ID: 1144971201

View in Genome Browser
Species Human (GRCh38)
Location 17:19110991-19111013
Sequence CTCGGGATTGGGGGTTTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144971194_1144971201 -6 Left 1144971194 17:19110974-19110996 CCAGGGTTTGTGTGGCGCTCGGG No data
Right 1144971201 17:19110991-19111013 CTCGGGATTGGGGGTTTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144971201 Original CRISPR CTCGGGATTGGGGGTTTTTT GGG Intergenic