ID: 1144961532

View in Genome Browser
Species Human (GRCh38)
Location 17:19046914-19046936
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 2, 1: 0, 2: 1, 3: 9, 4: 121}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144961532_1144961541 6 Left 1144961532 17:19046914-19046936 CCACGGACTCCATGCCGCTGCTC 0: 2
1: 0
2: 1
3: 9
4: 121
Right 1144961541 17:19046943-19046965 CCAGCAGCTGGGCTCAGAGCTGG 0: 2
1: 0
2: 8
3: 73
4: 543
1144961532_1144961539 -5 Left 1144961532 17:19046914-19046936 CCACGGACTCCATGCCGCTGCTC 0: 2
1: 0
2: 1
3: 9
4: 121
Right 1144961539 17:19046932-19046954 TGCTCGGGGCTCCAGCAGCTGGG 0: 2
1: 1
2: 0
3: 19
4: 227
1144961532_1144961542 7 Left 1144961532 17:19046914-19046936 CCACGGACTCCATGCCGCTGCTC 0: 2
1: 0
2: 1
3: 9
4: 121
Right 1144961542 17:19046944-19046966 CAGCAGCTGGGCTCAGAGCTGGG 0: 2
1: 0
2: 7
3: 60
4: 517
1144961532_1144961538 -6 Left 1144961532 17:19046914-19046936 CCACGGACTCCATGCCGCTGCTC 0: 2
1: 0
2: 1
3: 9
4: 121
Right 1144961538 17:19046931-19046953 CTGCTCGGGGCTCCAGCAGCTGG 0: 2
1: 0
2: 2
3: 21
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144961532 Original CRISPR GAGCAGCGGCATGGAGTCCG TGG (reversed) Exonic
900507735 1:3038150-3038172 GAGCAGCGGCAGAGGTTCCGAGG + Intergenic
900973339 1:6003334-6003356 GAGCAGGGTCATGGGGTCAGAGG + Intronic
902058340 1:13620793-13620815 GAGCTGCAGCATGGAGTCTGGGG + Intergenic
904687808 1:32273550-32273572 GAGGAGCTGCAGGGACTCCGGGG + Intronic
910703851 1:90105444-90105466 GAGCATCAGCATGGAGTCCGGGG - Intergenic
914988532 1:152479319-152479341 GAGCAGAGGCACTGAGTCTGTGG + Intergenic
916128283 1:161590246-161590268 GAGAAGGGGCATGGAGGGCGGGG - Intronic
916138203 1:161672077-161672099 GAGAAGGGGCATGGAGGGCGGGG - Intronic
918536899 1:185584805-185584827 GAGCAGTGGCATGGATCCCGGGG + Intergenic
919763850 1:201114313-201114335 GAGCAGTGGCATGGTAACCGAGG + Exonic
921446962 1:215258362-215258384 GAGCATAGGCATGGAGACCTTGG - Intergenic
1063662124 10:8042174-8042196 GTGCAGCGTCATGGGGTGCGAGG + Intergenic
1065449533 10:25842378-25842400 GCTCAGGGGCATGGACTCCGAGG + Intergenic
1067461275 10:46460380-46460402 GATCAGGGGCAGGGAGTCCTGGG - Intergenic
1067625920 10:47924221-47924243 GATCAGGGGCAGGGAGTCCTGGG + Intergenic
1070151986 10:73811079-73811101 GAGCAGCGGCGCGGAGGCTGCGG + Intronic
1070843648 10:79505194-79505216 GAGCAGGAGCATGGAGGCTGCGG - Intergenic
1070930018 10:80254406-80254428 GAGCAGGAGCATGGAGGCTGCGG + Intergenic
1072608446 10:97001821-97001843 GAGCGGCAGCAGGAAGTCCGAGG - Intronic
1073105635 10:101030862-101030884 GAGCCGCAGCCTGGAGCCCGCGG - Intronic
1074813245 10:117126015-117126037 AAGCAGCGGCATGGGGGCTGAGG - Intronic
1076833346 10:133007749-133007771 GGGCAGAGGCAGGAAGTCCGGGG + Intergenic
1077554986 11:3221613-3221635 GAGCTGCGGAACGCAGTCCGTGG - Intergenic
1083920114 11:65777967-65777989 CAGCAGCAGCTTTGAGTCCGGGG + Exonic
1083923256 11:65791635-65791657 GAGCAGAGGCACGGACACCGAGG - Intronic
1084117367 11:67050088-67050110 GGGCAGGGGCCTGGAGTACGAGG + Exonic
1091813915 12:3421839-3421861 GAGCAACGGGATGGAGGCTGAGG + Intronic
1095949805 12:47775758-47775780 GAGCAGAGTCATGGAGCCCCTGG + Intronic
1096184228 12:49567845-49567867 GCGCAAAGGCATGGAGACCGTGG - Intronic
1096634416 12:52949335-52949357 CAGGGGCGGCATGGGGTCCGGGG + Exonic
1104724363 12:131066826-131066848 GAGGAGCGGCCAGGAGGCCGAGG + Intronic
1104917707 12:132274414-132274436 GAGCAGCAGGCTGGAGGCCGGGG - Intronic
1106584688 13:31046759-31046781 GTGCGGCGGCATGGTGTGCGTGG - Intergenic
1113185228 13:107679890-107679912 AAACAGCTGCATGGAGTCAGTGG - Intronic
1113777649 13:112957512-112957534 GAGGCGCGGCATGGAGTCCAGGG - Intronic
1114656168 14:24316782-24316804 GAGCAGGGGCGTGGAGGGCGTGG + Exonic
1118983262 14:70732864-70732886 GAGCAGCGTCAGGGAGGCAGAGG + Exonic
1122557615 14:102590177-102590199 GGGCAGCGGGATGGGGTCCTAGG + Intergenic
1122775082 14:104113492-104113514 GGGCAGCAGCAGGGAGTCCCTGG - Exonic
1122816578 14:104316954-104316976 GAGCAGAGGCAGGGAGGCCCGGG + Intergenic
1123584135 15:21742214-21742236 GAGCAGGGGCAGGGAGGGCGGGG - Intergenic
1123620785 15:22184817-22184839 GAGCAGGGGCAGGGAGGGCGGGG - Intergenic
1125521619 15:40351029-40351051 GAGCAGGGGCAGGAAGTCTGGGG - Exonic
1128778419 15:70341686-70341708 CAGCAGGGGCATGGAGACCTGGG - Intergenic
1130120366 15:81042398-81042420 GAGAAGAGGCATGGAGGACGAGG + Intronic
1132603540 16:784320-784342 GAGCAGCAGCAGTGAGTCCAGGG + Intergenic
1133008666 16:2898226-2898248 CAGCAGAGGGATGGAGGCCGAGG - Intronic
1138106480 16:54289605-54289627 GAGCCGGGGCTGGGAGTCCGAGG - Intergenic
1138360720 16:56425316-56425338 GAGCAGCGGCATGGCGGCAGCGG + Exonic
1140477339 16:75245479-75245501 GAGCACAGGCAGGGAGGCCGGGG + Intronic
1142711105 17:1724592-1724614 GAGCAGCGGGAGGGAGGGCGGGG + Intronic
1142959317 17:3542782-3542804 GAGCAGGGGCTTGGGGTCTGCGG - Intronic
1143125880 17:4640676-4640698 GAGCAAGGGCGTGGAGTGCGGGG + Intronic
1143402599 17:6656146-6656168 GAGCAAGGGCGTGGAGTGCGGGG - Intergenic
1144961532 17:19046914-19046936 GAGCAGCGGCATGGAGTCCGTGG - Exonic
1144973628 17:19127610-19127632 GAGCAGCGGCATGGAGTCCGTGG + Exonic
1146465652 17:33084149-33084171 GAGCAGGGGCAGGGACTCCCAGG + Intronic
1148431876 17:47649715-47649737 GGGCAGCGGAATGGAGCGCGCGG - Intronic
1148874401 17:50678099-50678121 GAGCATCGGAGTGGAGTTCGTGG + Exonic
1151318442 17:73338142-73338164 GAGCAGCGGCAGTGGGTCCAGGG + Exonic
1158837831 18:61350069-61350091 GAGCAACGGCATGGAGTTCCTGG - Intronic
1160165315 18:76506588-76506610 GGGCAGGGGCTGGGAGTCCGGGG - Intergenic
1160681155 19:412184-412206 GGGCAGGGGCAGGGAGCCCGGGG + Intergenic
1161067326 19:2245203-2245225 GAGCAGAGGCATGGAGTTGTTGG + Intronic
1161683890 19:5693803-5693825 GAGCACCGGCCTGGGCTCCGAGG - Intronic
1162433735 19:10644369-10644391 GAGCAGAGACATGAAGTCTGAGG - Exonic
1164537850 19:29099586-29099608 AAGCAGCAGCATGGAGGCAGGGG - Intergenic
1164643648 19:29843558-29843580 GAGCAGCGACTTGGGGCCCGAGG + Intergenic
1168339090 19:55613660-55613682 GAGCAGCGGCATCGGGGGCGAGG + Exonic
926125143 2:10267440-10267462 GAGGAGCTGCTTGGAGTCAGCGG - Intergenic
926269711 2:11355901-11355923 GAGCAATGGAATGCAGTCCGCGG - Intergenic
928171856 2:29009491-29009513 GGGCAGAGGCAGGGAGTCTGTGG + Intronic
931214013 2:60224883-60224905 GAGCAGCAGCCTGGAGACCCAGG - Intergenic
932217331 2:69975391-69975413 CAGCACCGGCAGGGAGGCCGAGG - Intergenic
932323422 2:70838386-70838408 GAGCAAAGGCATGGAATCCTGGG + Intergenic
936472507 2:112811619-112811641 GAGGAGCAGCCTGAAGTCCGGGG + Intergenic
939057947 2:137385361-137385383 GAGCAGGGGCATGGAGGCCAGGG - Intronic
944581776 2:201138078-201138100 GGGCAGGGGCATGGACTGCGCGG - Intronic
1172037332 20:32019218-32019240 GAGCGGCGGCACGGAGGCGGCGG + Exonic
1172125446 20:32622754-32622776 AAGCAACGGCCTGGAGGCCGAGG + Intergenic
1172164947 20:32893378-32893400 GAGCAGAGGCAGGGAGTGGGGGG - Intronic
1172535082 20:35666464-35666486 TAGCAGGGGCATGAAGTTCGGGG - Intronic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1173754184 20:45500324-45500346 GAGCAGAGCCATGGTGTCAGTGG + Intergenic
1176039665 20:63058764-63058786 GAAGAGGGGCTTGGAGTCCGAGG - Intergenic
1176195969 20:63836424-63836446 GAGCAGGGGCAGGGAGAGCGCGG + Intergenic
1179194370 21:39151746-39151768 GAGCGGCTGCATGGAGGCTGAGG + Intergenic
1182002529 22:26931726-26931748 GAGCAGCCGCAAGGAATCCATGG - Intergenic
1185129796 22:49032419-49032441 TAGCAGGGGCAGGGAGGCCGGGG + Intergenic
1185415108 22:50705412-50705434 CAGCAGCTGCCTGGAGGCCGGGG + Intergenic
953748755 3:45594237-45594259 GAGCAGCGGCAGGAAGTTCACGG - Intronic
956778695 3:72587601-72587623 GAACAGCGCCATGGAGACCTAGG - Intergenic
961296107 3:125885930-125885952 GAGCAAGAGCATGGAGTCCCTGG - Intergenic
963236662 3:142963325-142963347 GCGCCGCGGCATGGTGCCCGGGG + Exonic
964480438 3:157133579-157133601 GAGAAGCAGCATGGAGTTTGGGG + Intergenic
965401462 3:168217977-168217999 GAGCACAGGCATGGAGGCCAGGG - Intergenic
970193570 4:13536066-13536088 GAGCAGGGGCATGGAGTGGGAGG + Intergenic
970583226 4:17492254-17492276 GAACAGCGGCATGCCGCCCGGGG - Exonic
978138708 4:105293876-105293898 TAGCAGGGGGATGGAGTCCATGG + Intergenic
984711994 4:182893634-182893656 GAGCAGCGGCCTTCAGTGCGGGG - Intronic
987373238 5:17212256-17212278 GAGCAGCGGCATGGGCTACTTGG + Intronic
992616070 5:78547503-78547525 GAGCAGTGGCATGGAAACCAAGG + Intronic
994626201 5:102222513-102222535 TAGCAGCAGCAGGGAGTCAGAGG + Intergenic
1001955250 5:175844243-175844265 TAGCAGCGGGATGGAGACAGGGG + Intronic
1010428087 6:75748826-75748848 GAGAAGGGGCGAGGAGTCCGGGG - Intergenic
1017950742 6:159132893-159132915 TGGCAGCGGCAGGGAGTCTGTGG + Intergenic
1018060277 6:160084626-160084648 GAGCAGGGGCATGGACTCACAGG + Intronic
1024062999 7:45713031-45713053 GGGCAGCAGCATGGTGTCGGTGG - Intronic
1025663160 7:63567746-63567768 GAGCACGGGCATGCCGTCCGTGG + Intergenic
1029020212 7:97357223-97357245 GAGCAGCAGCAAGGAGTGGGGGG + Intergenic
1034982848 7:155489690-155489712 GAGCAGGGGCCTGGACTCCATGG + Intronic
1038503444 8:28064044-28064066 GAGAAGGAGCATGGGGTCCGTGG - Intronic
1043891226 8:85654472-85654494 GGGCCGCGGCAGGGATTCCGGGG + Intergenic
1043892300 8:85661309-85661331 GGGCCGCGGCAGGGATTCCGGGG + Intergenic
1043893261 8:85716031-85716053 GGGCCGCGGCAGGGATTCCGGGG - Intergenic
1043895944 8:85737480-85737502 GGGCCGCGGCAGGGATTCCGGGG - Intergenic
1043896735 8:85744328-85744350 GGGCCGCGGCAGGGATTCCGGGG + Intergenic
1043899058 8:85762695-85762717 GGGCCGCGGCAGGGATTCCGGGG + Intergenic
1043900669 8:85774889-85774911 GGGCCGCGGCAGGGATTCCGGGG + Intergenic
1043902633 8:85790164-85790186 GGGCCGCGGCAGGGATTCCGGGG + Intergenic
1043904243 8:85802357-85802379 GGGCCGCGGCAGGGATTCCGGGG + Intergenic
1043905855 8:85814551-85814573 GGGCCGCGGCAGGGATTCCGGGG + Intergenic
1043907463 8:85826738-85826760 GGGCCGCGGCAGGGATTCCGGGG + Intergenic
1047839785 8:128738686-128738708 GAGCAGTGTGATGGAGTCTGAGG + Intergenic
1049701991 8:144019538-144019560 GAGCTGCGGCATGCAGACTGCGG + Intronic
1053407770 9:37892382-37892404 GAGCAGCGGCATCGCGTTCTTGG + Intronic
1060208497 9:121696618-121696640 GAGCAGAGGACTGGAGTCCACGG + Intronic
1061283574 9:129610333-129610355 GAGCAAGGGCGTGGAGTCCGGGG + Intronic
1062374113 9:136254331-136254353 CAGAAGCGGCATGGAGCCCCAGG - Intergenic
1187378155 X:18776039-18776061 GAGCAGCGGCAGGGAGCCCTGGG - Intronic
1189915442 X:45851439-45851461 GAGTAGGCGCGTGGAGTCCGGGG - Intergenic
1190526420 X:51333109-51333131 GGGCGGGGGCATGGAGCCCGAGG + Exonic
1190542817 X:51496279-51496301 GGGCGGGGGCATGGAGCCCGAGG - Exonic