ID: 1144970504

View in Genome Browser
Species Human (GRCh38)
Location 17:19106262-19106284
Sequence GACTCAGGCTCAGAGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144970495_1144970504 21 Left 1144970495 17:19106218-19106240 CCATTCCTGAACTAATCACTGAC No data
Right 1144970504 17:19106262-19106284 GACTCAGGCTCAGAGCTGGAAGG No data
1144970497_1144970504 16 Left 1144970497 17:19106223-19106245 CCTGAACTAATCACTGACCAGGG No data
Right 1144970504 17:19106262-19106284 GACTCAGGCTCAGAGCTGGAAGG No data
1144970501_1144970504 -1 Left 1144970501 17:19106240-19106262 CCAGGGAGGGAAAGCTCTGATTG No data
Right 1144970504 17:19106262-19106284 GACTCAGGCTCAGAGCTGGAAGG No data
1144970494_1144970504 22 Left 1144970494 17:19106217-19106239 CCCATTCCTGAACTAATCACTGA No data
Right 1144970504 17:19106262-19106284 GACTCAGGCTCAGAGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144970504 Original CRISPR GACTCAGGCTCAGAGCTGGA AGG Intergenic
No off target data available for this crispr