ID: 1144976953

View in Genome Browser
Species Human (GRCh38)
Location 17:19144233-19144255
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 635
Summary {0: 2, 1: 0, 2: 3, 3: 70, 4: 560}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144976953 Original CRISPR GGAAAAACAAGGCTGGGGTG GGG (reversed) Intronic
900051285 1:598922-598944 GGAAGAACACGGCGGGGGGGGGG + Intergenic
900110725 1:1004388-1004410 GAGGAACCAAGGCTGGGGTGGGG + Intergenic
900512027 1:3065277-3065299 GGAGGAACAAGGTGGGGGTGTGG + Intergenic
901882922 1:12204477-12204499 GGGAGAACCAGGCTGGGGTGAGG + Intronic
901943212 1:12679707-12679729 AAAAAAAAAAGGGTGGGGTGAGG + Intergenic
902570944 1:17346714-17346736 GGCAAAGCAAGGCAGTGGTGGGG - Intronic
903168068 1:21534934-21534956 GGAAAAAGAAGGCAGGGAGGAGG - Intronic
903655009 1:24943644-24943666 GGAAAAACAGGTCTGGAGAGGGG + Intronic
904410188 1:30320440-30320462 GGACAGACAAGGCTGGTCTGTGG - Intergenic
904870391 1:33614135-33614157 TAAAAAAAAAGGCGGGGGTGGGG - Intronic
905933097 1:41803513-41803535 GGAAAAGCAATGCTGGGGTGTGG - Intronic
906534237 1:46543014-46543036 GCAAAATCAAGGTGGGGGTGGGG - Intergenic
907031563 1:51177281-51177303 GGAAAAAGAACCCTGTGGTGTGG + Intergenic
908163981 1:61439347-61439369 GGAAAAAAAAGGCGGGGGAGGGG - Intronic
908400776 1:63771308-63771330 AAAAAAAAAATGCTGGGGTGGGG - Intergenic
908746050 1:67377685-67377707 GGAAAAAAATGGGTGGGGGGTGG - Intronic
910335318 1:86121972-86121994 GGAAAAACCAGGCTGGCTTCAGG + Intronic
910533867 1:88273656-88273678 GGAGAGATAATGCTGGGGTGGGG + Intergenic
910881909 1:91929439-91929461 GGGAAAACAGGGCAGGGCTGGGG + Intergenic
912777100 1:112512615-112512637 GGAAAAACAAAGCTAGAGTCAGG + Intronic
912952465 1:114129460-114129482 GCAGAAACAGGGCTGGGGAGGGG - Intronic
913157160 1:116111217-116111239 GGAAAATCAAGGCTGTTTTGAGG + Intergenic
913275790 1:117136694-117136716 GAAAAAAAAAGGGTGGGGGGTGG + Intergenic
913520733 1:119643625-119643647 GGGAGAAGAAGGCTGGGGAGAGG - Intronic
913997716 1:143665222-143665244 GGAAAGGCAGGGCTGGGTTGAGG - Intergenic
915130632 1:153693323-153693345 GGAAAAAAGAGGATGGGCTGGGG - Intronic
915183631 1:154084793-154084815 AAAAAAAAAAGGCTGGGGTTGGG + Intronic
915505842 1:156355779-156355801 AAAAAAAAAAGGCGGGGGTGGGG - Intronic
915787903 1:158635987-158636009 TGAAAGACAAGGCTGCTGTGGGG - Exonic
916121207 1:161529846-161529868 AAAAAAAAAAGGCTGGGGAGCGG + Intergenic
916223837 1:162470189-162470211 GGAACAAGAAGGCTGGGGGAAGG - Intergenic
916392570 1:164346605-164346627 TGAAAAAAGAGGCTGGGGTAAGG - Intergenic
916684987 1:167136236-167136258 GCAAAGAAGAGGCTGGGGTGGGG + Intergenic
916720477 1:167481750-167481772 GGAAAAGCAGTGGTGGGGTGGGG + Intronic
916883483 1:169045248-169045270 GAACAAACAAGGCTGAGGAGTGG - Intergenic
916892101 1:169122000-169122022 GGAAAGACAAGGCAGGAGGGTGG - Intronic
917247512 1:173020672-173020694 GGAAAAATAAAGCTGATGTGAGG - Intergenic
918202455 1:182279983-182280005 GGGAAAACAATGTTGGGGAGAGG + Intergenic
920433637 1:205934839-205934861 AGAGAAACAGGGCTGGGCTGGGG + Intronic
921216302 1:212939816-212939838 GGAAAAAAAAGTGTGGGATGGGG - Intergenic
921382261 1:214536148-214536170 GGAAGGCCAAGGCCGGGGTGGGG + Intronic
922001563 1:221483801-221483823 GGAAAAGCAAGGCAGGGCAGGGG + Intergenic
922228846 1:223668260-223668282 GGATGAACAGGGCTGGGGTGGGG - Intergenic
922582646 1:226710144-226710166 TGGAAAAGAAGTCTGGGGTGGGG + Intronic
923329510 1:232909609-232909631 GGAAAGCCCAGGTTGGGGTGGGG - Intergenic
923512722 1:234666429-234666451 GGAAAAACCAGGCTGGGCTAGGG - Intergenic
923873901 1:238026912-238026934 GTAAAAACAAATCTGTGGTGAGG + Intergenic
924909892 1:248498577-248498599 TGAGAAACAAGGATGTGGTGGGG + Intergenic
924914209 1:248549482-248549504 TGAGAAACAAGGATGTGGTGGGG - Intergenic
924933658 1:248750362-248750384 GGAGAAACAACGCTTGGCTGAGG - Intronic
1063496564 10:6514747-6514769 GGAAAGAGAAAGCTGGGTTGAGG - Intronic
1063751701 10:8956259-8956281 GTAAAAAGAAGGCTGCTGTGAGG + Intergenic
1063928870 10:11009113-11009135 GGAAAGACAAGGCAGTGGTGTGG + Intronic
1063960966 10:11305138-11305160 GGAAATCCAAGGCTGGTGAGGGG + Intronic
1065278917 10:24115042-24115064 AGAAAAACTGGGCTGAGGTGGGG - Intronic
1065460933 10:25963549-25963571 GGAGAAACAGGGCAGGAGTGAGG + Intronic
1066221294 10:33337205-33337227 GGAAAGACAAGGTCGGGGTGGGG - Intergenic
1066694355 10:38064678-38064700 ACAAAAACAAGTGTGGGGTGGGG - Intronic
1067509939 10:46886188-46886210 GGAAAAACCAAGCAAGGGTGGGG + Intergenic
1067652314 10:48165670-48165692 GGAAAAACCAAGCAAGGGTGGGG - Intronic
1068939229 10:62664561-62664583 GGGAAGCCAGGGCTGGGGTGTGG + Intronic
1069103051 10:64347698-64347720 GGGCAAACCAGGTTGGGGTGTGG + Intergenic
1069103291 10:64351236-64351258 GGGCAAACCAGGTTGGGGTGTGG - Intergenic
1069130783 10:64699455-64699477 GGAACAACAAGGTGGGGGCGAGG + Intergenic
1069607320 10:69747865-69747887 GGAAGCACAAGGCTGGATTGTGG - Intergenic
1069608139 10:69753125-69753147 GAACAAAGGAGGCTGGGGTGGGG - Intergenic
1069903768 10:71720453-71720475 GGAGAAAGAAGGCTGGGGGAGGG - Intronic
1071050054 10:81436353-81436375 GGAAAAACAAGGAAAGGCTGAGG + Intergenic
1071210128 10:83331588-83331610 GAGAAGATAAGGCTGGGGTGGGG - Intergenic
1073057043 10:100709712-100709734 GGAACTGGAAGGCTGGGGTGGGG - Intergenic
1074139029 10:110655266-110655288 GAAAAAAAAGGGCGGGGGTGGGG - Intronic
1074448209 10:113537799-113537821 GGAAAAACAGGCCTGGGTGGGGG - Intergenic
1075315835 10:121452686-121452708 AGATAAACAAGGCTCGGGGGAGG - Intergenic
1076492186 10:130869421-130869443 GGAAACACAGGGCTGGGCAGAGG - Intergenic
1076504281 10:130961792-130961814 GGAAGAGAAAGTCTGGGGTGGGG + Intergenic
1076686824 10:132201919-132201941 GGAACAAGAAGGCTGAGCTGAGG - Intronic
1076848596 10:133082111-133082133 GGAAAGCCATGTCTGGGGTGGGG + Intronic
1077225968 11:1439335-1439357 GGAAACCCAGGGTTGGGGTGTGG + Intronic
1077339420 11:2019375-2019397 GGATAAGCAAGGCTGGGCGGTGG + Intergenic
1077406864 11:2386623-2386645 GGAAGACCAAGGCTCAGGTGAGG + Intronic
1078667386 11:13337993-13338015 TGAAAAAAAAGCCTGGTGTGTGG + Intronic
1078673388 11:13385608-13385630 GGAAAATGAAGCATGGGGTGGGG - Intronic
1078699959 11:13670220-13670242 GGAATAACAGGGCCTGGGTGGGG - Intronic
1081542096 11:44042743-44042765 GGAAAGACCAGGATGGGGTTGGG - Intergenic
1082177779 11:49081581-49081603 GCAGAAAGCAGGCTGGGGTGGGG + Intergenic
1082793319 11:57362405-57362427 GGAAAATCAAGGCTTGGGCATGG + Intronic
1082891031 11:58139018-58139040 AGAAAGACAAAGCAGGGGTGGGG + Intronic
1083412894 11:62506027-62506049 AAAAAAAAAAGGCGGGGGTGGGG + Intronic
1083729037 11:64643197-64643219 GGAAAAACCGAGCTGGGGAGCGG + Intronic
1083775806 11:64893880-64893902 GGGAAACCAAGGCTCGGGTTGGG - Intergenic
1084531010 11:69727730-69727752 GGAAACACAAGTGTGAGGTGTGG + Intergenic
1084611673 11:70207026-70207048 GGAGAGGCATGGCTGGGGTGGGG + Exonic
1084637529 11:70401845-70401867 AGAAAAAAAAGGCTGGTGGGGGG + Intronic
1084920645 11:72466820-72466842 ACAAGAACAAGGCTGGGGCGGGG + Intergenic
1085314833 11:75538473-75538495 GGATACACAAGTCTGGGGTCTGG + Intergenic
1085794286 11:79523218-79523240 TGGAAAATAAGGCTGGGGGGAGG + Intergenic
1086316292 11:85596641-85596663 GGAAAAAAAAGGGTAGGATGGGG + Intronic
1086687939 11:89754279-89754301 GCAGAAAGCAGGCTGGGGTGGGG - Intergenic
1086717910 11:90085615-90085637 GCAGAAAGCAGGCTGGGGTGGGG + Intergenic
1086834170 11:91600725-91600747 AGAAAAAGAAGGCTGGGGCCTGG + Intergenic
1087658411 11:100955422-100955444 GGAGATACAGGGCTGGGGTAGGG + Intronic
1088394456 11:109351081-109351103 GGAAATGCAGGGCTAGGGTGAGG - Intergenic
1088916936 11:114234732-114234754 GGATGGAGAAGGCTGGGGTGGGG - Intronic
1088942457 11:114473947-114473969 TGGAAGAGAAGGCTGGGGTGGGG + Intergenic
1089455966 11:118625973-118625995 GACATGACAAGGCTGGGGTGGGG - Intronic
1089589615 11:119532014-119532036 GTGAAAACAGGGCTGGGCTGTGG - Intergenic
1089870733 11:121670678-121670700 GGAAAAAGGAGGGTGGGGTGTGG - Intergenic
1090236261 11:125150011-125150033 GGAAGAACAAGGATGGAGTTGGG - Intergenic
1090475496 11:127016398-127016420 GGAACACCCAGTCTGGGGTGAGG - Intergenic
1090779596 11:129995642-129995664 GAAAAAAAAAGGCGGGGGAGAGG + Intronic
1202822405 11_KI270721v1_random:74564-74586 GGATAAGCAAGGCTGGGCGGTGG + Intergenic
1091508378 12:1096570-1096592 GGACAAACTAGGCTGGGAGGAGG + Intronic
1091715690 12:2774664-2774686 GGAACAATAGGGGTGGGGTGGGG + Intergenic
1091861991 12:3793876-3793898 GGACAAAGAAGGATGGGGAGAGG + Intronic
1092670456 12:10855467-10855489 GGAAAATGAAGTCTGGGCTGAGG + Intronic
1093208160 12:16275956-16275978 GGAAAAATAAAGCTGGGTAGGGG - Intronic
1093308925 12:17554058-17554080 GAAACAACATGGCTGGGTTGGGG + Intergenic
1094078575 12:26506433-26506455 GGGAAATCAAGGCTGCAGTGAGG + Intronic
1094564561 12:31588338-31588360 GGAAAAATAAAGCAGGGGAGTGG - Intronic
1094836009 12:34322407-34322429 GGAAAAACAAGGCAAGGCAGAGG - Intergenic
1095450171 12:42322842-42322864 GGAATAACAAGGTAGTGGTGAGG - Intronic
1096694211 12:53338552-53338574 GGACAGACAGGGCTGGGGAGAGG + Intronic
1096744715 12:53718523-53718545 GAAAAAAAAGGGGTGGGGTGTGG - Intronic
1097176893 12:57148561-57148583 GGAAATGCAGGGCTGGGCTGGGG - Intronic
1097870065 12:64594335-64594357 GAAAAAAAAGGGGTGGGGTGTGG + Intergenic
1098037625 12:66321352-66321374 GGAAAGAGATGGTTGGGGTGGGG + Intronic
1098039008 12:66335404-66335426 GGAAAACCAGGGCTGTGGGGAGG + Intronic
1099128399 12:78795308-78795330 GGAAAAAAAAGGGCCGGGTGCGG + Intergenic
1100647963 12:96551183-96551205 GGGAAATCAAGGCTGCAGTGAGG + Intronic
1100902749 12:99261542-99261564 GGATATACAAGTCTGGAGTGTGG - Intronic
1101249014 12:102913816-102913838 AGAAAACCAAGGTTGGGGTTAGG + Intronic
1102618055 12:114172033-114172055 GGGAAAACAAGGTTCGGATGGGG - Intergenic
1102995055 12:117342763-117342785 GGAAAAGCAAGGCTGGGTATGGG + Intronic
1103069128 12:117926246-117926268 AGAAAACCAAGGCTGGGATGGGG - Intronic
1103632879 12:122276954-122276976 GAAAAAAAAAAGGTGGGGTGGGG - Intronic
1104252177 12:127105477-127105499 GGGAAATCAAGGCTGCAGTGAGG - Intergenic
1105239230 13:18595632-18595654 AGAAGACCAAGGCTGGGGAGAGG - Intergenic
1105398452 13:20064322-20064344 GGACAATCTAGGCTGGGCTGGGG - Intronic
1105415836 13:20210709-20210731 GGAAAACTAAGGCTGGACTGTGG + Intergenic
1106097445 13:26660516-26660538 GCAAAAACAGGACTGGCGTGGGG + Intronic
1106190843 13:27451013-27451035 GGCAAAACAAAGCTGGGGCCGGG + Intergenic
1106753160 13:32795682-32795704 GGAAAAGCATGGGTGGGGTCGGG - Intergenic
1106834048 13:33614812-33614834 TCAAAGACAAGGCTGGGGAGGGG + Intergenic
1106873470 13:34046777-34046799 AGCAAGGCAAGGCTGGGGTGCGG - Intergenic
1106917810 13:34534123-34534145 GGAAAATCAAGGAAGAGGTGGGG - Intergenic
1107238075 13:38197457-38197479 AGAAAAACAAGGCGGCGGTGGGG + Intergenic
1110351539 13:74513991-74514013 GTGAAAAAAAGGCTGGAGTGAGG + Intergenic
1111425040 13:88069266-88069288 GGAAATACAATTCTGGGGCGAGG + Intergenic
1111631897 13:90853255-90853277 GGAGATACTAGGTTGGGGTGCGG + Intergenic
1111642552 13:90987843-90987865 GGAAAAAGAAAGCTGGAATGAGG + Intergenic
1112498103 13:99921202-99921224 TGAAAAACAAGATTGGGGGGAGG - Intergenic
1112870181 13:103961866-103961888 GGAAAAAAAAAGGTGGGGAGAGG - Intergenic
1114414567 14:22532573-22532595 GGGAAAACATGGGTGGGATGGGG - Intergenic
1115204524 14:30887495-30887517 GTAATATTAAGGCTGGGGTGAGG - Intronic
1115274511 14:31592465-31592487 TGAGAAGAAAGGCTGGGGTGAGG + Intronic
1115288942 14:31748905-31748927 ATAAAAACAAAGCAGGGGTGGGG - Intronic
1115485814 14:33910280-33910302 AGAAACACATGGCTGGGGTTTGG + Intergenic
1115760487 14:36576178-36576200 GGAAAAAGATGGCTGGGAAGAGG + Intergenic
1117167650 14:53054725-53054747 GGAAAAACATGACTAGGGTTTGG - Intronic
1117312896 14:54546405-54546427 TGAGAAACAGGGCTGGGGTGGGG - Intergenic
1118057836 14:62100364-62100386 AAAAAAAAAAGGGTGGGGTGGGG - Intronic
1118068127 14:62214617-62214639 TGAAGAACAAGGCTTAGGTGTGG - Intergenic
1118359668 14:65045363-65045385 GGAAAAAAAAGTATGGGGAGGGG - Intronic
1118821271 14:69347665-69347687 GGTAATAAAATGCTGGGGTGGGG - Intronic
1118846901 14:69554274-69554296 AAAAAAACAGGGGTGGGGTGGGG + Intergenic
1119343009 14:73896762-73896784 GGAAGAGCAAGGCTTGGGGGAGG + Intronic
1119432895 14:74579752-74579774 GGAAATACCAGGCTGGGAAGGGG + Intronic
1119675215 14:76548310-76548332 GGAAAACCCAGGGTGGGATGGGG - Intergenic
1120994400 14:90405691-90405713 GGAAACCCAATGCTGGGCTGTGG - Exonic
1122685171 14:103500909-103500931 GGAAAAGCAAGGCTGGGTGCGGG - Intronic
1122744547 14:103890145-103890167 GGAGAAACAAGGCTGGCCTGGGG - Intergenic
1122901860 14:104785319-104785341 TAAACAACCAGGCTGGGGTGGGG + Intronic
1124881765 15:33649283-33649305 GGAAGAAAAAGACTGGGGGGAGG - Intronic
1125854113 15:42932744-42932766 ATAAAAACTAGGCTGGGGGGCGG + Intergenic
1126580083 15:50234684-50234706 GGCAAATCAAGGCTGCAGTGAGG + Intronic
1126582334 15:50252985-50253007 GGAAGAAAAAGGCAAGGGTGAGG - Intronic
1126663939 15:51058585-51058607 GGGGGAACCAGGCTGGGGTGGGG - Intronic
1127562541 15:60153689-60153711 CGAAAATCAAGGCTGTGCTGTGG + Intergenic
1128272526 15:66323680-66323702 GGAGACACAGGGCTGGGGTGGGG - Intronic
1128309497 15:66621648-66621670 GGAGAAACAGCTCTGGGGTGGGG - Intronic
1128995508 15:72291549-72291571 GGGAAAACAAGGCTAGTGGGGGG + Intronic
1129387551 15:75204036-75204058 GAAAACACAAGGCTAGTGTGGGG - Intronic
1130945274 15:88546385-88546407 GGAAAGAAAAGCCTGGGGCGGGG + Intronic
1131050390 15:89343638-89343660 GGGAAGATAAGGCTGGGGAGGGG + Intergenic
1131285378 15:91052578-91052600 GGAAGAACAGAGATGGGGTGGGG - Intergenic
1131940675 15:97561696-97561718 AGAATAAAAAGGCTGGGGTTGGG - Intergenic
1131958175 15:97760279-97760301 GGAAAAACTGGGCTGCAGTGAGG - Intergenic
1132287039 15:100670926-100670948 GTATTAACAGGGCTGGGGTGAGG - Intergenic
1132845913 16:2000750-2000772 AGAAAAACAAGCCAGGCGTGGGG + Intronic
1133098037 16:3460701-3460723 CAGAAAGCAAGGCTGGGGTGTGG + Intronic
1133148092 16:3805656-3805678 TGACAAACAAGGTTGGGGAGTGG + Intronic
1133928259 16:10211247-10211269 GGAGAAACCAGGGTGGGGGGAGG + Intergenic
1134313737 16:13099422-13099444 GGACAAAGAATGCTGGGGAGAGG + Intronic
1134320185 16:13155709-13155731 GGGGAAACGTGGCTGGGGTGGGG + Intronic
1134676354 16:16093375-16093397 GGGAAAGAAAGGCGGGGGTGCGG - Intronic
1135025994 16:18999415-18999437 AGAAAAATAAGTCAGGGGTGCGG - Intronic
1135732923 16:24909347-24909369 GTAAACATAAGGCTGGGGTGCGG + Intronic
1136025186 16:27464270-27464292 GGGAAAGCCAGGGTGGGGTGAGG + Intronic
1136364899 16:29805508-29805530 GTAAATACACCGCTGGGGTGGGG + Intergenic
1137530184 16:49274654-49274676 GAAAAAAAAAGGCGGGGGCGGGG - Intergenic
1138199144 16:55076133-55076155 GGAAAGACAAGGGAGGGGAGAGG + Intergenic
1138206965 16:55132509-55132531 TAAAGAACAAGGCTGGGGTAGGG - Intergenic
1138358825 16:56408802-56408824 GGAAAAACAAGGCCCTGGAGCGG + Intronic
1138396178 16:56706518-56706540 AGAAAAACAAGGGCCGGGTGTGG - Intronic
1138610347 16:58118532-58118554 AAAAAAACATGGCTGGGGTCAGG + Intronic
1139579490 16:67863968-67863990 GTAAAAGCAATGCTGGGATGAGG + Intronic
1139969498 16:70765090-70765112 GGAAAGACCAGGTTGGGGTGGGG - Intronic
1140315586 16:73893592-73893614 AAAAAAATAAGGCAGGGGTGGGG - Intergenic
1141315202 16:82956085-82956107 GGAAAAAAAAGTCTGGGGCTGGG - Intronic
1141342188 16:83213410-83213432 GAAGAAACAAGGAGGGGGTGGGG - Intronic
1141553005 16:84818853-84818875 GGAGAAACAAGGATGGGGAATGG - Intergenic
1142740072 17:1926716-1926738 GGAAGAACAGGGCTGAGCTGAGG + Intergenic
1143184657 17:5002979-5003001 GGAAAAACAGGGTAGGGGTGGGG - Intronic
1143504426 17:7356000-7356022 TGAAAGACAAGGAAGGGGTGGGG - Intronic
1143836745 17:9699086-9699108 GGAAACGCAAGGCATGGGTGGGG + Intronic
1144461712 17:15463854-15463876 GAAGATACAAGGCTGGGGTCTGG + Intronic
1144958205 17:19030291-19030313 GGAAAAACAAGGCTGGGGTGGGG + Intronic
1144976953 17:19144233-19144255 GGAAAAACAAGGCTGGGGTGGGG - Intronic
1145956955 17:28861288-28861310 GCTCAAACAAGGCAGGGGTGGGG - Intergenic
1146660171 17:34660280-34660302 GGGAAACCAAGGCTGGGTAGAGG + Intergenic
1146713734 17:35065774-35065796 GGAAGAACTAGGATGGAGTGTGG - Intronic
1146841184 17:36155372-36155394 GGAAAAAAAAGGGTGGGGGGAGG + Intergenic
1146853422 17:36243003-36243025 GGAAAAAAAAGGGTGAGGGGAGG + Intronic
1146869332 17:36366895-36366917 GGAAAAAAAAGGGTGAGGGGAGG + Intronic
1147072206 17:37967519-37967541 GGAAAAAAAAGGGTGAGGGGAGG + Intergenic
1147083731 17:38047056-38047078 GGAAAAAAAAGGGTGAGGGGAGG + Intronic
1147099677 17:38171023-38171045 GGAAAAAAAAGGGTGAGGGGAGG + Intergenic
1147308366 17:39578995-39579017 GGAAAAGCAGGTCTGGGGTTGGG + Intergenic
1148094115 17:45040658-45040680 GGGAAAGAAAGGATGGGGTGTGG - Intronic
1148542562 17:48492329-48492351 GGAAAAGCAGCGCGGGGGTGGGG - Intergenic
1148848629 17:50543331-50543353 GGGAAACCAAGGGTGGGGTGAGG + Exonic
1149249694 17:54754239-54754261 AGAAAAAGAAGGCTGGGGACTGG - Intergenic
1149593699 17:57850497-57850519 AGAAAACCAAGGCCGGGGAGGGG + Intergenic
1150285897 17:63953988-63954010 GGAGAATCCTGGCTGGGGTGAGG + Intronic
1150321492 17:64217989-64218011 GGAAAAACAGGTCTGGAGTCTGG + Intronic
1150499265 17:65634631-65634653 GCATAAACAGGGCTGGGCTGTGG - Intronic
1151316224 17:73324228-73324250 GGAAGGACAAGGTGGGGGTGGGG + Intergenic
1151542203 17:74770329-74770351 GTAGAAGCAAGGGTGGGGTGGGG - Intergenic
1151678051 17:75609979-75610001 AGAAAAGCAAGGGTCGGGTGCGG - Intergenic
1152199025 17:78934484-78934506 AGAAAAACAGGCCTGGGGAGAGG - Intergenic
1154449565 18:14463008-14463030 AGAAGACCAAGGCTGGGGAGAGG + Intergenic
1155490933 18:26401300-26401322 AAAAAAAAAAGTCTGGGGTGAGG - Intergenic
1156141384 18:34115560-34115582 GGCAATAAAAGGTTGGGGTGGGG + Intronic
1157116442 18:44866721-44866743 GAAAATAAAAGGCTGGGATGAGG - Intronic
1157319021 18:46620185-46620207 AGAGAATCAAGGCTGGGGGGCGG - Intronic
1157447256 18:47754898-47754920 GAAAAAACAAGGCCTGGGGGAGG + Intergenic
1158082916 18:53615593-53615615 GATAAAACAATGTTGGGGTGTGG - Intergenic
1158105985 18:53885339-53885361 GGAGAAAGAGGGATGGGGTGGGG + Intergenic
1158140173 18:54247092-54247114 GGAAGAACAAAGATGGGGGGTGG - Intergenic
1158878761 18:61756092-61756114 GGAAAAGCATGGCTGGTGTCAGG - Intergenic
1159089689 18:63833668-63833690 AGAAAAAAAAGGCAGGGGAGTGG + Intergenic
1159890119 18:73945059-73945081 GGAACATCAAGGCAGGGGAGAGG - Intergenic
1160178425 18:76614225-76614247 GGAAAATTATGGCTGGGCTGTGG + Intergenic
1160662128 19:306107-306129 GGGAAGGCGAGGCTGGGGTGGGG + Exonic
1160745878 19:710415-710437 AGATAAACAAGGCTGGGGGGTGG - Intronic
1160988154 19:1849089-1849111 CGAGGAACAAGGCTGGGATGGGG + Intergenic
1161282427 19:3453243-3453265 AGAAAAAAAAGGTTGGGGGGCGG + Intronic
1161366697 19:3883996-3884018 AGAAAAACAAAACTGGTGTGGGG + Intronic
1161547800 19:4892520-4892542 AAAAAAAAAAAGCTGGGGTGTGG - Intronic
1162054721 19:8055794-8055816 GGAAGAACTTGGCTGGGGAGGGG + Intronic
1162212049 19:9100085-9100107 GGAAAACCAGTGCTGGGGGGAGG + Intergenic
1162482443 19:10936117-10936139 TGAAAAAAAAGGCGGGGGCGGGG + Intergenic
1163295209 19:16407297-16407319 GAAAAAAAAATGCTGGGGAGTGG - Intronic
1164322392 19:24161257-24161279 GAAAAAAAAAGGCTGCGGTAGGG - Intergenic
1165093896 19:33400371-33400393 GGAAAATCAGGTCTGGGCTGGGG - Intronic
1165263872 19:34644327-34644349 AAAAAAACAAGGCTGGGGCTGGG - Intronic
1165306991 19:35009063-35009085 GGAAAAAACAGGCTGGGATTCGG - Intronic
1166192323 19:41183258-41183280 GGAAAAGAAAGGATGGGGTGAGG + Intergenic
1166730440 19:45056369-45056391 GGGAACACAAGGGTGCGGTGGGG - Intronic
1166870594 19:45868021-45868043 GGGAAAACAATGCGGGGGTGGGG + Intronic
1167125857 19:47548147-47548169 AGAAAAACAAAGCTGGGGCCGGG + Intronic
1167605113 19:50477604-50477626 TGAAAAAGAAGGCTTGGGAGAGG + Intronic
1167658782 19:50783505-50783527 AGAGAGAGAAGGCTGGGGTGAGG + Intergenic
1168349561 19:55668345-55668367 GGTCAGATAAGGCTGGGGTGGGG + Intronic
925303114 2:2830863-2830885 GAAAAAACAAGGGTGGGTTTGGG - Intergenic
925855438 2:8124876-8124898 AGAAAAGCAGGGCGGGGGTGGGG - Intergenic
925959021 2:8997490-8997512 GGAAATACAAGGCTTGGGTTCGG - Intronic
926202948 2:10814313-10814335 GGAAAATCAATGCTGGCATGTGG - Intronic
926580128 2:14625823-14625845 GGAACAACAATGTTGGGGTTGGG + Intergenic
926724313 2:15985156-15985178 GGAAAAGCAAGGAGAGGGTGAGG - Intergenic
926744188 2:16137204-16137226 GGGAGAACCAGGCTGAGGTGAGG + Intergenic
928001330 2:27525244-27525266 GAAGAAAGGAGGCTGGGGTGGGG + Intergenic
928130378 2:28644802-28644824 GAAAAAAAAAGGGTGGGGTGGGG - Intergenic
929305135 2:40352988-40353010 TTAAAAATAAGGCTGGGGTGTGG - Intronic
929693627 2:44095671-44095693 GAAGAAACAAGACTGGGGAGAGG - Intergenic
930020831 2:47001223-47001245 GGAGAAACAGGGCTGGGCAGAGG + Intronic
930033352 2:47071278-47071300 GGAGACACCAGGCTGGGGTCAGG - Intronic
930072296 2:47376548-47376570 GGAACATCAAGGCTCGGGTGAGG - Intronic
930257036 2:49104781-49104803 GGAAATACTGGGCTGGGATGGGG - Intronic
930258329 2:49116974-49116996 GGAAAAACCAAGCTTGGGAGAGG + Intronic
930508385 2:52313329-52313351 GGAAAAATAGGGCTGGGGAATGG - Intergenic
931346935 2:61455170-61455192 ACAAACAAAAGGCTGGGGTGTGG - Intronic
931720142 2:65061615-65061637 TGAAAGACAGGGCTGGTGTGGGG + Intronic
931734218 2:65179333-65179355 AAAAAAAAAAGGCTGGGTTGTGG - Intergenic
932375954 2:71235986-71236008 GGAAAGGCAAGGCTGGGTTTAGG - Intergenic
933123226 2:78569314-78569336 GGAATAACGAGGCTAGGCTGAGG - Intergenic
934582182 2:95451807-95451829 GCAGAAAGAAGGCTGGGGTGGGG - Intergenic
934597268 2:95624907-95624929 GCAGAAAGAAGGCTGGGGTGGGG + Intergenic
934842619 2:97638085-97638107 GCAGAAAGAAGGCTGGGGTGGGG - Intergenic
935251476 2:101265732-101265754 AGGAAAACAAGGCTGGGAAGGGG + Intronic
935302356 2:101703629-101703651 AAAAAAAAAAGGCGGGGGTGGGG + Intronic
935444973 2:103146557-103146579 GGAGAAACATGTCAGGGGTGTGG - Intergenic
936000539 2:108823978-108824000 AGAAAAAAAAGGGAGGGGTGGGG + Intronic
937100234 2:119263027-119263049 GGGAAAAAAAGGCTGGAGTGAGG - Intronic
937154597 2:119710209-119710231 GGGATGGCAAGGCTGGGGTGTGG - Intergenic
937248029 2:120506105-120506127 GGATCAATAAAGCTGGGGTGGGG - Intergenic
937501659 2:122485787-122485809 GGGAAAAGAAGGCTGGGGGTGGG + Intergenic
938048843 2:128148744-128148766 GAAAAAAAAAGGCTGGGGAATGG - Intronic
939174141 2:138730181-138730203 AAAAAAAAAAGGGTGGGGTGGGG - Intronic
939580198 2:143937734-143937756 GGAAACAGAACGCTGGGGGGTGG + Intergenic
941892563 2:170596965-170596987 GGGAAAATATGGCTGGGGTGGGG + Intronic
942219592 2:173756238-173756260 GGAAAAGCAAGGCAGGGCAGGGG + Intergenic
943031845 2:182694812-182694834 GGAAAAAAAAAGGTGGGGGGGGG + Intergenic
943192476 2:184696378-184696400 GTAAAAAGAGGGATGGGGTGAGG + Intronic
944413523 2:199463289-199463311 GGGACAACAAGGCAAGGGTGGGG + Intronic
944853463 2:203743696-203743718 GGTATAACAAGACTGGAGTGAGG - Intergenic
945569500 2:211447907-211447929 AGAGAAACATGGCTGGGGTTTGG + Intronic
946602884 2:221371450-221371472 GGAAGGATGAGGCTGGGGTGTGG - Intergenic
946779563 2:223179015-223179037 GGTAAAAGAAGGCTGGGGAGTGG + Intronic
946958415 2:224957286-224957308 CGAAAAACAAAGCCGGGGGGGGG - Intronic
947518364 2:230826354-230826376 GGAAAAAAATGGCTGGGGTGGGG + Intergenic
947996757 2:234534492-234534514 GGAAGAGCAAGGCTGGTGTGGGG + Intergenic
948548283 2:238748438-238748460 TGTAAAACAATGGTGGGGTGGGG - Intergenic
948605358 2:239131489-239131511 GGAGCAACAAGGCAGGGCTGGGG + Intronic
949028170 2:241775897-241775919 GCAGAAACAAGGCTGGGCTGAGG - Intergenic
1168913731 20:1469583-1469605 GCCAAAGGAAGGCTGGGGTGGGG - Intronic
1170014928 20:11769711-11769733 GGAAATGCATGGCTGAGGTGGGG - Intergenic
1170722139 20:18891156-18891178 GGCTAAAGAAAGCTGGGGTGGGG - Intergenic
1171138461 20:22719556-22719578 GGGAAAAGCAGGGTGGGGTGGGG + Intergenic
1171142542 20:22755527-22755549 GGAAATACCAGGCTGGGCTGTGG - Intergenic
1171287265 20:23951528-23951550 GGAGAAGTCAGGCTGGGGTGCGG - Intergenic
1171966593 20:31535352-31535374 GATAAAACAAGGCTTGGGTGAGG + Intronic
1172018863 20:31898573-31898595 GGAGGGACAAGGCTGGGGGGAGG - Intronic
1172251063 20:33479558-33479580 GGAAAAACAAGGCAGGAGAAAGG - Intergenic
1172844614 20:37922526-37922548 GGAAAACCAAGGCAGAGCTGAGG - Intronic
1172852499 20:37976821-37976843 GGAAAAAGATGGGTGGGGGGAGG - Intergenic
1173101183 20:40090400-40090422 GGAAAAACAAAGATTTGGTGTGG + Intergenic
1173482998 20:43417642-43417664 AGAAAAAAATGACTGGGGTGGGG - Intergenic
1173733253 20:45342678-45342700 GCAAGAACAAGGCTGGGAAGTGG + Intronic
1174039107 20:47686600-47686622 GGAAAAACAAGCCTGGTCAGAGG + Intronic
1174379986 20:50150084-50150106 GGAAGAGCATGCCTGGGGTGGGG + Intronic
1174780871 20:53387536-53387558 GGTAAATCAAGACTGGGCTGGGG + Intronic
1175034044 20:55982938-55982960 GGAAAACCCAGGCTGGTGGGTGG - Intergenic
1175553377 20:59831296-59831318 GGAAGGACCAGGCTGGGCTGGGG - Intronic
1177421352 21:20861839-20861861 GGAAAATCCAAGCTGGGGTTAGG - Intergenic
1179016149 21:37595808-37595830 GCCAAGACAAGGCTGGGATGCGG + Intergenic
1179543795 21:42101049-42101071 AGAAAATCAAGGCTGGGAAGTGG - Intronic
1180655243 22:17414780-17414802 GGAGAAAAATGGTTGGGGTGAGG + Intronic
1181428031 22:22856520-22856542 GGTAAGACAAGGCTGGGGGCAGG + Intronic
1181556843 22:23676056-23676078 GGGAAAACAAGGCCCTGGTGGGG + Intergenic
1181697543 22:24601528-24601550 GGGAAAACAAGGCCCTGGTGGGG - Intronic
1181816322 22:25439685-25439707 AAAAAAAAAAGGCGGGGGTGGGG - Intergenic
1182281737 22:29221267-29221289 GGAACCACCAGGCTGAGGTGAGG + Intronic
1182394134 22:30023081-30023103 GGGAAAACAAGTGTGGGGTCAGG - Intronic
1182423010 22:30257627-30257649 GGAGAAGCAGGGCCGGGGTGTGG + Intergenic
1182583732 22:31330888-31330910 GGAAAAACAGGGCTGGCCTGTGG + Intronic
1182872901 22:33664246-33664268 GGAAATCCAAGGCTGTGGTTTGG - Intronic
1183184096 22:36282076-36282098 GGGCACAGAAGGCTGGGGTGGGG - Exonic
1184066711 22:42125606-42125628 GGAAACAGAAGCCCGGGGTGGGG + Intergenic
1184069179 22:42137758-42137780 GGAAACAGAAGCCCGGGGTGGGG + Intergenic
1184231920 22:43162949-43162971 GGACAACCATGGCTGGCGTGGGG + Exonic
1184293864 22:43511872-43511894 GGATATAAAAGGCTGGGGTGTGG - Intergenic
1184494368 22:44828980-44829002 CGAAAAACAAAGCCCGGGTGCGG + Intronic
1184659541 22:45959619-45959641 GGCAAAACAGAGCTGGGCTGTGG - Intronic
1184694056 22:46130101-46130123 GGGAAACCAAGGCTGGCGGGAGG + Intergenic
1185025729 22:48410732-48410754 GGCTGAACAGGGCTGGGGTGAGG + Intergenic
1185074592 22:48676428-48676450 GGAAAGACAAAGCAGGGATGAGG - Intronic
949433368 3:4002501-4002523 GAAAAAGCAAGGCTGGGGGAAGG + Intronic
949807666 3:7973647-7973669 GGAAAACCAAAGCAGGGGAGAGG + Intergenic
950722463 3:14893057-14893079 GTAAATACACGGCTTGGGTGGGG - Intronic
950817524 3:15722032-15722054 AGAAAAACAAGGCTGGGCACAGG - Intronic
951074749 3:18376261-18376283 GGAAAATGATGGCGGGGGTGGGG + Intronic
953664382 3:44915598-44915620 TGGAAAGGAAGGCTGGGGTGAGG - Intronic
954024278 3:47769928-47769950 GTAAAAATAAGGCTGGGGCCGGG + Intronic
954763343 3:52893500-52893522 ATAAAAACCAGGATGGGGTGGGG + Intronic
955025142 3:55160462-55160484 GCAAAAACAAAGCGGGGGGGGGG - Intergenic
955078960 3:55640145-55640167 AGAAAATCAAGGCAAGGGTGTGG - Intronic
955798788 3:62665175-62665197 GGAAAAAGGATTCTGGGGTGAGG + Intronic
956575863 3:70752292-70752314 GGAAATACAAGGCAGGGTAGCGG + Intergenic
957502746 3:81077988-81078010 AAAAAAAAAAGGCTGGGGTGGGG + Intergenic
958410639 3:93811102-93811124 TGAAAAATTAGGCTGGTGTGGGG + Intergenic
960367892 3:116795904-116795926 GGGAAAACAGGGTTGGGGTGGGG - Intronic
960921540 3:122751882-122751904 GGAAAAACTAGACTAGGGAGAGG + Intronic
960960751 3:123068428-123068450 GGGAGAACCAGGCTGGAGTGGGG + Intronic
961273285 3:125706276-125706298 GGAAGAAAAAGGGTGGGATGGGG + Intergenic
961425188 3:126839708-126839730 AGAAAAAAAAGCCTGAGGTGGGG - Intronic
961438454 3:126935894-126935916 GGAAGAACAATGCTGGGTTTAGG + Intronic
961641090 3:128365202-128365224 GGTGAAACAAGGCCTGGGTGGGG + Intronic
961650196 3:128413365-128413387 GGGAGCACAAGGCTGGGATGCGG - Intergenic
961986883 3:131144230-131144252 TGAAAAAGAAGGCTGGGATCAGG - Intronic
962654108 3:137525219-137525241 GGAAAACAAAGGCTGAGGTGAGG + Intergenic
962664682 3:137642145-137642167 GAAAAAAAAAATCTGGGGTGGGG - Intergenic
962835997 3:139189234-139189256 GGAAAAACAAAGCCTGGATGAGG - Intronic
963049328 3:141128041-141128063 AGAAAAAGAAGGCTGGTGGGTGG + Intronic
963221317 3:142816084-142816106 AGAAAGACAAGGATGGAGTGGGG + Intronic
963668580 3:148222463-148222485 GGAGGAACAGGGCTGGGGTTGGG + Intergenic
966189473 3:177259116-177259138 GGAAAAAAAATACTGGGGTGTGG - Intergenic
966274787 3:178152601-178152623 GGAAAAAAAAAGGTGGGGGGAGG - Intergenic
966505265 3:180693581-180693603 ACAAAAACAAGGCTGGTATGAGG + Intronic
966511342 3:180766619-180766641 GGAAACAAAAGGATGGGGTCTGG - Intronic
966525205 3:180912567-180912589 GGGAAAACAGGGCTGGGATTGGG - Exonic
967173990 3:186846181-186846203 GTAAAAGCAAGGCAGGGGTGAGG + Intronic
967526884 3:190505663-190505685 GGAAGAAAAGGGGTGGGGTGAGG - Intergenic
967936971 3:194736744-194736766 GGAAGAGCAAGACTGGGTTGGGG - Intergenic
968122944 3:196139053-196139075 GGAAAAACAAAGCAGGAGTGAGG - Intergenic
968280826 3:197475474-197475496 AAAAAAAAAAGGTTGGGGTGGGG + Intergenic
968556782 4:1249627-1249649 GGTAAATCAGGGCTCGGGTGGGG - Intronic
969883395 4:10194596-10194618 GGAAAAACATGGTTGGGCAGGGG + Intergenic
970092780 4:12428943-12428965 GGAAAAAAAAAGGGGGGGTGGGG - Intergenic
970922907 4:21415840-21415862 GGAAAAACCAGGCTGGAGAGAGG + Intronic
970992690 4:22231140-22231162 GGATATACAATGCTGTGGTGAGG - Intergenic
971328501 4:25663604-25663626 GGAAAAAGGAGATTGGGGTGTGG + Intronic
971363637 4:25958964-25958986 AGGAGACCAAGGCTGGGGTGAGG + Intergenic
971819755 4:31536578-31536600 GCAAAAACAATGCTGGGGGGAGG - Intergenic
972718802 4:41675451-41675473 GAAAAAGCAAGGCACGGGTGGGG - Intronic
974173947 4:58301536-58301558 GGAGAAACAAAGCAGGGCTGAGG + Intergenic
974860070 4:67509778-67509800 AGAAAAACAAGGCTAGGGAGGGG - Intronic
975545523 4:75556783-75556805 GGAAAGAAAAGGCTGGGGAAGGG + Intronic
975796433 4:78011378-78011400 GGACAAAGAAGTCTGGGTTGAGG + Intergenic
975980388 4:80151626-80151648 GGCAAAACTAGGCTGGAGTAAGG + Intergenic
976775251 4:88699266-88699288 GGAAGAAGAAGGCGGGGCTGGGG - Intronic
977424631 4:96851995-96852017 AAAAAAACAAGGGTGGGGAGGGG + Intergenic
977959136 4:103065059-103065081 GGAAAAAAAAGGTTGGGTGGGGG + Intronic
978587524 4:110289706-110289728 AGAAAAAAAAGGCTGGGGGGTGG + Intergenic
979438777 4:120726280-120726302 GGTAAAACAAGGCTGAATTGAGG + Intronic
980709066 4:136540679-136540701 TTAAAAAAAATGCTGGGGTGGGG + Intergenic
981538330 4:145823514-145823536 GAAAAGAAAGGGCTGGGGTGGGG + Exonic
982054219 4:151531374-151531396 GGAAAAACTGGGCAGGGGAGAGG - Intronic
982350643 4:154411301-154411323 GAATAAACAAGTCTGGGGCGGGG + Intronic
982450852 4:155550762-155550784 GGAAAAAGAAGGGTGGGGCCTGG + Intergenic
982632100 4:157843623-157843645 GGAAAAACATTGCTGGGTTGAGG + Intergenic
983631041 4:169849600-169849622 AGAAAACCAAGTCTAGGGTGGGG + Intergenic
983659407 4:170117582-170117604 AGAAATACAAGGTCGGGGTGTGG - Intergenic
985392525 4:189504981-189505003 AGGAAAACTAGGCTGGGGAGAGG + Intergenic
985555064 5:554554-554576 GGATAAACCAGGGTGGGGTCTGG + Intergenic
985555111 5:554682-554704 GGATAAACCAGGGTGGGGTCTGG + Intergenic
985888668 5:2699479-2699501 GGAAGACCAAGGCAGGGGTGGGG + Intergenic
986271687 5:6236619-6236641 GGAAAGACAAGACTGAGGTCAGG + Intergenic
986769362 5:10957766-10957788 GGAAAAAGGAGACAGGGGTGGGG + Intergenic
986969758 5:13318645-13318667 GGTAAAAGTAGGCTGGGATGAGG - Intergenic
987716344 5:21577275-21577297 AGAAAAAACAGGCCGGGGTGCGG - Intergenic
988302406 5:29448444-29448466 GAAAAAACAAGGATTAGGTGAGG + Intergenic
988632266 5:32943908-32943930 GAAAAAACAGGGTAGGGGTGAGG + Intergenic
989085670 5:37673585-37673607 GAAAAAAAAAGGGTGGGGGGGGG - Intronic
989108582 5:37886205-37886227 GGAAAACCAAGGTGGGGGTGGGG + Intergenic
990211195 5:53482678-53482700 GGAAAAAGAAGGCAGTGGAGGGG - Intronic
990398359 5:55408172-55408194 GGAAAAGCATGTGTGGGGTGTGG - Intronic
990827191 5:59914267-59914289 AGAAAAACAAAGATGGGGGGTGG + Intronic
990967745 5:61467983-61468005 GGAGAAACAGGGGAGGGGTGTGG - Intronic
991746405 5:69746906-69746928 GGAAAAAGAAGGATGGGAGGAGG + Intergenic
991751300 5:69808335-69808357 GGAAAAAGAAGGATGGGAGGAGG - Intergenic
991762360 5:69931490-69931512 GAAAAAACAAGGATTAGGTGAGG - Intergenic
991784965 5:70186616-70186638 GAAAAAACAAGGATTAGGTGAGG + Intergenic
991825783 5:70622220-70622242 GGAAAAAGAAGGATGGGAGGAGG + Intergenic
991830588 5:70683229-70683251 GGAAAAAGAAGGATGGGAGGAGG - Intergenic
991841588 5:70806540-70806562 GAAAAAACAAGGATTAGGTGAGG - Intergenic
991877412 5:71187011-71187033 GAAAAAACAAGGATTAGGTGAGG + Intergenic
992074003 5:73174346-73174368 GTAAAAATTAGGCTGGGCTGGGG + Exonic
992375077 5:76181053-76181075 GTAACACCAAGGCTGGGGTAAGG - Intronic
992688362 5:79219492-79219514 AAAAAAACAAGGCGCGGGTGTGG - Intronic
993487361 5:88503216-88503238 AAAAAAAAAAGGCTGGGGGGAGG + Intergenic
995060506 5:107807697-107807719 GGATATACAAGTCTGGAGTGTGG + Intergenic
995078412 5:108015826-108015848 AGGTCAACAAGGCTGGGGTGAGG + Intronic
995198153 5:109396767-109396789 AAAAAAAAAAGGCAGGGGTGGGG + Intronic
995260163 5:110094558-110094580 AGGAAAACAAGGCTGGAGTGTGG - Intergenic
995974529 5:118016786-118016808 GGAAACAAAAGGTGGGGGTGGGG + Intergenic
997354781 5:133255235-133255257 GGAAAGAGAGGGCTGGGTTGGGG + Intronic
997898432 5:137740982-137741004 TGTAGAAGAAGGCTGGGGTGTGG - Intergenic
998216104 5:140239692-140239714 GCAAACACAAGTGTGGGGTGGGG - Intronic
998922182 5:147081718-147081740 AAAAAAACAAGGCTGGGGATGGG + Intronic
999038143 5:148376427-148376449 GAAAAAAAAAGGCGGGGGTGGGG + Intergenic
999662322 5:153878363-153878385 AGAAAGCCAAGGGTGGGGTGGGG + Intergenic
1000164536 5:158635121-158635143 GGAGAAACTGGGGTGGGGTGGGG - Intergenic
1000260213 5:159580926-159580948 TGAAAAATAAAGCTGGGGAGTGG + Intergenic
1000316462 5:160097181-160097203 GGAAAAATTAGCCTGGTGTGGGG + Intronic
1000968761 5:167691223-167691245 GGTAAATGAAGGTTGGGGTGGGG - Intronic
1001200031 5:169707649-169707671 TAAAGAACAAGTCTGGGGTGAGG - Intronic
1001236959 5:170038257-170038279 GGAGAAACAAGGTTGGAGGGAGG - Intronic
1001604714 5:172951438-172951460 GGAAGAACAAGAAAGGGGTGGGG - Exonic
1001717239 5:173826267-173826289 GGAAAAACAAGGTCTGGGTTAGG + Intergenic
1002063108 5:176638083-176638105 GGAAGAACAAGTCTGGAGCGGGG + Intronic
1003243507 6:4365102-4365124 TGGAAGACAAGACTGGGGTGAGG - Intergenic
1005014863 6:21366180-21366202 AGAGATACAAGGTTGGGGTGTGG + Intergenic
1005560783 6:27038853-27038875 GGAAAAAAAAAGCTGGCATGGGG - Intergenic
1006071097 6:31498412-31498434 GGGAAAGCAGGGCTGAGGTGTGG - Intronic
1006505194 6:34484848-34484870 GGAAAAATAAAGCAGGGGTGAGG + Intronic
1006641270 6:35490990-35491012 GGGAGACCAAGGCCGGGGTGGGG + Intronic
1006780905 6:36631669-36631691 GCAGAAATACGGCTGGGGTGGGG + Intergenic
1007032549 6:38641009-38641031 GGAAAAGCAAGGCTTGGGGCAGG + Intergenic
1007073071 6:39050201-39050223 GGAAAACCAAGGCCTGGCTGGGG - Intronic
1007704892 6:43784507-43784529 GGAAAACAAAGGCTGGGGTTAGG - Intronic
1007834726 6:44665660-44665682 GGAAGAACATGGCTGGGGAGTGG + Intergenic
1010283947 6:74053226-74053248 GAAAAAAGATGGCTGGTGTGAGG + Intergenic
1010539217 6:77070276-77070298 GGACAATGAAGTCTGGGGTGAGG - Intergenic
1011111700 6:83844393-83844415 GTAAGAATAAGGGTGGGGTGGGG + Intergenic
1011420463 6:87166411-87166433 GAAAAAATAAGGCTGAGGTAAGG + Intronic
1011502302 6:88004618-88004640 GGAAAAATAATGCTGGGGTAGGG + Intergenic
1011598904 6:89041874-89041896 GGAAAAGCAAGGCTAGTGCGTGG + Intergenic
1012039810 6:94189636-94189658 GAAAAGACAAGGCAGGGGAGGGG + Intergenic
1012431538 6:99168960-99168982 GGAAGAACAAGGGTGGGAGGAGG + Intergenic
1013290580 6:108715808-108715830 GAAAAAAGAAGGCTTAGGTGGGG + Intergenic
1013770489 6:113622776-113622798 GTTAAGACAAAGCTGGGGTGGGG - Intergenic
1014795690 6:125721638-125721660 GGAAACAGCAGGCTGGGATGGGG + Intergenic
1015474471 6:133644742-133644764 GGAAGAACATGGCTGAGTTGGGG - Intergenic
1016903088 6:149121147-149121169 GGAAAAAGAAGGGTAGGGGGTGG + Intergenic
1018410028 6:163535638-163535660 GGAAAAACTAGGGCTGGGTGCGG + Intronic
1018414026 6:163585780-163585802 GAAAAAACATTGCCGGGGTGTGG - Intergenic
1018445809 6:163857236-163857258 AGAAAAACAGGGATTGGGTGTGG - Intergenic
1018509118 6:164506181-164506203 GGAAGCACAAGTCTGGGGAGGGG - Intergenic
1018970641 6:168526317-168526339 GGAAGAACAGGGCAGAGGTGTGG - Intronic
1019165593 6:170095722-170095744 GGAGAAAGAAGGCTGGGCTGAGG - Intergenic
1019324598 7:432004-432026 GGAAAGACAAGCCTGGGCCGGGG + Intergenic
1019413945 7:918991-919013 GGGAGACCGAGGCTGGGGTGGGG + Intronic
1019479725 7:1261056-1261078 GGTTCAGCAAGGCTGGGGTGAGG - Intergenic
1019688963 7:2399066-2399088 AGAAAGACAGGGATGGGGTGGGG + Intergenic
1019700364 7:2471825-2471847 GGGAAACTGAGGCTGGGGTGGGG - Intergenic
1019769187 7:2872733-2872755 AAAAAAAAAAGGATGGGGTGAGG - Intergenic
1019838443 7:3414216-3414238 GAAGAGACAAGGTTGGGGTGCGG + Intronic
1020092750 7:5350421-5350443 GGAAAAACAGGGCGGGCGGGGGG + Intronic
1021039570 7:15845213-15845235 GGGGAAATAAGGCTGGGATGGGG + Intergenic
1021151290 7:17153637-17153659 GGCAAAAAATGGCGGGGGTGGGG - Intergenic
1021266807 7:18534781-18534803 GGACAAACAAAACTGAGGTGAGG - Intronic
1021594726 7:22302770-22302792 AAAAAAAAAAGGCGGGGGTGGGG - Intronic
1022010235 7:26302438-26302460 GGAAACACAGTGCTGAGGTGGGG - Intronic
1022381831 7:29867556-29867578 AAAAAAAAAAAGCTGGGGTGTGG - Intronic
1022626824 7:32045203-32045225 GGTAAAACATGGCTGGGGGTGGG - Intronic
1022640574 7:32178662-32178684 GGAAAGAGAAGGTTGGGGAGGGG - Intronic
1023764428 7:43497569-43497591 GGAAAAGATAGGCTGGGGAGGGG + Intronic
1024251173 7:47506772-47506794 GGAAAGCCAGGGCTGGGGTACGG - Intronic
1024343829 7:48292740-48292762 AGGAAAATAAGGCAGGGGTGGGG - Intronic
1025008412 7:55374544-55374566 GGGAAAAGCAGGCAGGGGTGGGG - Intronic
1025605837 7:63039305-63039327 GGACAAAGAAGGCTGGGAAGGGG - Intergenic
1025951567 7:66149797-66149819 GGAAAAAAAAGGTGGGGGTGAGG - Intronic
1026057146 7:66994826-66994848 AGAAACACAAGGGTGGGGTGGGG + Intronic
1027251934 7:76404325-76404347 GGAAAGACAGGGCTTGGGGGAGG + Exonic
1028751851 7:94391818-94391840 GGAAAAACAAGTAAGGGGTGGGG - Intergenic
1029253351 7:99252345-99252367 GGGAAAACAGGGCTGGCGGGGGG + Intergenic
1029822338 7:103158231-103158253 GGAAAAAGAAGGCTTGGGGAGGG - Intergenic
1030026064 7:105325946-105325968 GGAAAAACAAGGCAATGCTGAGG + Intronic
1030070525 7:105693964-105693986 GGAGCAAGAAGTCTGGGGTGGGG + Intronic
1030227657 7:107169771-107169793 GGAAAAACAAGCCCGGAGTCCGG + Intronic
1030663858 7:112252284-112252306 AGAAAAACAAGGCTGCTGAGTGG + Intronic
1031484197 7:122308863-122308885 TGAATGTCAAGGCTGGGGTGGGG - Intronic
1031693224 7:124816820-124816842 AGAAAAATAAGGCAGGGGTGGGG + Intergenic
1033417153 7:141172465-141172487 GACAAAACAAGGCTGAGGAGGGG + Intronic
1033706784 7:143895926-143895948 GGAAAAAAATGGGTGGGGGGAGG + Intronic
1034560753 7:151877812-151877834 GAAAAAAGCAGGGTGGGGTGGGG - Intergenic
1034590167 7:152131842-152131864 GGAATAGCAGGGCTGGAGTGAGG + Intergenic
1034748062 7:153541612-153541634 GGGAAAACAGGGCTGGTTTGGGG + Intergenic
1036233850 8:7021505-7021527 GAAAAAATCAGGCTGGGGTTGGG - Intergenic
1037745058 8:21636736-21636758 GGAAAATCACAGGTGGGGTGTGG - Intergenic
1037980526 8:23250122-23250144 AGAAAAATAAGGCTGTGGTGTGG - Intronic
1038454962 8:27667102-27667124 CCAATAACAAGGCAGGGGTGAGG - Intronic
1038522180 8:28243178-28243200 GAAAAAAAAAGGTTGGGGGGTGG - Intergenic
1040302483 8:46195205-46195227 GGGAAAACAGGGCTGCAGTGTGG + Intergenic
1040333619 8:46404949-46404971 GCAAAAACAAGGCAGCAGTGTGG + Intergenic
1040336848 8:46420434-46420456 GCAAAAACAAGGCTGCAGTGTGG + Intergenic
1040466220 8:47697729-47697751 GCAAGAAGAAGGCTGGGGGGTGG - Intronic
1041296056 8:56358673-56358695 GGAAAGACAAGCCTGGGATGGGG + Intergenic
1042117181 8:65444972-65444994 GGAAAGATCAGGATGGGGTGAGG - Intergenic
1045976429 8:108134662-108134684 GGCAAAAGAAGGATGGGATGTGG - Intergenic
1046002754 8:108441631-108441653 GGAAAAACAAGGTGGGAATGCGG + Intergenic
1046386543 8:113514207-113514229 AGAGATACAAGGTTGGGGTGCGG + Intergenic
1046652986 8:116859656-116859678 GGAGAAACATTGCGGGGGTGGGG - Intronic
1046810244 8:118525320-118525342 GGAAAAACGTGTATGGGGTGGGG - Intronic
1046943178 8:119950998-119951020 GGAAAGTCAAGGCTGCAGTGAGG + Intronic
1047176162 8:122542498-122542520 AGAAGAACAAGGCTGGGGTATGG - Intergenic
1048011440 8:130459641-130459663 AGAGAAACTAGGGTGGGGTGGGG + Intergenic
1048580322 8:135725160-135725182 GAAAAAACAAGGCTGGGATGAGG + Intergenic
1048608440 8:135995088-135995110 AAAAAAACAAGGAGGGGGTGGGG + Intergenic
1050196251 9:3087249-3087271 TGAAAGAGAAGACTGGGGTGGGG + Intergenic
1050622828 9:7472832-7472854 AGAAAAAAAAAGGTGGGGTGGGG + Intergenic
1050738027 9:8786747-8786769 GGAAAAAAAAGGTGGGGGGGCGG + Intronic
1051130812 9:13858251-13858273 GGAAATACAGGCCTGGGGTAAGG + Intergenic
1051807694 9:21014121-21014143 GGAAAAATAATGCTAGGGTAGGG + Intronic
1052111903 9:24596160-24596182 GGAAAAACAAAGAGGGGGAGGGG - Intergenic
1052836526 9:33254294-33254316 TTAAAAACAATGATGGGGTGGGG + Exonic
1052840063 9:33285497-33285519 AGAATAACAGGGCTGGGGTGGGG - Intergenic
1052843402 9:33313137-33313159 GGAGAAAGAATGCTGGGGTGAGG - Intronic
1055716582 9:79124816-79124838 GACAAAAAAAGGCAGGGGTGGGG - Intergenic
1056250843 9:84746448-84746470 GGAAACACAAGGCTGGGAGAGGG - Intronic
1056756541 9:89385410-89385432 TCAACAACGAGGCTGGGGTGAGG + Intronic
1056863623 9:90210163-90210185 GGAAGAAAAAGGGTGGGATGGGG + Intergenic
1057464481 9:95300180-95300202 GGAGATAGAAGGCTGAGGTGAGG - Intronic
1057507050 9:95643244-95643266 GTAACAAAAAGGCAGGGGTGGGG + Intergenic
1057842530 9:98497545-98497567 GCAAGAACTAGGCTGGGGTTAGG + Intronic
1057849911 9:98557202-98557224 GGAAAGAGAAGGCTGGAGTGAGG - Intronic
1057866640 9:98686898-98686920 GGAAGTACAGGGCTGGGGAGAGG - Intronic
1058046200 9:100359794-100359816 GGAAAAGCAAGGGCTGGGTGTGG + Intergenic
1058424696 9:104866238-104866260 GGAGAAAAAAGGAGGGGGTGAGG + Intronic
1058486473 9:105447657-105447679 GGAGGAAAAGGGCTGGGGTGGGG - Intergenic
1058890563 9:109357238-109357260 GGCTAAACAAGGCCTGGGTGTGG - Intergenic
1059148665 9:111926849-111926871 AAAAAAAAAAGGCTGGGGGGAGG - Intronic
1059288953 9:113204305-113204327 GGAAAGCCAAGGCTGAGGTCGGG - Intronic
1059612586 9:115915263-115915285 GGAAAAACAAGGCTTTAGGGAGG - Intergenic
1061010909 9:127954135-127954157 ACAAACACAAGGCAGGGGTGAGG + Intronic
1061241884 9:129379180-129379202 GGAAAGAAGAGGCTGGGGTGAGG - Intergenic
1061516726 9:131094420-131094442 GTAAAATCAAGGCTACGGTGGGG + Intronic
1061608361 9:131729086-131729108 GGAAAGACAGGGTTGGGGAGGGG + Intronic
1061645623 9:131998701-131998723 GGAAAAAGAATGGTGGGGTGAGG + Intronic
1061765427 9:132878449-132878471 GGAAAAGCGAGGCCGGGGTTGGG - Exonic
1061837963 9:133341794-133341816 GGAAAGGCAGGTCTGGGGTGTGG - Intronic
1062070772 9:134553967-134553989 GGAAGAGGAAGGCTGGGGAGGGG + Intergenic
1185893007 X:3836599-3836621 GGAAAGGTAAGGCTGGGGGGGGG + Intronic
1185898116 X:3875019-3875041 GGAAAGGTAAGGCTGGGGGGGGG + Intergenic
1185903234 X:3913450-3913472 GGAAAGGTAAGGCTGGGGGGGGG + Intergenic
1186260770 X:7776795-7776817 GGAGAAACAAGCTTGGAGTGTGG + Intergenic
1186853300 X:13601554-13601576 GGAAAACCCAGGATGGGCTGGGG - Intronic
1186875825 X:13816938-13816960 GGAAAAACAAGTGTGTGTTGGGG - Exonic
1187055564 X:15738550-15738572 GGAGGAAGAGGGCTGGGGTGGGG - Intronic
1187470812 X:19568101-19568123 GGTAGTACAGGGCTGGGGTGGGG + Intronic
1187569528 X:20486900-20486922 AGAAAACCAAGGTGGGGGTGAGG + Intergenic
1189473217 X:41330440-41330462 TCAAAAAGAAGGCGGGGGTGGGG - Intergenic
1190053821 X:47170682-47170704 GGAAAATCAAGGGTGGGGTCTGG + Intronic
1190088559 X:47417755-47417777 AGAAAAAAAAGGCGGGGGGGTGG - Intergenic
1190275928 X:48899218-48899240 GGAAAGCCAAGGGTGGGGGGTGG - Intronic
1190745505 X:53319997-53320019 AAAAAAAAAAGGCGGGGGTGGGG + Intronic
1191713761 X:64179671-64179693 GGAGCAAGAAGGCTGGGGAGGGG + Intergenic
1192541287 X:71975419-71975441 GGAGAGACAAGTGTGGGGTGTGG - Intergenic
1192735078 X:73843072-73843094 GGGAAACTAAGGGTGGGGTGGGG + Intergenic
1193732555 X:85118337-85118359 GCAAATACAAGACTGGTGTGTGG - Intergenic
1193732623 X:85119285-85119307 GCAAATACAAGACTGGTGTGTGG + Intergenic
1194467837 X:94255397-94255419 TGAAAACCCAGGCTGGGGAGTGG - Intergenic
1195659334 X:107362657-107362679 TGAAGAAAAAGGTTGGGGTGGGG + Intergenic
1196370636 X:114975882-114975904 TGAAAAACATGGCTTGGATGAGG - Intergenic
1197376359 X:125686406-125686428 GGAAAAACCAAGCTGGGAAGTGG - Intergenic
1197675351 X:129324138-129324160 GCAAAAACAAAAGTGGGGTGGGG + Intergenic
1198242000 X:134796502-134796524 GGGAAAACAAGGATGGAGGGAGG + Intronic
1198342909 X:135732429-135732451 GAACAAAGAGGGCTGGGGTGGGG - Intergenic
1198345080 X:135750866-135750888 GAACAAAGAGGGCTGGGGTGGGG + Intergenic
1198827287 X:140712856-140712878 GGAAAAAAAAGGGCGGGGGGAGG + Intergenic
1199635798 X:149810413-149810435 GGAAAAATAAGAGAGGGGTGAGG + Intergenic
1200159703 X:153999972-153999994 GGGAAAACGGGGCGGGGGTGGGG + Intergenic
1200749847 Y:6934841-6934863 GAAAAAAAAAGGATTGGGTGTGG - Intronic
1202150579 Y:21840324-21840346 GAAAAAACAAGGCTTGCCTGAGG + Intergenic