ID: 1144971084

View in Genome Browser
Species Human (GRCh38)
Location 17:19110391-19110413
Sequence ACTCCCACCCTGATTGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144971080_1144971084 2 Left 1144971080 17:19110366-19110388 CCCCTGCTGTGAGAAGTCTCTGC No data
Right 1144971084 17:19110391-19110413 ACTCCCACCCTGATTGGAGCAGG No data
1144971077_1144971084 21 Left 1144971077 17:19110347-19110369 CCCTGACTCATGCTCCGCGCCCC No data
Right 1144971084 17:19110391-19110413 ACTCCCACCCTGATTGGAGCAGG No data
1144971079_1144971084 7 Left 1144971079 17:19110361-19110383 CCGCGCCCCTGCTGTGAGAAGTC No data
Right 1144971084 17:19110391-19110413 ACTCCCACCCTGATTGGAGCAGG No data
1144971082_1144971084 0 Left 1144971082 17:19110368-19110390 CCTGCTGTGAGAAGTCTCTGCTG No data
Right 1144971084 17:19110391-19110413 ACTCCCACCCTGATTGGAGCAGG No data
1144971081_1144971084 1 Left 1144971081 17:19110367-19110389 CCCTGCTGTGAGAAGTCTCTGCT No data
Right 1144971084 17:19110391-19110413 ACTCCCACCCTGATTGGAGCAGG No data
1144971076_1144971084 30 Left 1144971076 17:19110338-19110360 CCTAGCAAGCCCTGACTCATGCT No data
Right 1144971084 17:19110391-19110413 ACTCCCACCCTGATTGGAGCAGG No data
1144971078_1144971084 20 Left 1144971078 17:19110348-19110370 CCTGACTCATGCTCCGCGCCCCT No data
Right 1144971084 17:19110391-19110413 ACTCCCACCCTGATTGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144971084 Original CRISPR ACTCCCACCCTGATTGGAGC AGG Intergenic
No off target data available for this crispr