGGCACCGGGTGAGAGGCAGG - Intronic
932494324 2:72138973-72138995 CAGGGCACGGGGTGAGAGGCAGG - Intronic
932501134 2:72183576-72183598 TCTGGCAGGGGGTGGGAGCTGGG + Intronic
932595253 2:73089363-73089385 CCTGGTACCGGGCGGGAGCCAGG - Intronic
932830962 2:74989424-74989446 CCTGTCGGGGGGTGGGGGGCTGG + Intergenic
932856667 2:75241313-75241335 CCTGGGAAGGGCTGGCAGGCAGG - Intergenic
933017115 2:77141464-77141486 CCTGTCATGGGGTGGGGGGAGGG + Intronic
933070100 2:77846223-77846245 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
933323959 2:80812451-80812473 CCTGTCATGGGGTGTGGGGCTGG + Intergenic
933382660 2:81569393-81569415 CCTGTCAGGGGGTTGGGGGCTGG - Intergenic
934277389 2:91585700-91585722 CCTGTCATGGGGTGGGGGGAAGG + Intergenic
934495817 2:94796915-94796937 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
934505047 2:94883585-94883607 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
934539045 2:95159588-95159610 GCTGGCGCGGGGTGGCGGGCGGG - Exonic
934539056 2:95159612-95159634 GCTGGCGCGGGGTGGCGGGCGGG - Intronic
934539067 2:95159636-95159658 GCTGGCGCGGGGTGGCGGGCGGG - Intronic
934539078 2:95159660-95159682 GCTGGCGCGGGGTGGCGGGCGGG - Intronic
934938242 2:98480704-98480726 CCTGGCAAGGGATGGGGGCCAGG - Intronic
935192584 2:100790889-100790911 CCAGGGACTGGGAGGGAGGCGGG - Intergenic
935326376 2:101941350-101941372 TCTGCCACGGGGTGGAGGGCAGG + Intergenic
935399142 2:102641891-102641913 CCTGTCGGGGGGTGGGGGGCTGG + Intronic
936072449 2:109380375-109380397 CCTGGCACAGGGTGGGGCCCAGG + Intronic
936091084 2:109501799-109501821 CCTGGCCCAGGGTGGGGGCCAGG + Intronic
936224616 2:110636640-110636662 CCTGCCGTGGGGTGGGAGGAGGG + Intergenic
936252096 2:110874841-110874863 CATCCCTCGGGGTGGGAGGCAGG + Intronic
936565552 2:113579769-113579791 CCTGTCAGTGGGTGGGGGGCTGG + Intergenic
936648141 2:114395348-114395370 CCTGTCATGGGGTGGGAGGATGG + Intergenic
936795517 2:116198126-116198148 CCGGGCACGGTTTGGGAGGCTGG - Intergenic
936866445 2:117080151-117080173 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
936911725 2:117600742-117600764 CCTGCCAGTGGGTGGGGGGCTGG + Intergenic
937068071 2:119034242-119034264 CCTGTCAGGGGGTGGGGGGTTGG + Intergenic
937101502 2:119274380-119274402 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
937130665 2:119510133-119510155 CCTGTCAGGGGGTAGGGGGCTGG - Intronic
937290662 2:120779807-120779829 CCTGGCCCGGGGAGGCAGGATGG - Intronic
937337441 2:121070637-121070659 CCTGGCAGGGGGTGGGGGCAAGG - Intergenic
937354815 2:121191642-121191664 AGTGGCAGTGGGTGGGAGGCTGG + Intergenic
937407109 2:121640213-121640235 TCTGCCATGGGGTGGGGGGCCGG + Intronic
937612232 2:123876057-123876079 CCTGTCATGGGGTTGGGGGCAGG - Intergenic
938026826 2:127956547-127956569 CCTGTCATGGGGTGGGGGGAGGG + Intronic
938272756 2:129989649-129989671 CCTGTCATGGGGTGGGGGGATGG + Intergenic
938290024 2:130144019-130144041 GCGGGGACGGGGTGGGGGGCGGG + Intronic
938314106 2:130314705-130314727 CATGGCAGGGGGAGGGAGGGTGG - Intergenic
938364396 2:130723344-130723366 CCTGTCATGGGGTGGGAGAAGGG - Intergenic
938443479 2:131356469-131356491 CCTGTCATGGGGTGGGGGGATGG - Intergenic
938466500 2:131528918-131528940 GCGGGGACGGGGTGGGGGGCGGG - Intronic
938590600 2:132732285-132732307 CCTGTCAAGGGGTGGGGGGAGGG + Intronic
938684859 2:133728347-133728369 CCTGTCATGGGGTGGGGGGAAGG + Intergenic
938867932 2:135443376-135443398 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
938960499 2:136336271-136336293 GCTGGGACGAGTTGGGAGGCAGG + Intergenic
939019401 2:136941003-136941025 CCTGTCATGGGGTGGGGGGCTGG - Intronic
939077874 2:137625318-137625340 CCTGTCATGGGGTGGGGGGAGGG + Intronic
939127851 2:138199086-138199108 CCTGTCAGGGGGTGGGAGTTAGG + Intergenic
939298627 2:140303807-140303829 CCTGTCATTGGGTGGGAGGAGGG - Intronic
939328406 2:140725528-140725550 CCTGTCATGGGGTGGGGGGAGGG + Intronic
939526806 2:143305316-143305338 CCTGTCAGGGGGTCGGGGGCTGG + Intronic
939710928 2:145519283-145519305 CCTGTCTGGGAGTGGGAGGCTGG - Intergenic
939796269 2:146647835-146647857 CCTGTCAAGGGGTGGGGGCCTGG + Intergenic
939851278 2:147308891-147308913 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
939934530 2:148274376-148274398 CCTGTCATGGGGTGGGGGGCTGG - Intronic
939947723 2:148429839-148429861 CCTGTCATGGGGTGGGGGGCTGG + Intronic
940017526 2:149122567-149122589 CCTGTCATGGGGTGGGGGGAGGG - Intronic
940140312 2:150485801-150485823 CCTGGCGCGCGGTGGTAGGGAGG - Intronic
940298581 2:152155848-152155870 CCTCACACGTGGTGTGAGGCAGG + Intronic
940592998 2:155752859-155752881 CCTGTCATGGGGTGGGGGGGTGG + Intergenic
940703325 2:157073595-157073617 CCTGTCAGGGAGTGGGGGGCTGG + Intergenic
940839421 2:158561926-158561948 CCTGTCGGGGGGTGGGGGGCTGG - Intronic
940852387 2:158700961-158700983 CCAGACATGGGGTGGGAGGAGGG + Intergenic
940855083 2:158723396-158723418 GCTGGCACTGGCTGTGAGGCTGG - Intergenic
940891135 2:159036507-159036529 CCTGTCATGGGGTGGGAGGATGG - Intronic
940978225 2:159970945-159970967 CCTGTCGGGGGGTGGGGGGCTGG + Intronic
940989982 2:160086981-160087003 CCTGTTAGGGGGTGGGGGGCTGG + Intergenic
940996367 2:160154426-160154448 CCTGTTATGGGGTGGGGGGCTGG + Intronic
941463145 2:165794297-165794319 GCTGGGGCGGGGCGGGAGGCTGG - Exonic
941514802 2:166459971-166459993 CCTGTCAGAGGGTGGGAGGAAGG + Intronic
941532940 2:166691774-166691796 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
941550298 2:166907762-166907784 CCTGTCATGGGGTGGGGGGAGGG - Intronic
941806623 2:169716824-169716846 CCTGGGGCGGGGTGGGGGGGTGG - Intronic
941987004 2:171520017-171520039 ACTGGCAGGGGGTGCTAGGCTGG + Intergenic
942108197 2:172654603-172654625 CCTGTCGTGGGGTGGGGGGCTGG + Intergenic
942368221 2:175252523-175252545 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
942466949 2:176218300-176218322 CCTGTCAGGGCGTGGGGGGCTGG - Intergenic
942588849 2:177518666-177518688 AGTGGCAAGGGGTGGGGGGCGGG - Intronic
942640429 2:178055340-178055362 CCTGTCATGGGGTGGGGGGGAGG + Intronic
942652194 2:178180653-178180675 CCTGTCAGGGGGTTGGGGGCAGG - Intergenic
942728779 2:179040532-179040554 CCTGTCAGAGGGTGGGAGGTGGG - Intronic
943084324 2:183294555-183294577 CCTGTCAGGGGGTGGTGGGCTGG - Intergenic
943277218 2:185882836-185882858 CCTGTCGTGGGGTGGGAGGAGGG - Intergenic
943426067 2:187735085-187735107 CCTGTCGTGGGGTGGGAGGAGGG + Intergenic
943584128 2:189717930-189717952 CCTGTTCTGGGGTGGGAGGCAGG + Intronic
943908319 2:193529601-193529623 CCTGTCAGGGGGTAGGGGGCTGG - Intergenic
943943246 2:194025688-194025710 CCTATCATGGGGTGGGAGGAGGG + Intergenic
943945225 2:194052306-194052328 CCTGTCATGGAGTGGGGGGCAGG + Intergenic
944033329 2:195263950-195263972 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
944195422 2:197048337-197048359 CCTGTCAGGGAGTGGGGGGCAGG - Intronic
944334055 2:198508633-198508655 CCTGTCAGGGGGTGGGGGGCTGG - Intronic
944375292 2:199034429-199034451 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
944615078 2:201451686-201451708 CCAGCCCCGGGGAGGGAGGCGGG + Exonic
944655089 2:201869372-201869394 CCTGTCATGGGGTGGGGGGCAGG + Intronic
945115861 2:206407355-206407377 CCTGTCCTGGGGTGGGAGGCTGG - Intergenic
945314890 2:208360605-208360627 CCTGGCGCTTGGTGGGTGGCTGG - Intronic
945318722 2:208397148-208397170 CCTGTTGTGGGGTGGGAGGCTGG + Intronic
945350013 2:208766125-208766147 CCTGTCATGGGGTGGGGGGAGGG + Intronic
945417749 2:209595948-209595970 CCTGTCATGGGGTAGGAGGCAGG + Intronic
946085730 2:217169316-217169338 CCTGTCAGGGGCTGGGGGGCTGG - Intergenic
946179946 2:217943028-217943050 CCTGGGAACGGGTGGCAGGCAGG + Intronic
946205345 2:218102753-218102775 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
946586226 2:221190797-221190819 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
946696589 2:222366152-222366174 CCTGTTGCGGGGTGGGGGGCTGG - Intergenic
946875974 2:224130259-224130281 CCTGTCAGGGGGTGGGAGACTGG + Intergenic
946925506 2:224622829-224622851 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
947055171 2:226091904-226091926 CCTGGTAGGGGGTGGAAAGCAGG - Intergenic
947371915 2:229455666-229455688 CGTGGCAAGAGGTGGGAGGTAGG + Intronic
947613109 2:231536064-231536086 CCTGCCCCGGGGTGAGAGACAGG + Intergenic
947627252 2:231627741-231627763 CCTGGAATGTGGTGGGAGGGAGG - Intergenic
947837861 2:233188317-233188339 CCTGGCAGGCGGTGGCAGGGAGG - Intronic
947877537 2:233477667-233477689 CCTGGCACAGGGCTGGTGGCAGG - Intronic
948205197 2:236159773-236159795 CCGGGCCCGGGGTGGGGGGGCGG - Intergenic
948406871 2:237728425-237728447 CCAGTTAAGGGGTGGGAGGCAGG + Intronic
948431566 2:237922384-237922406 CCTGGCCCGCTGTGTGAGGCTGG - Intergenic
948465146 2:238148630-238148652 CCAGGCCCGGGGTTGGGGGCTGG + Intronic
948612049 2:239176183-239176205 CCGGGCAGAGGGAGGGAGGCCGG - Intronic
948612078 2:239176267-239176289 CCGGGCAGAGGGAGGGAGGCCGG - Intronic
948612086 2:239176286-239176308 CCGGGCAGAGGGAGGGAGGCCGG - Intronic
948612115 2:239176370-239176392 CCAGGCAGAGGGAGGGAGGCCGG - Intronic
948889311 2:240899199-240899221 CCTGGCACGCGGTGGTATGGGGG - Intergenic
948893357 2:240917393-240917415 CCTGGCTGGGGTTGGGAGGAGGG + Intergenic
1168844868 20:937417-937439 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1169234669 20:3921198-3921220 CCTGCCATGGGGTGGGGGGAGGG - Intronic
1169261086 20:4138593-4138615 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1169464719 20:5827301-5827323 CCTGGCAGGAGGTGGAAGGAGGG - Intronic
1169634859 20:7678154-7678176 TCTGTCATGGGGTGGGAGGAGGG + Intergenic
1169862282 20:10165385-10165407 CCTGTCGGGGGGTGGGGGGCTGG + Intergenic
1169882215 20:10359084-10359106 CCTGTCAGGGGGTGGGGGGTAGG + Intergenic
1169896360 20:10509069-10509091 CCTGACTCGGAGTGGGAGGAGGG - Intronic
1170054907 20:12191471-12191493 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1170186753 20:13599520-13599542 CCTGTCAGGCGGTGGGGGGCTGG + Intronic
1170324588 20:15142659-15142681 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1170391158 20:15876262-15876284 CCTGCTATTGGGTGGGAGGCAGG - Intronic
1170413498 20:16115721-16115743 CCTGGCCCCTGGTGGGAGGTGGG - Intergenic
1170483094 20:16787978-16788000 CCTGTCGGGGGGTGGGAGGCTGG - Intergenic
1170832289 20:19853030-19853052 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1171001351 20:21418928-21418950 CCTGTCGTGGGGTGGGAGGGTGG + Intergenic
1171083079 20:22208580-22208602 CCTGTCAGGGGGTGGGGAGCTGG - Intergenic
1171088002 20:22256121-22256143 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1171140830 20:22740616-22740638 CCTGCCATGGGGTGGGGGGAGGG + Intergenic
1171934680 20:31263191-31263213 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1172055697 20:32152794-32152816 CCAGGCTCGGGGTAGGAGGTGGG - Intronic
1172114367 20:32564902-32564924 ACTGTCAAGGGCTGGGAGGCTGG + Intronic
1172149019 20:32777634-32777656 CCTGGCATAGAGTGGGAGGTGGG - Intronic
1172455726 20:35071429-35071451 CCTGGCATGGGGTGGGGGGAGGG - Intronic
1172502469 20:35437169-35437191 TCTGGCCCGGGGTGGGTGTCTGG - Intronic
1172755552 20:37281357-37281379 CCTGGGCCGGGGTGGGGGGCGGG + Intergenic
1172765095 20:37346657-37346679 CCCGGCCCCGGGTGGGAGGTGGG + Intronic
1172830254 20:37827911-37827933 CATGGCATGGGGTGGGCTGCAGG - Intronic
1173144928 20:40516221-40516243 CCTGTCAGGGGGTGGGGGCCTGG - Intergenic
1173413468 20:42836213-42836235 CCTGGCCCTATGTGGGAGGCGGG - Intronic
1173479313 20:43386605-43386627 CCTGGCACGGTGTTGGATCCTGG - Intergenic
1173579539 20:44137398-44137420 CCTGGGGAGGGGCGGGAGGCGGG - Intronic
1173688757 20:44942680-44942702 CCTGGGCCGGGGTGGAAGGAGGG - Exonic
1174075436 20:47932204-47932226 CCTGGCAGAGGCTGGGAGGTGGG + Intergenic
1174083377 20:47986938-47986960 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1174096828 20:48096424-48096446 CCAGGCACTGGGAGGGAGGCTGG - Intergenic
1174459121 20:50670371-50670393 GCTGGCACTGGGTGGGTGGGTGG - Intronic
1174560107 20:51425072-51425094 CCTGGCTGGGGGTGGGGGGTTGG + Intronic
1175268480 20:57717089-57717111 CCATGCATGGGGTGGGTGGCGGG - Intergenic
1175715531 20:61252487-61252509 CCGGGCACCGGGCGGGCGGCGGG + Exonic
1175751041 20:61498050-61498072 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1175834533 20:61985017-61985039 CGGGGCAGGGGGTGGGAGGATGG + Intronic
1175870756 20:62208398-62208420 CCTGGTAGGGGGCGGCAGGCTGG - Intergenic
1175964537 20:62653883-62653905 CCTGCCATGGGGTGGGGGGAGGG + Intronic
1175989177 20:62779032-62779054 CCTGGCTGGGGCTGGGATGCGGG - Intergenic
1176069175 20:63217120-63217142 CCTGGAATGGGGTGTCAGGCAGG + Intergenic
1176670191 21:9726734-9726756 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1176736730 21:10556190-10556212 CCTGTCATGGGGTGGGGGGATGG - Intronic
1177122717 21:17157739-17157761 CCTGTCATGGGGTAGGGGGCTGG + Intergenic
1177126872 21:17204986-17205008 CCTGTCAGAGGGTGGGGGGCTGG + Intergenic
1177672980 21:24257323-24257345 CCTGTCGGGGGGTGGGGGGCTGG + Intergenic
1177849349 21:26328161-26328183 CCTGTCATGGGGTGGGGGGATGG - Intergenic
1178232688 21:30804851-30804873 CCTGTCAGGGAGTGGGGGGCAGG + Intergenic
1178402285 21:32297283-32297305 CCTGGAAAGGGGAGAGAGGCTGG + Intronic
1178463416 21:32824092-32824114 CCTGTCAGGGGGTGGGGGGTTGG + Intergenic
1178518202 21:33266313-33266335 CCTGCAGCGGGGTGGGAGCCCGG + Intronic
1178533822 21:33396553-33396575 CCAGGCGGGGGGTGGGGGGCGGG - Intergenic
1178748003 21:35272086-35272108 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1179209532 21:39313494-39313516 CCGGGCGCGGGGCGGGAGGCGGG + Exonic
1179591762 21:42413680-42413702 ACTGTGACGGGGTTGGAGGCTGG + Intronic
1180464376 22:15597884-15597906 CCTGGAGAGGGGTAGGAGGCAGG - Intergenic
1180562718 22:16633650-16633672 CCTGTCATGGGGTGGGGGGATGG - Intergenic
1180656638 22:17427008-17427030 CCTGTCGTGGGGTGGGGGGCTGG - Intronic
1180698323 22:17768424-17768446 CCTGGGCAGGGGAGGGAGGCAGG - Intronic
1180743179 22:18067826-18067848 CCTGGCACATGGTGGGCGACGGG + Intergenic
1180878301 22:19185683-19185705 CGTGGCTCGGAGTGGGTGGCTGG + Intronic
1181177220 22:21044739-21044761 AATGGGACGGGGTGGGAGGTAGG - Intergenic
1181410104 22:22712577-22712599 CCTGCTGCAGGGTGGGAGGCTGG + Intergenic
1181447808 22:22991882-22991904 CCTGTCATGGGGTGGGAGGCTGG + Intergenic
1181449215 22:23006665-23006687 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1181465437 22:23108219-23108241 CCCAGCACGGGGTGGATGGCAGG - Intronic
1181492416 22:23268857-23268879 CCTGGCACTGGAGGCGAGGCCGG + Intronic
1181562819 22:23715508-23715530 CCTGTCACAGGGAGGAAGGCTGG + Intergenic
1181672745 22:24433304-24433326 CCTGGGCCGGGCTGGGAGCCAGG + Exonic
1181860790 22:25816491-25816513 CCTGTCTGGGGGTGGGGGGCTGG - Intronic
1181934285 22:26428229-26428251 CCTGGGACAGGGAGGGAGGTGGG + Intergenic
1181961471 22:26625008-26625030 CCTGCCAGGGTGTGGGAGACGGG - Intronic
1181997932 22:26897686-26897708 GCTGGTAAGGGGTGGGAGGGAGG + Intergenic
1182058086 22:27376428-27376450 CCTGTCAGAGGGTGGGGGGCTGG + Intergenic
1182331720 22:29555713-29555735 TCTAGCAGGGGGAGGGAGGCAGG + Exonic
1182423183 22:30258202-30258224 CCTGGTGGAGGGTGGGAGGCAGG + Intergenic
1182610075 22:31540178-31540200 TCTGGCACGGGGTGGGGGGGTGG + Intronic
1182704058 22:32264031-32264053 CCTGTCATGGGGTTGGGGGCTGG + Intergenic
1182865229 22:33598521-33598543 CCTGTCAGGGGGTGGGGGCCTGG - Intronic
1182903989 22:33920873-33920895 CCTGGCCGGGCGCGGGAGGCGGG - Intronic
1183186063 22:36292315-36292337 CCTTCCACGGTGTGGCAGGCAGG - Intronic
1183363834 22:37396876-37396898 CCTGGCATGGACTTGGAGGCTGG - Intronic
1183383650 22:37502984-37503006 CTGGGCTCGGGGTGAGAGGCTGG + Intronic
1183482924 22:38074847-38074869 CCTGGACTGGGGTGGGAGGTCGG - Exonic
1183532405 22:38366486-38366508 CCTGTCATGGGGTGGGGGGATGG + Intronic
1183718755 22:39549964-39549986 CCTGGCACATGGTGGGAGCTTGG + Intergenic
1183828714 22:40406853-40406875 CCTGGCACGGTTTGGGAGGAAGG + Intronic
1184033530 22:41908206-41908228 CCCAGCAGGGGGTGGGAGGTGGG + Intergenic
1184194627 22:42918724-42918746 CCTGGCAGGTGGTGGGACTCTGG - Intronic
1184242121 22:43216857-43216879 CCTGGCGGGGGGTGGGTGGGGGG - Intronic
1184275499 22:43407391-43407413 TCTGGCACCAGGTGGGGGGCAGG + Intergenic
1184301293 22:43562631-43562653 CCTGGTGCGGGGTGGGAGGGAGG + Intronic
1184301326 22:43562710-43562732 CCTGGTGCGGGGTGGGAGGGAGG + Intronic
1184301359 22:43562789-43562811 CCTGGTGCGGGGTGGGAGGGAGG + Intronic
1184334947 22:43847600-43847622 CTTGGAAGGGGGTGGGAGGCTGG - Intronic
1184357843 22:43994451-43994473 CCTGGCGTGTGGTGGGAGGTGGG + Intronic
1184523399 22:45008498-45008520 CCTGGGATGGGGCGGGAGGGTGG - Intronic
1184613729 22:45623454-45623476 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1184648662 22:45909607-45909629 CCAGGCCTGGGGTGGGAGGAGGG + Intergenic
1184657022 22:45947019-45947041 CCTGGCATGGGCTGGGAGCTGGG - Intronic
1184680736 22:46071186-46071208 CCTTGCCCGGGGCGGGCGGCGGG + Intronic
1184834481 22:47013047-47013069 TCGCGCACGGGGCGGGAGGCTGG - Intronic
1184986906 22:48141898-48141920 CAGGACACGGGGTGGGGGGCGGG + Intergenic
1185118023 22:48949119-48949141 GCTGGAATGGGGGGGGAGGCTGG - Intergenic
1185138421 22:49086964-49086986 CCTGGAGTGGGGTGGGAAGCCGG - Intergenic
1185147589 22:49147679-49147701 CCTGGCAGTGGGGAGGAGGCTGG + Intergenic
1185402138 22:50624730-50624752 CCAGGAACGGGGTGGGAGGGTGG - Intronic
949105806 3:198164-198186 GCGGGGAAGGGGTGGGAGGCCGG + Intronic
949414508 3:3800269-3800291 CCGGGGACGGGGAGGGAGGAGGG + Intronic
949421290 3:3868714-3868736 CCTGTCATGGGGTGGGGGGAGGG + Intronic
949427668 3:3936863-3936885 CCTGTCATGGGGTGGGGGGAGGG - Intronic
949450564 3:4180536-4180558 CCTGTCATGGGGTGGGGGGCTGG + Intronic
949579340 3:5371625-5371647 CCTGTCAAGGGTTAGGAGGCTGG - Intergenic
949617882 3:5775108-5775130 CCTGTCGGGGGGTGGGAGGATGG - Intergenic
949631634 3:5934535-5934557 CCTGTCGGGGGGTGGGAGACTGG - Intergenic
949945551 3:9187110-9187132 CCTGTCGGGGGGTGGGGGGCTGG - Intronic
949960200 3:9305557-9305579 CCTGTCGGGGGGTGGGAGACTGG - Intronic
950183387 3:10930406-10930428 CCTGGCATGGGGTGGGTGCTCGG + Intronic
950383896 3:12641206-12641228 CCTGTCATGGGGTGGGGGGAGGG + Intronic
950449687 3:13058698-13058720 CATGGCGAGGGATGGGAGGCAGG - Intronic
950862188 3:16159020-16159042 CCTGTCATGGGGTGGGGGCCTGG - Intergenic
951189840 3:19755410-19755432 CCTGTCGTGGGGTGGGGGGCTGG - Intergenic
951204184 3:19909031-19909053 CCTTGTAGGGGGTGGGGGGCGGG - Intronic
951485381 3:23203595-23203617 CCGGGCACGGGGAGCGAGGAAGG - Intronic
952016498 3:28962708-28962730 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
952088900 3:29860426-29860448 GTTGGCATGGGGTGGGAGGTGGG + Intronic
952113546 3:30153105-30153127 CCTGTCATAGGGTGGGAGGCTGG - Intergenic
952118428 3:30212915-30212937 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
952254336 3:31682439-31682461 CCTGGCACGGGGATGGAGACAGG - Intronic
952457118 3:33483805-33483827 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
952724331 3:36567488-36567510 CCTGTCAGGGGCTGGGGGGCTGG - Intergenic
952813450 3:37425503-37425525 CCTGTCGGGGGGTGGGAGGCTGG - Intronic
952939295 3:38429704-38429726 CCTGTCATGGGGTGGGGGCCTGG - Intergenic
953204028 3:40805017-40805039 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
953246804 3:41200049-41200071 CCGGGCCCTGGGTGGGGGGCGGG + Intronic
953271919 3:41454020-41454042 CCTGTCATGGGGTGGGGGGAGGG + Intronic
953652133 3:44816390-44816412 CCTGTCAAGGGGTGGGGGGCTGG - Intronic
953702765 3:45209600-45209622 AGGTGCACGGGGTGGGAGGCAGG + Intergenic
953979330 3:47405893-47405915 CCTGGGAGGGAGTGGGAGGATGG - Exonic
954061835 3:48074301-48074323 CCTGTCATGGGGTGGGGGGAGGG + Intronic
954277085 3:49549403-49549425 CCTGGCACTGAGTAGGAGTCAGG + Intergenic
954415044 3:50389154-50389176 CCTGGGGCGGGGGCGGAGGCCGG + Intronic
954511980 3:51133311-51133333 CCTGTCATGGGGTGGGGGGAGGG - Intronic
954572489 3:51653774-51653796 CCTGGCATGGTGTGGGGGGATGG + Intronic
954713692 3:52516930-52516952 GCAGGCACGGGGCCGGAGGCAGG - Intronic
954835948 3:53468109-53468131 CCTGTCGTGGGGTGGGAGGAGGG - Intergenic
955361123 3:58275791-58275813 CCAGGCAGGGGGTAGGGGGCTGG - Intronic
955742599 3:62108193-62108215 CCTGTTGCGGGGTGGGGGGCTGG - Intronic
956027732 3:65001472-65001494 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
956420914 3:69085509-69085531 CCTGGCACGCGGGCGGGGGCAGG - Intronic
956606925 3:71082469-71082491 CCTGTCAGGGGGTGGGGGGTAGG + Intronic
956614435 3:71156893-71156915 CCTGGCCCAGTGTGGCAGGCAGG - Intronic
956792982 3:72694328-72694350 CATGGCAGGGGGTGGCAGGGTGG + Intergenic
957562052 3:81834603-81834625 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
957644334 3:82901578-82901600 CCTGTCATGGGGTGGGGGGAAGG - Intergenic
957644890 3:82907997-82908019 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
957695019 3:83624551-83624573 CCTGTCAGGGGGTGAGGGGCTGG + Intergenic
957713392 3:83893319-83893341 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
958087348 3:88827382-88827404 CCTGTCGGGGGGTGGGGGGCTGG - Intergenic
958443167 3:94180843-94180865 CCTGTCTTGGGGTGGGAGGAGGG - Intergenic
958708538 3:97688568-97688590 CCTGTCATGGGGTGGGGGGAGGG + Intronic
958769951 3:98414335-98414357 CCTGTCAGAGGGTGGGAGGTAGG - Intergenic
958811545 3:98865857-98865879 CCTGTCATGGGGTGGGGGGAGGG - Intronic
958812908 3:98882569-98882591 CCTGTCAGAGGCTGGGAGGCTGG - Intronic
958874016 3:99594837-99594859 CCTGTCAGGGGGTGGGGCGCTGG + Intergenic
959045833 3:101472494-101472516 CCTGTCGCGGGGTGGGGAGCTGG + Intronic
959173574 3:102875377-102875399 CCTGTCATGGGGTTGGGGGCTGG + Intergenic
959487276 3:106941349-106941371 CCTGTCGTGGGGTCGGAGGCTGG + Intergenic
959726187 3:109544155-109544177 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
959741527 3:109726102-109726124 CCTGTCATGGGTTGGGAGGATGG - Intergenic
960276212 3:115732306-115732328 CCTGTCATGGGGTGGGGGGCAGG - Intergenic
960772323 3:121208326-121208348 CCTGTCATGGGGTGGGGGGAGGG + Intronic
960782943 3:121340479-121340501 CCTGTCGGGGGGTGGGAGGCTGG - Intronic
960835496 3:121902507-121902529 CCTGTCATGGGGTGGAGGGCTGG - Intronic
960911895 3:122657618-122657640 CCTGTCAGGTGGTGGGAGGCTGG + Intergenic
960912912 3:122667312-122667334 CCTGTCGTGGGGTGGGGGGCAGG - Intergenic
960946316 3:122969280-122969302 CCTGGAAGGAGGTGGGAAGCAGG - Intronic
960963345 3:123088077-123088099 CCCGGCAGAGGGTGGGAGGATGG - Intronic
960995112 3:123335594-123335616 CCTGGCACTGTGAGGGAGGTGGG + Intronic
961311091 3:126001906-126001928 CCTGTCATGGGGTAGGGGGCAGG + Intergenic
961353576 3:126319833-126319855 ACTGGCTCGGGGTGGGGTGCAGG + Intergenic
961363633 3:126384896-126384918 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
961395555 3:126586149-126586171 CCTGTCGTGGGGTGGGAGGAGGG - Intronic
961577364 3:127848887-127848909 CCTGGCAAGGGATAGGAGGTAGG + Intergenic
961771453 3:129253053-129253075 GCTGCCACGGGGTGGGCAGCTGG - Intronic
961823914 3:129588874-129588896 CCTGGGACGGGGTGGCTGGCAGG + Intronic
961857595 3:129888159-129888181 TCTGGCAGATGGTGGGAGGCAGG + Intronic
961984282 3:131116123-131116145 CCTGTCATGGGGTGGGGGGAAGG - Intronic
962075076 3:132073021-132073043 CCTGTCATGGGGTGGGTGGAGGG + Intronic
962201115 3:133401855-133401877 CCTGGGATGAAGTGGGAGGCAGG - Intronic
962201269 3:133403092-133403114 CCTGGAAAGGGGTGGGGGCCTGG - Intronic
962480034 3:135790032-135790054 CCTGTCATGGGGTGGGGGGCAGG - Intergenic
962861839 3:139410574-139410596 CCTGTCATGGGGTGGGGGGCTGG + Intergenic
962950731 3:140216208-140216230 CATGGATGGGGGTGGGAGGCGGG - Intronic
963159428 3:142135553-142135575 CCTGTCATGGGGTGGGAGGCTGG - Intronic
963173395 3:142274064-142274086 CCTGTCGTGGGGTGGGGGGCTGG - Intergenic
963527673 3:146434919-146434941 CCTGTCATGGGGTGGGGGGAGGG - Intronic
963613998 3:147511413-147511435 CCTGTCCAGGGGTGGGAGACAGG - Intergenic
963980806 3:151534647-151534669 CCTGTCATGGGGTGGGGAGCTGG + Intergenic
964264697 3:154880979-154881001 CCTGTCAGGGAGTGGGGGGCTGG + Intergenic
964371880 3:156008687-156008709 CCTGTCAGGGGGTAGGGGGCTGG - Intergenic
964560334 3:157988261-157988283 CCTGTCATGGGGTGGGTGGAGGG + Intergenic
964560948 3:157995423-157995445 CCTGTCAGGGGGTAGGGGGCTGG + Intergenic
964581156 3:158239567-158239589 CCTGTCATGGGGTGGGGGGCTGG + Intronic
964719963 3:159761589-159761611 CCTGGCAGGAGATGGAAGGCTGG + Intronic
965204642 3:165705616-165705638 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
965352500 3:167631109-167631131 CCTGTCAGGGGGTGGGGAGCTGG + Intronic
965489529 3:169319417-169319439 CCTGTCAGGGGGTGGGGGGTAGG + Intronic
965518338 3:169646301-169646323 CCTGTCATGGGGTGGGGGGAGGG + Intronic
965739526 3:171859143-171859165 CCTTTCAGTGGGTGGGAGGCTGG + Exonic
966215639 3:177499416-177499438 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
966460167 3:180167591-180167613 CCTGTCATGGGGTGGGAGAGTGG + Intergenic
966480976 3:180408054-180408076 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
966487820 3:180490682-180490704 CCTGTCATGGGGTGGGGGGTGGG + Intergenic
966536508 3:181041043-181041065 CCTGTCATGGGGTGGGCGGAGGG - Intergenic
966569930 3:181430118-181430140 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
966589742 3:181668828-181668850 CCTGTCGGGGGGTGGGAGACTGG + Intergenic
967469243 3:189843260-189843282 CCTGGCAGGTGGTGGGAGTGGGG - Intronic
968132059 3:196197765-196197787 CCTGGCACGAGCTGCGGGGCGGG - Intronic
968554230 4:1239243-1239265 CCTGGCACGGGGCGGTCGGGCGG - Intronic
968588884 4:1447852-1447874 CCTGTCACTGGGTGGCAGTCTGG - Intergenic
968649823 4:1756097-1756119 CCTGGCTGTGGGTGGGAGCCAGG - Intergenic
968656093 4:1779059-1779081 CCAGGCACGAGGTAGGATGCAGG - Intergenic
968662873 4:1806028-1806050 CTGGGGAAGGGGTGGGAGGCAGG - Intronic
968810554 4:2797821-2797843 CCTGCCCAGGAGTGGGAGGCTGG - Intronic
968939598 4:3631056-3631078 CCTGGGGTGGGGTGGGAGGGGGG + Intergenic
968941338 4:3640347-3640369 GATGGCATGGGGTGGGAGGAGGG + Intergenic
969102216 4:4777668-4777690 CCTGGCAGTGGGGGGGATGCTGG + Intergenic
969153352 4:5188856-5188878 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
969184673 4:5466237-5466259 GCTGCCAGGGGGCGGGAGGCGGG + Intronic
969347860 4:6580495-6580517 GCTGGCACGGGGCAGGAGGCAGG - Intronic
969458282 4:7313522-7313544 CCAGGCACGGGGAGGAAGGAGGG + Intronic
969478605 4:7435002-7435024 CCGGGCACAGGGTGTGAGTCAGG - Intronic
969489332 4:7490314-7490336 CCTGGCAGAGGGAGGCAGGCTGG - Intronic
969569212 4:7998708-7998730 CCTGCCACTGCATGGGAGGCTGG + Intronic
969991731 4:11271358-11271380 CCCAGCACAGGGTGGAAGGCTGG + Intergenic
970304238 4:14715039-14715061 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
970441474 4:16083849-16083871 CCTCGGACGTGGCGGGAGGCAGG + Intronic
970615871 4:17767702-17767724 GCTGGCGGGGGGTGGGGGGCGGG - Intronic
970796135 4:19915822-19915844 CCTGTCATGGGGTGGGGGGGCGG - Intergenic
970884237 4:20968770-20968792 CCTGTCAAGGGGTGGGGGGCTGG + Intronic
970918009 4:21358162-21358184 CCTGTCAGGTGGTGGGGGGCTGG + Intronic
970954462 4:21794116-21794138 CCTGTCACGGGGTAGGGGGAGGG + Intronic
971099419 4:23446997-23447019 CCTGTCGTGGGGTGGGAGGATGG - Intergenic
971526118 4:27620939-27620961 CCTGGGAGGGGCTGGCAGGCAGG - Intergenic
972109621 4:35541461-35541483 CCTGGGATGGGCTGGCAGGCAGG - Intergenic
972178243 4:36434237-36434259 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
972555307 4:40175388-40175410 CCTGGGGCAGGGTGGGAGGTAGG + Intergenic
972905847 4:43745964-43745986 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
973561272 4:52138661-52138683 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
973581632 4:52349642-52349664 CGGGGCAGGGGGTGGGAGGTGGG + Intergenic
973632052 4:52828750-52828772 CCTGTCGTGGGGTGGGAGGAGGG - Intergenic
973678750 4:53293878-53293900 CCTGTCAGGGGGTGGGAGGCTGG - Intronic
973782561 4:54301932-54301954 CCTGTCAGGGGGTGGGGGGCCGG + Intergenic
973836318 4:54813053-54813075 CCTGTCATGGGGTGGGGGCCAGG + Intergenic
973874007 4:55195958-55195980 CCTGTCAGGGGGTGGGGGGAAGG + Intergenic
974077403 4:57179971-57179993 CCTGTCATGGGGTGGGGGGAAGG - Intergenic
974114082 4:57559430-57559452 CCTGTCAGGGGGTCGGGGGCTGG - Intergenic
974145860 4:57946304-57946326 CCTGTCGTGGGGTGGGAGGAGGG + Intergenic
974264375 4:59565456-59565478 CCTGTCATGGGGCGGGGGGCTGG - Intergenic
974470748 4:62315219-62315241 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
974587856 4:63902888-63902910 CCTGTCGTGGGGTGGGTGGCTGG - Intergenic
974758817 4:66248695-66248717 CCTGTCACGGTGTGGGGAGCTGG + Intergenic
974806875 4:66891957-66891979 CCTTTCAGAGGGTGGGAGGCGGG + Intergenic
974842786 4:67317554-67317576 CCTGTCAATGGGTGGGGGGCTGG - Intergenic
974964691 4:68746625-68746647 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
975087172 4:70355908-70355930 CCTGTCAGGGGGTGGGTGGCTGG + Intergenic
975218170 4:71781228-71781250 CCTGTCATGGGGTGGGGAGCAGG + Intronic
975661124 4:76689720-76689742 CTGGGCACGGAGAGGGAGGCGGG + Intronic
976062439 4:81144755-81144777 CCTGTCATGGGGTGGGGGGAGGG - Intronic
976066296 4:81191426-81191448 CCTGTCAGGGGGTTGGGGGCTGG + Intronic
976348287 4:84030459-84030481 CCTGTCGGGGGGTGGGGGGCGGG + Intergenic
976450833 4:85189162-85189184 CCTGTCGTGGGGTGGGGGGCTGG - Intergenic
976938345 4:90667490-90667512 CCTGTCAGGGAGTGGGGGGCTGG - Intronic
977127259 4:93185894-93185916 CCTGTCATGGGGTGGGGGTCAGG - Intronic
977456726 4:97271092-97271114 CCTGTCATGGGGTGGGGGGAGGG - Intronic
977613853 4:99065537-99065559 CCTGTCGTGGGGTGGGAGGAGGG - Intergenic
977616605 4:99094085-99094107 CCTGTTGTGGGGTGGGAGGCGGG - Intergenic
977625322 4:99183716-99183738 CCTGTCAGGAGGTGGGGGGCTGG - Intergenic
977680425 4:99792799-99792821 CCTGTCATGGGGTGGGGGGACGG - Intergenic
977866158 4:102030581-102030603 CCTGTTGCGGGGTGGGGGGCTGG - Intronic
977900338 4:102415116-102415138 CCTGTCATGGGGTGGGGGGAGGG + Intronic
978013299 4:103713465-103713487 CCTGTCATGGGGTGGGGGGAGGG + Intronic
978046348 4:104134066-104134088 CCTGTCATGGGGTGGGGGGCTGG - Intergenic
978123095 4:105105150-105105172 CCTGTCAGGAGGTGGGGGGCTGG - Intergenic
978329504 4:107597387-107597409 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
979012837 4:115393154-115393176 CCTGTCAGGGGCTGGGGGGCTGG + Intergenic
979016921 4:115446783-115446805 CCTGTCAGGTGGTGGGGGGCTGG - Intergenic
979018465 4:115464966-115464988 CCTGTCATGGGGTGGGGGGATGG - Intergenic
979171623 4:117607694-117607716 CCTGTCATGGGGTGGGTGGAGGG - Intergenic
979208744 4:118075049-118075071 CCTGTCATGGGGTGGGGGGATGG - Intronic
979278094 4:118835840-118835862 CCGGGGACGCGGCGGGAGGCCGG - Intronic
979311103 4:119203976-119203998 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
979497127 4:121395996-121396018 CCTGTCATGGGGTGGGGGGCTGG + Intergenic
979563518 4:122127584-122127606 CCTGTCGTGGGGTGGGGGGCTGG - Intergenic
979660106 4:123243590-123243612 CCTGTCAGGTGGTGGGGGGCTGG + Intronic
980260038 4:130436971-130436993 CCTGGCAGGGGGAGGGGGGCTGG - Intergenic
980476941 4:133330503-133330525 CCTGTCAGGGGGTAGGGGGCTGG - Intergenic
980530074 4:134041570-134041592 CCTGTCAGGGGATGGGAGGCTGG + Intergenic
980559489 4:134454272-134454294 CCTGTCATGGGGTGGGGGGATGG + Intergenic
980597496 4:134973001-134973023 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
980813393 4:137913153-137913175 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
981172544 4:141641684-141641706 CCTGTCATGGGGTGGGGGGAGGG + Intronic
981244735 4:142522338-142522360 CATGTCTCGGGGTGGGGGGCGGG - Intronic
981346858 4:143685856-143685878 CCTGTCAGGGGGTGGGGGCCTGG + Intronic
981864874 4:149405402-149405424 CCTGTCAGGGGATGGGGGGCTGG + Intergenic
982120987 4:152143516-152143538 CCTGTCAGGGGGTGAGGGGCTGG + Intergenic
982384634 4:154787331-154787353 CCTGTCATGGGGTGGGGGGAGGG - Intronic
982673118 4:158346087-158346109 CCTGTCAGGGGGTGGGAGCAAGG + Intronic
982752915 4:159183889-159183911 CCTGTCATGGGGTGAGAGGAGGG - Intronic
983135416 4:164073489-164073511 CCTGTCAGGGAGTGGGGGGCAGG + Intronic
983457364 4:167982170-167982192 CCTGTCAGGGGGTGGGGGGAGGG - Intergenic
983546241 4:168967349-168967371 CCTGTCAGGGGGTTGGGGGCTGG + Intronic
983753895 4:171310135-171310157 CCTGTCAGGGGGTGGGTGGCTGG - Intergenic
983962124 4:173767801-173767823 CCTGACTCAGGGTGGCAGGCGGG + Intergenic
984032735 4:174625127-174625149 CCTGTCAGGGGGTAGGGGGCCGG - Intergenic
984179873 4:176469129-176469151 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
984308356 4:178023856-178023878 CCTGTCACGGGGTGGGGGGAGGG + Intergenic
984518792 4:180775387-180775409 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
984828871 4:183953031-183953053 CCTGTCAGAGGGTGGGAGGCTGG + Intronic
984949669 4:184997656-184997678 CCTGTCAAGAGGTGGGAGGCTGG - Intergenic
985187701 4:187335516-187335538 AGTCGCACGGGCTGGGAGGCAGG - Intergenic
985233441 4:187846847-187846869 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
985325426 4:188763121-188763143 CCTGTCAAGGGGTGAGGGGCTGG - Intergenic
985483438 5:134318-134340 CATGGGAAAGGGTGGGAGGCAGG + Intergenic
985622040 5:960834-960856 CCTGGCTCTGCGTGGGAGGTGGG + Intergenic
985653791 5:1119662-1119684 CCTGGCACGGGGTGGCTGAAAGG - Intergenic
985667760 5:1191089-1191111 CCTGGACATGGGTGGGAGGCAGG + Intergenic
985785148 5:1889490-1889512 CCTCGCTAGGGATGGGAGGCGGG - Intergenic
985851453 5:2391726-2391748 CCTGGGGCGGGCTGGGAGACTGG - Intergenic
986256934 5:6108522-6108544 CCTGGCTCAGGGTGGCAGGCAGG - Intergenic
986407130 5:7437310-7437332 CCTGTCTCGGGAGGGGAGGCTGG - Intronic
986912802 5:12577300-12577322 CCTGTCATGGGGTGGGAGGAGGG + Intergenic
987013961 5:13798047-13798069 CCTGTCTGGGGGTGGGGGGCTGG + Intronic
987327276 5:16823765-16823787 CCTGGCTGGGGGCGGGGGGCGGG + Intronic
987445998 5:18020673-18020695 CATGGGAGGGGGTGGGGGGCAGG + Intergenic
987529644 5:19101083-19101105 CCTGTCATGGGGTGGGGGGCAGG + Intergenic
987560506 5:19513994-19514016 CCTGTCATGGGGTGGGAGAATGG - Intronic
987693234 5:21295784-21295806 CCTGTCGTGGGGTGGGAGGAGGG - Intergenic
987725582 5:21695158-21695180 CCTGTCAGGGGATGGGAGGTAGG - Intergenic
987902943 5:24037372-24037394 CCTGTCGGGGGGTGGGGGGCTGG - Intronic
988090436 5:26532690-26532712 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
988187300 5:27884037-27884059 CCTGTCATGGGGTGGGGGGATGG - Intergenic
988469843 5:31527640-31527662 CCTGGTAAGGGGTGGGTGGCAGG - Intronic
988491242 5:31707146-31707168 CCTGTCATGGGGTGGGGGGAGGG + Intronic
988608183 5:32700544-32700566 CCTGTCGGGGGGTGGGGGGCTGG - Intronic
988610265 5:32717001-32717023 CCTGTCAGGGGGTGGGGGGTGGG - Intronic
988612284 5:32738285-32738307 CCTATCAGGGGGTGGGGGGCAGG - Intronic
988688158 5:33545854-33545876 CCTGTCGGGGGGTGGGGGGCTGG + Intronic
988840705 5:35081034-35081056 CCTGTCATGGGGTGGGGGGAGGG + Intronic
988975714 5:36514007-36514029 CCTGTCAGGAGGTGGGCGGCTGG + Intergenic
989290098 5:39754174-39754196 CCTGTCATGCGGTGGGGGGCTGG + Intergenic
989584023 5:43060417-43060439 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
989813274 5:45704320-45704342 CCTGTCAGGGGGTGGGGGGAAGG - Intergenic
989990151 5:50754331-50754353 CCTGTTGTGGGGTGGGAGGCTGG - Intronic
990091674 5:52059110-52059132 CCTGTCATGGGGTGGGGGGAGGG - Intronic
990228516 5:53685215-53685237 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
990240127 5:53808755-53808777 CCTGTCATGGGGTGAGGGGCTGG + Intergenic
990489704 5:56292869-56292891 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
990825925 5:59897599-59897621 CCTGTCGGGGGGTGGGATGCTGG - Intronic
991280302 5:64905826-64905848 CCTGTCATGGGGTGGGAGACAGG - Intronic
991355955 5:65768750-65768772 CATGGCACGGGTTGGGAGGTGGG + Intronic
991508807 5:67354078-67354100 CCTGGGAGGTTGTGGGAGGCAGG - Intergenic
991553196 5:67866143-67866165 CCTGTCATGGGGTGGGGGGATGG - Intergenic
991720641 5:69492458-69492480 GCTGGCAGGGTGTGGGAAGCAGG + Exonic
991747042 5:69753772-69753794 CCTGTCGTGGGGTGGGAGGAGGG + Intergenic
991750663 5:69801470-69801492 CCTGTCGTGGGGTGGGAGGAGGG - Intergenic
991798643 5:70333714-70333736 CCTGTCGTGGGGTGGGAGGAGGG + Intergenic
991826417 5:70629084-70629106 CCTGTCGTGGGGTGGGAGGAGGG + Intergenic
991829952 5:70676367-70676389 CCTGTCGTGGGGTGGGAGGAGGG - Intergenic
991890975 5:71333037-71333059 CCTGTCGTGGGGTGGGAGGAGGG + Intergenic
991962063 5:72054938-72054960 CCTGTTGCGGGGTGGGGGGCTGG + Intergenic
992183527 5:74221846-74221868 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
992212083 5:74490733-74490755 TTTGGCAGGGGGTGGGAGGAAGG - Intergenic
992343605 5:75852157-75852179 CCTGTCAGGTGGTGGGGGGCTGG + Intergenic
992346976 5:75889248-75889270 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
992357190 5:75998184-75998206 CCTGATACGGGGTGGGAGGAAGG + Intergenic
992875710 5:81053273-81053295 CCTGTCATGGGGTGGGGGGAGGG - Intronic
993075366 5:83223829-83223851 CCTGTCATGGGGTGGGGGGAGGG - Intronic
993163514 5:84319994-84320016 CCTGTCAGGGGGTGGGTGCCTGG + Intronic
993171698 5:84428514-84428536 CCTGTCAGGGGGTGGGGGACTGG - Intergenic
993489732 5:88532304-88532326 CCTGTCAAGGGGTAGGGGGCTGG + Intergenic
993592395 5:89810021-89810043 CCTGGATGGGGGTGGGAGGGTGG + Intergenic
994241267 5:97424350-97424372 CCTGTCGGGGGGTGGGGGGCTGG - Intergenic
994452402 5:99959060-99959082 CCTGTCAGGGGGTGGGGGACTGG - Intergenic
994705786 5:103205003-103205025 CCTGTCAGTGGGTGGGGGGCTGG - Intronic
994720964 5:103379978-103380000 CCTGTCAGGGGTTGGGGGGCAGG - Intergenic
995108581 5:108402632-108402654 CCTGTCAGGGGCTGGGGGGCTGG - Intergenic
995117374 5:108496400-108496422 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
995810558 5:116102814-116102836 CCTGTCAGGGTGTGGGGGGCTGG - Intronic
995812276 5:116121130-116121152 CCTGTCATGTGGTGGGGGGCAGG - Intronic
996419844 5:123250678-123250700 CCTGTCAGGGGGTAGGGGGCTGG - Intergenic
996763994 5:127017107-127017129 CCTGTCAGGTGGTGGGGGGCTGG + Intronic
997075840 5:130675593-130675615 CCTGTCAGCGGGTGGGAGGCAGG + Intergenic
997094566 5:130896238-130896260 CCTGTCATGGGGTGGGGGACTGG + Intergenic
997097495 5:130929528-130929550 CCTGTCAGGGGGTGGGGGGTAGG + Intergenic
997219187 5:132145340-132145362 CCTATCATGGGGTGGGGGGCTGG - Intergenic
997602834 5:135152039-135152061 CCTGTCATGGGGTGGGGGGAGGG + Intronic
997699293 5:135885254-135885276 CCTGGCACTGGATGGGATGGGGG - Intronic
997903321 5:137788940-137788962 CCTGTCAGGGGGTGGTGGGCTGG + Intergenic
998057149 5:139087919-139087941 CCTGGCTGTGGGTGGGTGGCTGG - Intronic
998323615 5:141257833-141257855 CCTGTCATGGGGTGGGGGGCAGG - Intergenic
998781023 5:145656745-145656767 CCTGTCATGGGGTGGGGGGAGGG + Intronic
999130313 5:149278049-149278071 CTTGGCAGAGGGTGGGAGGGAGG - Intronic
1000214843 5:159145530-159145552 CCTGTCAGGGGGTGGGTGGCTGG + Intergenic
1000423889 5:161068328-161068350 CCTGTCCTGGGGTGGGGGGCAGG - Intergenic
1000467473 5:161597531-161597553 CCTGTCACGGGATGGGGGGAGGG + Intronic
1000495686 5:161981682-161981704 CCTGTCAGGGGGTTGGGGGCTGG - Intergenic
1000516464 5:162241310-162241332 CCTGGAATTCGGTGGGAGGCAGG - Intergenic
1000523074 5:162320904-162320926 CCAGGGATGGGGTGGGAGGGGGG + Intergenic
1001020444 5:168178227-168178249 CCCGGCAGGGGGTGGCAGCCTGG - Intronic
1001036497 5:168300438-168300460 ACTGGCAAGGGGTGGGGGGTGGG - Intronic
1001180677 5:169517165-169517187 CCTGTCAGGGGGTGGGGGGATGG - Intergenic
1001328990 5:170749086-170749108 CGTGGCTCGGGGAGGGAGGGAGG - Intergenic
1001415785 5:171544116-171544138 GCTGGCACTGGCTGGGGGGCAGG + Intergenic
1001518372 5:172373230-172373252 CCAGGCACAGGCTGGGAAGCAGG - Intronic
1001639328 5:173233998-173234020 CCAGGATCGGGGAGGGAGGCCGG - Intronic
1002260785 5:177992748-177992770 CATGGGAGGGGGTGGGGGGCAGG + Exonic
1002338379 5:178496082-178496104 CATGGGACAGGGTAGGAGGCAGG + Intronic
1002641284 5:180631773-180631795 CCAGGCCTGGGGTGGGAGACAGG + Exonic
1002794246 6:458035-458057 CCTGTCAGGGGGTGGGGGGGGGG - Intergenic
1002973619 6:2050951-2050973 CCTGTCAGGGGGTGTGGGGCTGG + Intronic
1003228546 6:4228549-4228571 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1003399433 6:5779610-5779632 CCTGTCGTGGGGTGGGGGGCTGG - Intergenic
1003470843 6:6430060-6430082 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1003691294 6:8356296-8356318 CCTGTTGAGGGGTGGGAGGCTGG + Intergenic
1003793373 6:9572768-9572790 CCTGTCATGGGGTGGGGGGATGG + Intergenic
1004032433 6:11883855-11883877 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1004056612 6:12145361-12145383 CCTGTCATGGGGTGGGGGCCTGG + Intronic
1004282175 6:14289512-14289534 CCTGTCATGGGGTGGGGGTCGGG + Intergenic
1004289772 6:14355888-14355910 CCTGTCAGGGGCTGGGGGGCTGG - Intergenic
1004454993 6:15784125-15784147 CCTGTCATGGGATGGGTGGCTGG - Intergenic
1004502987 6:16225711-16225733 CCTGTCGTGGGGTGGGGGGCAGG + Intergenic
1005776334 6:29135538-29135560 CCTGTCATGGGTTGGGGGGCAGG - Intergenic
1005851584 6:29827403-29827425 ACAGGCAAGGAGTGGGAGGCAGG + Intronic
1006414053 6:33893032-33893054 CCTGGCGCGGGGTGGGGAGAGGG + Intergenic
1006617050 6:35336745-35336767 CCTGTCATGGGGTGGGGGGCTGG - Intergenic
1007248958 6:40482755-40482777 CCTGGCCAGGAGGGGGAGGCAGG - Intronic
1007319390 6:41016243-41016265 CCTGTCATGGGGTGGGGAGCGGG + Intergenic
1007349161 6:41256072-41256094 TCTGTCTCGGGGTGGGAGGTAGG - Intergenic
1007600368 6:43077198-43077220 CCTGGCACGGAGTGGGCGCAGGG - Intronic
1007616083 6:43180390-43180412 TCTGGGAGGGGGTGAGAGGCAGG + Exonic
1007682540 6:43644576-43644598 CCTGGCTTGGGGTGGGGTGCGGG + Intergenic
1007727409 6:43924774-43924796 CCTGGCACAGAGTGGGTGCCTGG + Intergenic
1007746107 6:44043854-44043876 CCTGGCAAGCTGAGGGAGGCAGG - Intergenic
1008213758 6:48759397-48759419 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1008269782 6:49477413-49477435 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1008363002 6:50643770-50643792 CCTGTCATGGGGTGGGGGACTGG - Intergenic
1008374155 6:50772234-50772256 CCTGTCATGGGGTGGGCGGAGGG + Intronic
1008398821 6:51039940-51039962 CCTGTCATGGGGTGGGGGGATGG - Intergenic
1008411123 6:51180963-51180985 CCTGTCAGGGGGTGGGGGGTTGG - Intergenic
1008724645 6:54402031-54402053 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1008734612 6:54528031-54528053 CCTGTCGTGGGGTGGGCGGCAGG - Intergenic
1008775828 6:55036536-55036558 CCTGTTAGGGGGAGGGAGGCTGG - Intergenic
1008812449 6:55520091-55520113 CCTGTCAGGGGGTGGGGGGCGGG + Intronic
1008979424 6:57465969-57465991 CCTGTCAGGGGGTGGGGAGCTGG - Intronic
1009167563 6:60358959-60358981 CCTGTCAGGGGGTGGGGAGCCGG - Intergenic
1009291604 6:61889589-61889611 CCTGTCATGGGGTGGGTGGGGGG + Intronic
1009330960 6:62419126-62419148 CCTGTCATGGGGTGGGGAGCAGG + Intergenic
1009500541 6:64407291-64407313 CCTGTCATGGGGTGGGGGGCTGG + Intronic
1009625016 6:66127504-66127526 CTTTGCAAGGGGTGGGAGGTGGG + Intergenic
1009688698 6:66997928-66997950 CCTGTCAGGGGGTGGAGGGCTGG + Intergenic
1009910762 6:69924250-69924272 CCTGTCATGGGGTGGGGGGAAGG - Intronic
1009987610 6:70800664-70800686 CCTGTCAGGGGGTGGGGGGCTGG - Intronic
1010178566 6:73057321-73057343 CCTGTCATGGGGTGGGGGGAAGG + Intronic
1010289541 6:74119582-74119604 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1010467493 6:76186261-76186283 CCTGTCGTGGGGTGGGGGGCTGG - Intergenic
1010806095 6:80238748-80238770 CCTGTCATGGGATGGGAGGAGGG - Intronic
1010867841 6:81001922-81001944 CCTGCCACAGGGTGGGATGGCGG + Intergenic
1011129301 6:84037565-84037587 CCCACCACGGGGTGGGGGGCTGG + Intronic
1011154876 6:84319784-84319806 CCTGTCATGGGGTGGGAAGCTGG + Intergenic
1011349818 6:86410249-86410271 CCTGTCATGGGGTGGGGGGTGGG - Intergenic
1011725782 6:90209046-90209068 CCTGTCGGGGGGTGGGGGGCTGG + Intronic
1011908305 6:92402171-92402193 CCTGTCATGGGGTGGGAGGCTGG - Intergenic
1011932258 6:92729071-92729093 CCTGTCATGGGGTTGGGGGCTGG - Intergenic
1012064382 6:94531342-94531364 CCTTGCACTGGGTGGGAGATTGG - Intergenic
1012169744 6:96002820-96002842 CCTGGCAAGGGCCGGGAGCCCGG - Intergenic
1012188633 6:96253317-96253339 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1012507277 6:99961699-99961721 CCTGTTGCGGGATGGGAGGCTGG + Intronic
1013370017 6:109461103-109461125 CCTGTCATAGGGTGGGGGGCTGG - Intergenic
1013535916 6:111062880-111062902 CCTGTCGGGGGGTGGGAGGCTGG - Intergenic
1013592942 6:111635021-111635043 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1013651217 6:112196711-112196733 CCTGGAATGGGGTGGGAGATTGG + Intronic
1013683411 6:112550759-112550781 CCTGTCAAGGGGTGGGAGGCTGG - Intergenic
1013932515 6:115551007-115551029 CCTGTCACGGGGGTGGAGGAAGG + Intergenic
1014107376 6:117582509-117582531 ACTGGCACAGGATGGGGGGCAGG - Intronic
1014237041 6:118969795-118969817 CCTGTCACGGGGTGGGGGGCAGG - Intronic
1014255425 6:119156335-119156357 CCTGACGTGGGGTGGGAGGAGGG + Intergenic
1014462156 6:121708918-121708940 CCTGTCATGGGGTGGGGGGCAGG + Intergenic
1014478745 6:121908822-121908844 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1014815930 6:125935487-125935509 CCTGTCATGGGGTGGGGGGAAGG - Intergenic
1014907660 6:127049222-127049244 CCTGTCACTGGGTGGGGGACTGG + Intergenic
1014951714 6:127563485-127563507 CCTGTCAGGGGGTGGGGGGCTGG - Intronic
1015137128 6:129885598-129885620 CCTGTCATCGGGTGGGGGGCTGG + Intergenic
1015155374 6:130089214-130089236 CCTGTCATGGGGTGGGGGGCAGG - Intronic
1015194345 6:130508918-130508940 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1015331758 6:131988129-131988151 CCTGTCATGGGATGGGGGGCTGG - Intergenic
1015418664 6:132981245-132981267 CCTGTCGTGGGGTGGGGGGCTGG - Intergenic
1015736102 6:136401624-136401646 CCTGTCGTGGGGTGGGAGGAGGG + Intronic
1015790092 6:136957702-136957724 CCTGGGACTGGGTGGGTGGGTGG - Intergenic
1015790106 6:136957735-136957757 CCTGGGACTGGGTGGGTGGATGG - Intergenic
1015790165 6:136957888-136957910 CCTGGGACTGGGTGGGGGGTGGG - Intergenic
1015790193 6:136957944-136957966 CCTGGAACTGGGTGGGTGGATGG - Intergenic
1015967164 6:138706070-138706092 CCTGTCATGGGGTGGGGGGCTGG - Intergenic
1016577969 6:145592158-145592180 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1016978694 6:149834024-149834046 CCTGTCAGAGGGTGGGAGGTAGG - Intronic
1017232119 6:152084265-152084287 CCTGTCAGGGGTTGGGGGGCTGG + Intronic
1017303240 6:152886496-152886518 CCTGTCATGGGGTGGGGGGCAGG + Intergenic
1017842290 6:158232036-158232058 CCTGGGCCGGGGAGGGAGGGCGG + Intergenic
1017852526 6:158317314-158317336 CCTGTCGTGGGGTGGGGGGCAGG - Intronic
1018110010 6:160527178-160527200 CTTGTCAGGGGGTGGGAAGCTGG - Intergenic
1018240307 6:161767754-161767776 CCTGGCTGGGGGTGGGGGGCTGG + Intronic
1018269887 6:162065718-162065740 CCTGCCATGGGGTGGAGGGCTGG - Intronic
1018295771 6:162341750-162341772 CCTGTCAGGGGGTGGGGGGATGG + Intronic
1018612835 6:165661386-165661408 CACTGCGCGGGGTGGGAGGCCGG + Intronic
1018676606 6:166227629-166227651 CCTAGCATGGGGTGGGGTGCAGG - Intergenic
1018856469 6:167678763-167678785 CCGGGGGCGGGGCGGGAGGCCGG - Intergenic
1019127546 6:169850940-169850962 CCTGGCAATGGGGAGGAGGCCGG + Intergenic
1019568226 7:1695268-1695290 GCTGGGAAGGGCTGGGAGGCCGG - Intronic
1019628405 7:2033137-2033159 CCTGGCACGTGGTGCCTGGCTGG - Intronic
1019701305 7:2476107-2476129 TCTGGCACTGGGTTGGGGGCAGG - Intronic
1019835483 7:3378918-3378940 CCGGGGAAGGGGTGGGAGGTCGG - Intronic
1020016414 7:4834522-4834544 GCTGGCCCCGGCTGGGAGGCGGG - Intronic
1020137175 7:5593969-5593991 CCCAGCCCGGGGTGGGAGGTGGG - Intronic
1020545482 7:9523976-9523998 CCTGTCAGGGGGTGGGATGGGGG - Intergenic
1020562554 7:9747685-9747707 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1020780060 7:12506634-12506656 CCTGTCATGGGGTGGGAGGCTGG + Intergenic
1021321618 7:19219442-19219464 CCTGTCATGGGGTGGGGGACAGG + Intergenic
1021436853 7:20628156-20628178 CCTGTTGTGGGGTGGGAGGCTGG - Intronic
1021460684 7:20883573-20883595 CCTGTTGCGGGGTGGGGGGCTGG - Intergenic
1021698828 7:23298655-23298677 CCTGGCACGGGTGGGGGGGTGGG - Intergenic
1021749865 7:23785837-23785859 CCTGTCATGGGGTGGGGGGCAGG + Intronic
1021870000 7:24996415-24996437 CCTGTCAGGGGGTGAGGGGCTGG - Intergenic
1021909958 7:25375580-25375602 CCTTGCACAGGGAGGGAGCCGGG + Intergenic
1022087912 7:27087193-27087215 GCTGGCGGGGGGCGGGAGGCTGG + Intergenic
1022347839 7:29534395-29534417 CCTGTCATGGGGTGGGGGGCAGG + Intergenic
1022361140 7:29659215-29659237 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1022461070 7:30607540-30607562 CCTGTCGGGGGGTGGGAGGCTGG + Intronic
1022527223 7:31046077-31046099 CCTGTCAGGAGGTGGGGGGCTGG + Intergenic
1022558795 7:31327698-31327720 CCTGTCATGGGGTGAGGGGCTGG - Intergenic
1022591677 7:31669996-31670018 CCTGTCACGGGATGGAAGGAAGG - Intergenic
1022661414 7:32370630-32370652 CCTGTCATGGGGTGGGGGGAAGG + Intergenic
1022672932 7:32473027-32473049 CCTGGGAAGGGATGGGAGGCAGG + Intergenic
1022683587 7:32573328-32573350 GATGGCACGGGCTGGGAGGGAGG + Exonic
1022877329 7:34548170-34548192 CCTGTCATGGGGTGGGGGGCAGG - Intergenic
1022934459 7:35157788-35157810 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1023014895 7:35956978-35957000 CCTGTCAGGGGGTGGAGGGCTGG - Intergenic
1023372248 7:39523196-39523218 CCTGTCATGTGGTGGGGGGCTGG - Intergenic
1023508864 7:40929081-40929103 CCTGTCAGGGGGTGGCGGGCTGG - Intergenic
1023624081 7:42099028-42099050 CTTGGCACGGGGGAGCAGGCAGG - Intronic
1023650672 7:42365590-42365612 CCTGTCAGGGGGTGGGGAGCGGG - Intergenic
1023852753 7:44159322-44159344 CCTGCCATGGGGTCAGAGGCAGG + Intronic
1023864244 7:44231355-44231377 GCTGGCACGGAGTCCGAGGCCGG + Intronic
1024041160 7:45556355-45556377 CCTGTCGGGGGGTGGGGGGCTGG - Intergenic
1024105829 7:46085529-46085551 CCTGTCGGGGGGTGGGGGGCCGG - Intergenic
1024157008 7:46636262-46636284 CCTGGCAGGGGCTGGAAGGATGG + Intergenic
1024290619 7:47801082-47801104 CCAGCCACAGTGTGGGAGGCTGG - Intronic
1024591765 7:50892381-50892403 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1024621157 7:51158851-51158873 CGAGGCACGGGGTGGGAGACAGG + Intronic
1024738663 7:52332730-52332752 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1025040106 7:55634501-55634523 CCTGTCACGGGGTGGGGGCCAGG + Intergenic
1025089283 7:56049284-56049306 CCTGTCAGGGGGTGGGAGCAAGG - Intronic
1025227662 7:57178639-57178661 CCTGTCACAGGGAGGAAGGCTGG + Intergenic
1025230783 7:57202143-57202165 CCTGGCACAGGGAGGAAAGCTGG + Intergenic
1025258506 7:57400834-57400856 GCAGGCACTGGGAGGGAGGCCGG + Intergenic
1025582393 7:62736944-62736966 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1025636637 7:63325708-63325730 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1025646059 7:63422394-63422416 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1025716290 7:63959997-63960019 CCTGTCACGGGGGGAGGGGCTGG - Intergenic
1025843525 7:65174561-65174583 CCTGTTAGGGGGTGGGGGGCTGG - Intergenic
1025879520 7:65521406-65521428 CCTGTTAGGGGGTGGGGGGCTGG + Intergenic
1025893918 7:65681182-65681204 CCTGTTAGGGGGTGGGGGGCTGG - Intergenic
1025929100 7:65980721-65980743 CCTGTCACAGGGAGGAAGGCTGG + Intronic
1026015337 7:66667228-66667250 CCTGGCACGGGCTGAGACTCAGG + Intronic
1026822351 7:73557822-73557844 CCCGGGCCGGGGTGCGAGGCGGG + Exonic
1026891745 7:73986380-73986402 CCTGGCACGGGCTGAGACTCAGG + Intergenic
1027233123 7:76283205-76283227 CCTGGCACGGGGATGGGGGGGGG + Intronic
1027348902 7:77290227-77290249 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1027571599 7:79875435-79875457 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1027686618 7:81286451-81286473 CCTGTCATGGGGTGGGGGGATGG + Intergenic
1027727315 7:81824226-81824248 CCTGTCATGGGGTGGGGGGCTGG - Intergenic
1028144853 7:87310386-87310408 CCTGTCAGGGGGTGGGGGCCAGG + Intergenic
1028316221 7:89406066-89406088 CCTGTCAGGGAGTGGGGGGCAGG - Intergenic
1028368469 7:90063090-90063112 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1028394282 7:90350069-90350091 CCTGTCATGGGGTTGGGGGCTGG - Intronic
1028394973 7:90359293-90359315 CCTGTCAGGGGGTGGGGGTCTGG - Intronic
1028736740 7:94221818-94221840 CCTGTCAGGGGGTAGGGGGCTGG + Intergenic
1028837289 7:95388932-95388954 CCTGTCAGGGTGTGGGGGGCTGG + Intronic
1028984150 7:96996892-96996914 TCTGGGATGGGGAGGGAGGCAGG - Intergenic
1028992328 7:97062462-97062484 CCTGTCTGGGGGTGGGCGGCTGG + Intergenic
1029186136 7:98740136-98740158 CCAGGCACGGGGCTGGTGGCTGG - Intergenic
1029640792 7:101817531-101817553 CCGGGCGGGGGGTGGCAGGCAGG - Intronic
1029830395 7:103250571-103250593 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1029869632 7:103676882-103676904 CCTGTCATGGGGTGGGAGCAGGG + Intronic
1029938164 7:104450566-104450588 CCTGACAGGGGGTGGGGGACTGG + Intronic
1030030382 7:105364027-105364049 CCTGTCGTGGGGTGGGGGGCTGG + Intronic
1030132642 7:106215903-106215925 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1030162895 7:106526593-106526615 CCTGTCATGGGGTGGGGGGAAGG - Intergenic
1030182145 7:106721309-106721331 CATGGGAAGGGGTGGGAGGTTGG - Intergenic
1030220471 7:107093659-107093681 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1030227610 7:107169588-107169610 CTTGGCCAGGGGTGGGGGGCTGG + Intronic
1030462962 7:109863485-109863507 CCTGTCAGGGGGTAGGGGGCTGG + Intergenic
1031178035 7:118377410-118377432 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1031366531 7:120906690-120906712 CCTGTCTTGGGGTGGGTGGCTGG + Intergenic
1031538810 7:122967612-122967634 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1031566113 7:123298889-123298911 CCTGTCAGGGGGTGAGGGGCTGG - Intergenic
1031581342 7:123478415-123478437 CCTGTCATGGGGTGGGAAGCAGG + Intronic
1031905584 7:127456933-127456955 CCTGTCGTGGGGTGGGGGGCAGG + Intergenic
1032182467 7:129692093-129692115 CCTGCCACCGGGAGGGTGGCAGG - Intronic
1032414436 7:131725489-131725511 CCTGGCTCAGGGGAGGAGGCTGG + Intergenic
1032562320 7:132905091-132905113 CCTGTCGTGGGGTGGGGGGCAGG + Intronic
1033025703 7:137770309-137770331 CCTGTCTGGGGGTGGGAGGCAGG + Intronic
1033056050 7:138055718-138055740 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1033176699 7:139130665-139130687 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1033477043 7:141701765-141701787 CCTGGTGCGGGGTGCGGGGCCGG + Intronic
1033637811 7:143228252-143228274 CCTGTTGCGGGGTGGGGGGCTGG - Intergenic
1033922248 7:146408616-146408638 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1034358054 7:150469235-150469257 CCTGGTACAGGGTGGGATGGGGG - Intronic
1034673492 7:152874512-152874534 CCTGTCGGGGGGTGGGGGGCTGG - Intergenic
1034692617 7:153025978-153026000 CCTGTCATGGGGTGGGGGGCTGG - Intergenic
1034722581 7:153308175-153308197 CCTGTCGGGGGGTGGGGGGCTGG + Intergenic
1034839129 7:154379351-154379373 CCTGTCAGGTGGTGGGGGGCTGG + Intronic
1034861565 7:154599668-154599690 CCTGTCATGGGGTGGGGGGCTGG - Intronic
1034899331 7:154897881-154897903 CCTGTCGTGGGGTGGGGGGCTGG - Intergenic
1034940047 7:155224795-155224817 CCAGGGAGGGGCTGGGAGGCAGG + Intergenic
1034973033 7:155430989-155431011 CCTGTCGTGGGGTGGGGGGCTGG + Intergenic
1035002812 7:155628335-155628357 CCTGTCAGTGGGTGGGGGGCTGG + Intronic
1036485604 8:9175980-9176002 CCTGTCTTGGGGTGGGAGGGTGG - Intergenic
1036665550 8:10734800-10734822 CCCCGCACGGCGCGGGAGGCGGG - Intronic
1036955267 8:13181484-13181506 CCGGACATGGGGTGGGGGGCTGG - Intronic
1037308463 8:17530113-17530135 TATAGCACGGGGTAGGAGGCAGG - Intronic
1037449634 8:19003737-19003759 ACTGGCAGGGGGTGGGGGGTTGG + Intronic
1037612378 8:20487041-20487063 CCTGTCAGGGGGTGGGGGGGGGG + Intergenic
1037720215 8:21437333-21437355 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1037809864 8:22080894-22080916 CCTGTAGCGGGGCGGGAGGCTGG + Intronic
1037834536 8:22208388-22208410 CCTAGTATGGGGTGGGGGGCAGG - Intronic
1038116841 8:24566015-24566037 CCTGTCATGGGGTAGGGGGCAGG - Intergenic
1038141406 8:24849313-24849335 CCTGTCATGGGGTGGGGGGGAGG - Intergenic
1038484744 8:27926440-27926462 CCTGTCAGGGGGTGGGGGACTGG + Intronic
1038510857 8:28134102-28134124 CCTGTCGTGGGGTGGGGGGCAGG - Intronic
1038644480 8:29350855-29350877 CCGGGGAGGGGGTGGGAGGAGGG - Intergenic
1038750901 8:30294891-30294913 CCTGTCGGGGGGTGGGTGGCTGG - Intergenic
1039342492 8:36666489-36666511 CCTGTCATAGGGTGGGAGGCTGG - Intergenic
1039712389 8:40068877-40068899 CCTGTCAGGGGGTGGGGGGCAGG + Intergenic
1039832907 8:41230947-41230969 CCTGTCGGGGGGTGGGGGGCTGG + Intergenic
1040014244 8:42688357-42688379 CCTGTCGCGGGGTGGGGGGCAGG + Intergenic
1040359128 8:46648263-46648285 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1040360829 8:46662686-46662708 CCTGTCAGAGGGTGGGAGGTGGG - Intergenic
1040412052 8:47164448-47164470 CCTGTCATGGGGTGGGGGGATGG + Intergenic
1040557239 8:48491516-48491538 CCTGTCAGGGGTTGGGGGGCAGG + Intergenic
1040562697 8:48538684-48538706 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1040585267 8:48735025-48735047 CTTAGCACGGGGTGGGACCCAGG + Intronic
1041344586 8:56883496-56883518 CAGGGGAAGGGGTGGGAGGCGGG + Intergenic
1041945992 8:63443650-63443672 CCTGTCATGGGGTGGGGGGGGGG - Intergenic
1041951188 8:63504898-63504920 CCTGTCGGGGGGTGGGAGACTGG - Intergenic
1041960931 8:63615188-63615210 CCTGTCGTGGGGTGGGAGGAGGG - Intergenic
1042010296 8:64236690-64236712 CCTGTCTTGGGGTGGGAGGAGGG + Intergenic
1042140314 8:65671948-65671970 CCTGTCTTGGGGTGGGAGGCTGG - Intronic
1042153043 8:65810340-65810362 CCTGTCATGGGGTGGGGGGATGG + Intronic
1042321646 8:67481812-67481834 CCTGACCCTGGGAGGGAGGCAGG + Intronic
1042376267 8:68056242-68056264 CCAGGCAGGGAGTGGCAGGCAGG + Intronic
1042525596 8:69761606-69761628 CCTGGGAAGGGGTGACAGGCAGG - Intronic
1042534926 8:69849263-69849285 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1042541673 8:69913525-69913547 CCTGTCATGGGGTGGGGGACAGG + Intergenic
1042697473 8:71571345-71571367 CCTGTCAGGGGGTGGGGGGTCGG + Intronic
1042852970 8:73235005-73235027 CCTGTCAGGGGGTGGGGGTCTGG - Intergenic
1042878072 8:73457932-73457954 CTAGGCACGGGGTTGGAGGAGGG + Intronic
1042931838 8:74021914-74021936 CCTGTCATGGGGTGGGGGGCTGG + Intronic
1043352019 8:79372972-79372994 CCTGTCACGGGGTGGGGGGCAGG + Intergenic
1043364439 8:79516218-79516240 CCTGTTGTGGGGTGGGAGGCTGG - Intergenic
1043458263 8:80433584-80433606 CCTGTCGTGGGGTGGGGGGCTGG - Intergenic
1043664716 8:82794225-82794247 CCTGTCGTGGGATGGGAGGCGGG + Intergenic
1043676758 8:82966420-82966442 CCTGGCAGGGGCGGGGAGGACGG - Intergenic
1043738350 8:83775374-83775396 GGTGGCACAGGGTGGGAAGCAGG - Intergenic
1043791594 8:84475058-84475080 CCTGTCACTGGGTGGGGGGCTGG - Intronic
1043889389 8:85639662-85639684 CCTGTCATGGGGTGGAGGGCGGG + Intergenic
1043911384 8:85868432-85868454 CCTGTCAGGGGGTGGGAGGAGGG - Intergenic
1044102460 8:88157819-88157841 CCTGTCATGGGGTGGGGGGATGG - Intronic
1044107162 8:88223684-88223706 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1044128703 8:88492314-88492336 CTTGTCGTGGGGTGGGAGGCAGG + Intergenic
1044221774 8:89678106-89678128 CCTGTCATGGGGTGGGGGGATGG + Intergenic
1044318124 8:90773014-90773036 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1044385268 8:91580791-91580813 CCTGTCATAGGGTGGGAGGCAGG - Intergenic
1044615082 8:94131825-94131847 CCTGTCAGGGGGTGGGGGTCTGG - Intronic
1044632767 8:94295480-94295502 CCTGTCAGGGGGTGGGAGGCAGG + Intergenic
1044755453 8:95457082-95457104 CCTGGCAAGGTGTGAGAAGCTGG + Intergenic
1044790585 8:95842812-95842834 TGTGGTACGGGGTGGTAGGCAGG - Intergenic
1045070613 8:98500510-98500532 CCTGTCATGGGGTAGGGGGCAGG - Intronic
1045113065 8:98951671-98951693 CCTGCCGCGGGGTGTGAGTCAGG - Exonic
1045240122 8:100393018-100393040 CCTGGAACAGGGATGGAGGCAGG - Intronic
1045527913 8:102957211-102957233 CCTGTCATGGGGTGGGGGGTGGG - Intronic
1045606196 8:103779746-103779768 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1046116556 8:109791443-109791465 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1046252835 8:111655162-111655184 CCTGTCACGGGGTGGGGGGAGGG + Intergenic
1046527499 8:115399063-115399085 CCTGTCATGGGGTGGGAAGAGGG + Intergenic
1046565475 8:115893839-115893861 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1046625517 8:116572691-116572713 CCTGGCACTGGGGCAGAGGCCGG + Intergenic
1046736930 8:117786986-117787008 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1046765425 8:118064326-118064348 CCTGTCAAGGGGTGGGAGCTAGG - Intronic
1046848162 8:118942216-118942238 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1046934053 8:119869549-119869571 CCTGTCAGTGGGTGGGGGGCTGG + Intergenic
1047015795 8:120721886-120721908 CATGTCATGGGGTGGGGGGCAGG - Intronic
1047437279 8:124845287-124845309 CCTGTCATGGGGTGGGGGGAAGG - Intergenic
1047756657 8:127924026-127924048 TCTGGCATGGTGTTGGAGGCCGG + Intergenic
1048484160 8:134831981-134832003 CCTGGCCCGGGGTCGGGGGTCGG + Intergenic
1048661746 8:136611769-136611791 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1048797241 8:138162277-138162299 CCAGGCACGGGGGAGAAGGCAGG + Intronic
1049047017 8:140160638-140160660 CCTGTCGGGGGGTGGGGGGCTGG + Intronic
1049096231 8:140549863-140549885 GCTGGGGCGGGGTGGGAGGCAGG + Intronic
1049178540 8:141208505-141208527 CCTGTCCCCGGGGGGGAGGCAGG - Intronic
1049415204 8:142491881-142491903 CCTGACAGGGAGAGGGAGGCAGG + Intronic
1049470007 8:142771013-142771035 CCAGGCACAGGGAGGGAGACAGG - Intronic
1049826227 8:144670581-144670603 CCTGGAGCAGGGCGGGAGGCAGG - Intergenic
1049882104 8:145072261-145072283 CCTGTCGGGGGGTGGGAGGCTGG - Intergenic
1049886873 9:33457-33479 CCTGTCAGTGGGTGGGGGGCTGG - Intergenic
1050071552 9:1820287-1820309 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1050095371 9:2059414-2059436 CCTGGTATGGAGAGGGAGGCAGG - Intronic
1050171107 9:2817764-2817786 CATGTCAGGTGGTGGGAGGCTGG + Intronic
1050181458 9:2927368-2927390 CCTGTCAGGGAGTGGGAGGTAGG + Intergenic
1050282109 9:4061213-4061235 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1050321171 9:4453841-4453863 CTTGTCATGGGGTGGGAGGAAGG + Intergenic
1050699635 9:8324248-8324270 CCTGCCAGGGGGTGGGGGCCTGG - Intronic
1050854990 9:10343125-10343147 CCTGTCAGGGGGTCGGGGGCTGG - Intronic
1050954157 9:11634095-11634117 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1051045197 9:12864959-12864981 CCTGTCAGCAGGTGGGAGGCTGG - Intergenic
1051294634 9:15582775-15582797 CCTGGCAGGAGGTGGGGGGCTGG + Intronic
1051302821 9:15671506-15671528 CCTGGCAGGGGGTGGGGGGCTGG - Intronic
1051305058 9:15700131-15700153 CCATGGAGGGGGTGGGAGGCAGG + Intronic
1051481633 9:17568404-17568426 CCTGTCATGGGGTGGGAGGCAGG - Intergenic
1051537122 9:18172121-18172143 CTTGTCAGGGGGTGGGGGGCTGG + Intergenic
1051548244 9:18300454-18300476 CCTGTCAGGGGGAGGGGGGCTGG + Intergenic
1051619430 9:19036098-19036120 CCTGGCGGGGGGTAGGGGGCTGG + Intronic
1051718558 9:20010757-20010779 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1051960956 9:22762071-22762093 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1051985930 9:23086923-23086945 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1052056184 9:23910373-23910395 CCTGTCATGGGGTGGGAGGAGGG + Intergenic
1052217852 9:25988568-25988590 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1052355564 9:27501593-27501615 CCTGTCATGGGGTGGGGGGTGGG + Intronic
1052487009 9:29114550-29114572 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1052860423 9:33434816-33434838 CCTGGCTTGAGGTGGGAGGTGGG - Intergenic
1053048989 9:34942842-34942864 CCTGTCATGGGATGGGGGGCAGG + Intergenic
1053753799 9:41281579-41281601 CCTGTCATGGGGTGGGGGGCTGG - Intergenic
1054259322 9:62845935-62845957 CCTGTCATGGGGTGGGGGGCTGG - Intergenic
1054332455 9:63774098-63774120 CCTGTCATGGGGTGGGGGGCTGG + Intergenic
1054595979 9:67066717-67066739 ACTGTCACGGGGTGGGGGGAGGG - Intergenic
1054729524 9:68686703-68686725 CTTGGCATGAGTTGGGAGGCAGG + Intergenic
1054890541 9:70246309-70246331 CCTGCCAGGGGGTGGGGGGCTGG + Intergenic
1055087482 9:72328943-72328965 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1055282971 9:74696151-74696173 CCTGTCGTGGGGTGGGGGGCTGG + Intergenic
1055296030 9:74834606-74834628 CCTGTCAGGGGGTGGGGGGCTGG - Intronic
1055624771 9:78165180-78165202 CCTGTCAGGGAGTGGGAAGCTGG - Intergenic
1055643488 9:78340621-78340643 CCTGTCATGGGGTGGGAGGCTGG + Intergenic
1056175962 9:84036316-84036338 CCTGTCAGGGGGTGGGGGCCTGG - Intergenic
1056221797 9:84457123-84457145 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1056668607 9:88603314-88603336 CCTGTCGTGGGGTGGGGGGCTGG + Intergenic
1057134831 9:92680413-92680435 CCAGGCACTGGGTGGGTTGCAGG + Intergenic
1057435324 9:95035117-95035139 CCTGTCATGGGGTGGGGGACAGG - Intronic
1057768546 9:97945493-97945515 CCTGTCTGGGGGTGGGGGGCAGG - Intergenic
1057797434 9:98169004-98169026 CCTGGGACGGGGTGGAGGGGTGG + Intronic
1057854845 9:98594278-98594300 TCAGCCACGGGGTGGGAGGCGGG - Intronic
1058253716 9:102735034-102735056 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1058317946 9:103592590-103592612 CCTGTTATGGGGTGGGAGGAGGG - Intergenic
1058357010 9:104094523-104094545 CCTGGCGGGAGGCGGGAGGCGGG + Intronic
1058426783 9:104882382-104882404 CCTGGCAAGGGGACAGAGGCTGG - Intronic
1058614861 9:106815181-106815203 CCTGTCATGGGGTTGGGGGCAGG + Intergenic
1058879988 9:109277736-109277758 CCTGGCTGGGGCTGGGAGGAAGG + Intronic
1059086083 9:111304361-111304383 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1060124432 9:121028687-121028709 CCTGTCATGGGGTGGGGGACGGG + Intronic
1060382512 9:123189691-123189713 CCTGTCGTGGGGTGGGGGGCTGG + Intronic
1060514791 9:124258696-124258718 CCTGGCATGGGCTGGGGGTCGGG + Intronic
1060796238 9:126514578-126514600 CGCCGCAGGGGGTGGGAGGCCGG - Intergenic
1060983048 9:127804392-127804414 CCTGGCACGGAGTGGGCTGCAGG + Exonic
1061003640 9:127916469-127916491 GCTGGGAAGGGGTGGGAGCCGGG + Exonic
1061181258 9:129026543-129026565 CCAGCCTCGGGGTGGGAGGGAGG - Intronic
1061479882 9:130892373-130892395 TCTGACACGGGATGGGATGCAGG + Intergenic
1061503459 9:131017117-131017139 CTTGGAACGAGGTGGGGGGCTGG + Intronic
1061657169 9:132101192-132101214 CCTGTCATGGGGTGGGGGGCAGG + Intergenic
1061881691 9:133572179-133572201 CCTGGGGCGGGGTGGGGGGTGGG - Intronic
1061940841 9:133883012-133883034 CCTGGCATGGGGTGGGTGTGGGG - Intronic
1062447514 9:136601873-136601895 ACTGGCACTGGGTGGGGGGAGGG + Intergenic
1062465165 9:136677661-136677683 CCTGGCACGGGGCAGGAGACCGG + Intronic
1062520071 9:136954097-136954119 CTTGGCAGGGGGTTGGGGGCTGG - Intronic
1062526629 9:136980489-136980511 CCTGGCACAGAGTGGGCGCCTGG - Intronic
1062574269 9:137199272-137199294 CCTGGCAGGGTGCGGGAGGTAGG + Exonic
1062742757 9:138189155-138189177 CCTGTCGGGGGGTGGGAGGCTGG - Intergenic
1203565817 Un_KI270744v1:86757-86779 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1185619181 X:1442910-1442932 CCTGGCAGGGTGTGGCAGCCAGG - Intronic
1185741321 X:2535023-2535045 CCTGTCAGGGGGTGGGGGCCTGG + Intergenic
1185828237 X:3273402-3273424 CCTGTCAGGGGGTGGGGGTCTGG - Intronic
1185836196 X:3347204-3347226 TCTGGCAAGGGGAGGGAGGCGGG - Intergenic
1185947537 X:4394656-4394678 CCTGTCAGGGGTTGGGGGGCTGG - Intergenic
1186726262 X:12362354-12362376 CCTGTCATGGAGTGGGAGGAGGG - Intronic
1186763465 X:12747142-12747164 CCTGTCATGGGGTGGGGGGAAGG + Intergenic
1186867044 X:13730910-13730932 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
1186968603 X:14815163-14815185 CCTGTCTTGGGGTGGGGGGCAGG + Intergenic
1186974160 X:14882005-14882027 CCTGGCATGGGGTGGGGGAAGGG + Intronic
1187068012 X:15859946-15859968 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1187421389 X:19137035-19137057 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1187941656 X:24388441-24388463 CCTGGCAGGGAGTGGGCTGCAGG - Intergenic
1188017033 X:25117288-25117310 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1188123651 X:26339946-26339968 CCTGTCCTGGGGTGGGAGGATGG + Intergenic
1188178287 X:27021933-27021955 CCTGTCAGGGAGTGGGGGGCTGG - Intergenic
1188296811 X:28459938-28459960 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1188336928 X:28947546-28947568 CCTGTCGTGGGGTGGGAGGATGG + Intronic
1188354804 X:29177742-29177764 CCTGTCATGGGGTCGGGGGCTGG - Intronic
1188596587 X:31908561-31908583 CCTGTCGTGGGGTGGGGGGCTGG + Intronic
1188650593 X:32627145-32627167 CCTGGGGCGGGGGGGGGGGCGGG - Intronic
1188709368 X:33375760-33375782 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1188720017 X:33510710-33510732 CCTGTCCGGGGGTGGGGGGCTGG + Intergenic
1188951153 X:36376772-36376794 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1189001935 X:36957499-36957521 CCTGGCCCGCGGAGGGAGCCCGG - Intergenic
1189162628 X:38826076-38826098 CCTGTCGGGGGGTGGGGGGCTGG - Intergenic
1189501828 X:41568082-41568104 CCTGTCAGGGGGTGGGGGGCTGG + Intronic
1189618531 X:42810829-42810851 CCTGTCAGGGGATGGGGGGCTGG - Intergenic
1189696327 X:43666986-43667008 TCTGTCATGGGGTGGGGGGCGGG + Intronic
1189700445 X:43713326-43713348 CCTGTCAGGTGGTGGGAGGAGGG + Intronic
1189713771 X:43843685-43843707 CCCGGGACCGTGTGGGAGGCAGG - Exonic
1189735454 X:44065579-44065601 CCTGTCAGGGGATGGGAGGCTGG - Intergenic
1189844733 X:45124238-45124260 CCTGTCGGGGGGTGGGGGGCTGG + Intergenic
1189894416 X:45639261-45639283 CCTGTCATGGGGTGGGGGGCTGG + Intergenic
1190105927 X:47561293-47561315 CCGGGCACGGGCAGGGAGCCCGG + Intronic
1190397713 X:50001613-50001635 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1190540111 X:51468476-51468498 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1190686883 X:52882738-52882760 CCTGTCATGGGGTGGGAGGGAGG - Intergenic
1190699099 X:52973054-52973076 CCTGTCATGGGGTGGGAGGGAGG + Intronic
1190883363 X:54509430-54509452 CCTGGCAAGAGGTGAGTGGCAGG + Intergenic
1191043590 X:56112325-56112347 CCTGCCATGGAGTGGGGGGCTGG + Intergenic
1191073176 X:56424207-56424229 CCTGTCAGGGGGTGGGGGCCTGG - Intergenic
1191131979 X:57024067-57024089 CCTGTCAGGGGTTGGGGGGCTGG - Intergenic
1191582602 X:62781396-62781418 CCTGTCATGGGGTGGGAGGATGG - Intergenic
1191646249 X:63484308-63484330 CCTGTCAGGGGGTGTGTGGCTGG + Intergenic
1191973886 X:66849113-66849135 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1192149783 X:68705125-68705147 CCTGGGACTGGGTTGGGGGCAGG + Intronic
1192287134 X:69750170-69750192 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1192567397 X:72176627-72176649 CCTGTCATGGGGTGGGGGGCTGG + Intergenic
1192612807 X:72584899-72584921 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1192636580 X:72825365-72825387 CCTGTCCGGGGGTGGGGGGCTGG - Intronic
1192645134 X:72895449-72895471 CCTGTCCGGGGGTGGGGGGCTGG + Intronic
1192678082 X:73221371-73221393 CCTGTTAGGGGGTGGGGGGCTGG - Intergenic
1192728343 X:73776421-73776443 CCTGTTAGTGGGTGGGAGGCTGG + Intergenic
1192897194 X:75456346-75456368 CCTGTCATGGGGTGGGGGGCTGG + Intronic
1192920254 X:75698573-75698595 CCTGTCATGAGGTGGGAGGAGGG + Intergenic
1192935441 X:75854182-75854204 CCTGTCAGGGGGTGAGGGGCTGG - Intergenic
1192973265 X:76255517-76255539 CCTGTCGTGGGGTGGGTGGCTGG - Intergenic
1193096245 X:77552455-77552477 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1193110666 X:77726466-77726488 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1193280949 X:79650371-79650393 CCTGTCGTGGGGTGGGGGGCAGG - Intergenic
1193296759 X:79842506-79842528 CCTGTCATGGGGTGGGAGGAGGG + Intergenic
1193403231 X:81070499-81070521 CCTGTCATCGGGTGGGGGGCAGG + Intergenic
1193589959 X:83376810-83376832 CCTGTCAGGGGGTGGGTGCCTGG + Intergenic
1193657198 X:84212737-84212759 CCTGTCATGGGGTGGGGGGATGG - Intergenic
1193668636 X:84355702-84355724 CCTGTCGTGGGGTGGGAGGAGGG + Intronic
1193694512 X:84691805-84691827 CCTGTTAGGGGGTGAGAGGCAGG - Intergenic
1193712974 X:84901303-84901325 CCTGTCATGGGGTGGCAGGATGG - Intergenic
1193800851 X:85934423-85934445 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1193893348 X:87079742-87079764 CCTGTCATAGGGTGGGAGGAGGG - Intergenic
1194052627 X:89090680-89090702 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1194056927 X:89146426-89146448 CCTGTCAGGGGGTGGGGGGCTGG + Intergenic
1194222976 X:91219101-91219123 CCTGTTGAGGGGTGGGAGGCTGG - Intergenic
1194239581 X:91427824-91427846 CCGGGGAAAGGGTGGGAGGCGGG + Intergenic
1194294639 X:92113211-92113233 CCTGGCTGGGGCTGGGTGGCAGG + Intronic
1194459748 X:94151733-94151755 CCTGTCATGGGGCGGGGGGCAGG - Intergenic
1194459799 X:94152139-94152161 CCCGTCATGGGGTGGGGGGCAGG + Intergenic
1194549963 X:95285480-95285502 CCTGTCATGGGGTGGGGGGCAGG - Intergenic
1194628491 X:96254359-96254381 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1194677279 X:96809665-96809687 CCTGTCATGGGGTGGGGAGCAGG - Intronic
1194866703 X:99077894-99077916 CCTGTCACGGGGTGGGGGTATGG - Intergenic
1195368349 X:104148676-104148698 CCTGTCATGGGGTAGGAGGACGG + Intronic
1195368742 X:104152225-104152247 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1195517120 X:105789677-105789699 CCTGTCATGGGGTGGGGGGCTGG + Intergenic
1195572588 X:106412999-106413021 CCTGTCATGGGGTGGGAGGCGGG + Intergenic
1195593132 X:106655489-106655511 CCTGTCATGGGGTGGGCGGTGGG - Intronic
1195602596 X:106765866-106765888 CCTGTCGTGGGGTGGGGGGCTGG - Intronic
1195660823 X:107376195-107376217 CCTGTCAGGGGGTGGGGGGAGGG - Intergenic
1195665642 X:107427698-107427720 CCTGTCATGGGGTGGGGGGCTGG + Intergenic
1195728712 X:107943712-107943734 CCTGTCATGGGGTGGGGGGCAGG - Intergenic
1195932314 X:110090856-110090878 CCTGTCATGGGGTGGGGGGCTGG - Intronic
1195945343 X:110204436-110204458 ACTGGCAAGGGGTGGGGAGCGGG + Intronic
1195951383 X:110277411-110277433 CCTGTCATGGGGTGGGGGGCTGG + Intronic
1195955762 X:110328614-110328636 CCTGTCAGGGGGTGGGGGCCTGG - Intronic
1195956251 X:110333819-110333841 CCTGTCAGGGGGTGGGGGTCTGG + Intronic
1195988883 X:110662881-110662903 CCTGTCAGGTGGTGGGGGGCTGG + Intergenic
1196079313 X:111614498-111614520 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1196115312 X:111993049-111993071 CCTGTCAGGGGGTGGGGGGCTGG - Intronic
1196119008 X:112028423-112028445 CCTGTCATGGGGTGGGGGCCTGG - Intronic
1196232586 X:113240883-113240905 GCTGGCATGGGGTGAGAGGGTGG + Intergenic
1196296128 X:113999335-113999357 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1196337677 X:114557812-114557834 CCTCCCATGGGGTTGGAGGCAGG - Intergenic
1196361725 X:114868989-114869011 CCTGTCAGGGGTTGGGGGGCTGG - Intronic
1196459525 X:115915976-115915998 CCTGTCACGGGGTGGGGGGACGG + Intergenic
1196854141 X:119967193-119967215 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1196979211 X:121193179-121193201 CCTGTCAGGGGGTAGGGGGCTGG - Intergenic
1197490291 X:127107882-127107904 CCTGTCATGGTGTGGGAGGCTGG + Intergenic
1197575419 X:128204913-128204935 CCTGTCACGGGGTGGGGGGAGGG + Intergenic
1197576356 X:128216937-128216959 CCTGTCAGGGAGTGGGGGGCTGG + Intergenic
1198161792 X:134015511-134015533 CCTGTCGGGGGGTGGGGGGCTGG - Intergenic
1198179683 X:134194111-134194133 CCTGTCAGGAGGTGGGGGGCTGG + Intergenic
1198587819 X:138142331-138142353 CCTGTCATGGGGTGGGGGGATGG - Intergenic
1198790172 X:140336573-140336595 TCTGTCATGGGGTGGGGGGCTGG + Intergenic
1199000545 X:142631385-142631407 CCTGTCAGGGGATGGGGGGCTGG + Intergenic
1199120938 X:144053308-144053330 CCTGTCAGGCGGTGGGGGGCTGG - Intergenic
1199384327 X:147206311-147206333 CCTGTCAGGGGTTGGGGGGCTGG + Intergenic
1199468237 X:148164548-148164570 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1199475545 X:148240932-148240954 CCTGTCATGGGGTGGGGGGATGG + Intergenic
1199772813 X:150984649-150984671 CCCGGCACGGGGGCCGAGGCGGG + Intronic
1199826441 X:151505063-151505085 CCTGTCGTGGGGTGGGAGGCTGG - Intergenic
1199901853 X:152181664-152181686 CCTGTTGTGGGGTGGGAGGCTGG + Intronic
1199911271 X:152289664-152289686 CCTGTCGTGGGGTGGGGGGCAGG - Intronic
1199976857 X:152899257-152899279 CCTGGCTGGGGGCGGGAGGCAGG + Intergenic
1200047040 X:153408664-153408686 TCTGGCAGGGGGGCGGAGGCAGG + Intergenic
1200294937 X:154910414-154910436 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1200356225 X:155555029-155555051 CCTGTCAGGGGGTGGGGAGCTGG - Intronic
1200370845 X:155722930-155722952 CCTGTCAGGGGGTGGGGGGCTGG - Intergenic
1200559454 Y:4682556-4682578 CCTGTTGAGGGGTGGGAGGCTGG - Intergenic
1200612136 Y:5337714-5337736 CCTGGCTGGGGCTGGGCGGCAGG + Intronic
1200650813 Y:5838192-5838214 CCTGTCATGGGATGGGGGGCAGG + Intergenic
1200718638 Y:6578524-6578546 CCTGTCAGGGGGTAGGCGGCTGG + Intergenic
1200743810 Y:6884274-6884296 CCTGTCAGGGGCTGGGGGGCTGG + Intergenic
1201075621 Y:10185192-10185214 TCTGGCAAGGGGTGGGAGAAGGG - Intergenic
1201302214 Y:12518552-12518574 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1201511139 Y:14764557-14764579 TCTGGGATGGGGTGGGAGGTGGG + Intronic
1201914090 Y:19163979-19164001 CCTGTCAGGGGGTGGGGGCCTGG + Intergenic
1202015564 Y:20402671-20402693 CCTGTCAGGGGGTGGGAAGTTGG - Intergenic