ID: 1144977071

View in Genome Browser
Species Human (GRCh38)
Location 17:19144832-19144854
Sequence CCCAGAGGGTAGCCCCAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 2, 1: 0, 2: 1, 3: 22, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144977060_1144977071 22 Left 1144977060 17:19144787-19144809 CCCACAGGCCTTGGGAAGGGGAG 0: 2
1: 0
2: 4
3: 43
4: 293
Right 1144977071 17:19144832-19144854 CCCAGAGGGTAGCCCCAGTCTGG 0: 2
1: 0
2: 1
3: 22
4: 178
1144977063_1144977071 14 Left 1144977063 17:19144795-19144817 CCTTGGGAAGGGGAGTGGAGATG 0: 2
1: 0
2: 4
3: 59
4: 448
Right 1144977071 17:19144832-19144854 CCCAGAGGGTAGCCCCAGTCTGG 0: 2
1: 0
2: 1
3: 22
4: 178
1144977061_1144977071 21 Left 1144977061 17:19144788-19144810 CCACAGGCCTTGGGAAGGGGAGT 0: 2
1: 0
2: 6
3: 51
4: 275
Right 1144977071 17:19144832-19144854 CCCAGAGGGTAGCCCCAGTCTGG 0: 2
1: 0
2: 1
3: 22
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144977071 Original CRISPR CCCAGAGGGTAGCCCCAGTC TGG Intronic
900488130 1:2933175-2933197 CCCAGAGGGCAGGGGCAGTCTGG - Intergenic
900612886 1:3551821-3551843 CCCAGAGGGTGGCCTCGGGCAGG - Intronic
902622865 1:17660542-17660564 CCCAAAGGGCAGCCCCTGCCTGG - Intronic
904402348 1:30265222-30265244 CCTGGAGGGCAGCCCCAGGCTGG - Intergenic
905789380 1:40782401-40782423 CCCAGAGGGCACCCCCAGCTAGG + Intergenic
906491353 1:46271233-46271255 CCCAGAGGGTAGGCACATTCTGG + Intronic
906616391 1:47235572-47235594 CCCAAACGGAGGCCCCAGTCGGG + Intergenic
906963393 1:50433122-50433144 CCCAGAGGAGGTCCCCAGTCCGG - Intergenic
910194046 1:84622199-84622221 CCCAGACTGTTCCCCCAGTCGGG - Intergenic
915396786 1:155590898-155590920 CCCAGAGGTGAGCACCAGGCGGG + Intergenic
916218507 1:162419894-162419916 CCCAGAGGGTACCCGGAGTCCGG - Intergenic
921353660 1:214263941-214263963 CTCAGAGGGTAGCTTCAGCCTGG - Intergenic
922454263 1:225762210-225762232 CTCAGAGGGAAGCACCAGTGTGG - Intergenic
923564657 1:235067869-235067891 CCCAGAGTGAAGCCCCACCCAGG - Intergenic
924775104 1:247111133-247111155 CCCGGCGGGTACCCCGAGTCCGG - Exonic
1063341692 10:5271352-5271374 CCCAGAGCTTAGCCCCATTCAGG + Intergenic
1064782368 10:18856671-18856693 CCCAGCAGGTACCCCGAGTCCGG + Intergenic
1067183884 10:44011003-44011025 CACAGAGGGCAGCCCCTGACTGG - Intergenic
1069712300 10:70497449-70497471 CCCAGAGAGTTGGCACAGTCAGG - Intronic
1069756225 10:70775797-70775819 CCCAGAGGGCAGCCTGAGGCGGG + Intronic
1074794539 10:116928660-116928682 CCCTGAGGGTACACTCAGTCGGG - Intronic
1076555823 10:131320893-131320915 CCCAGAGCCGAGCCCCAGGCTGG + Intergenic
1077101977 11:826387-826409 CCCCAAGGGGAGCCCCAGTCAGG + Intronic
1077109246 11:854810-854832 CCCAGAGGCCAGCGCCAGGCAGG - Intronic
1077654835 11:4008824-4008846 CACAGACAGTAGCCCCAGCCAGG + Intronic
1079400969 11:20105983-20106005 CCCAGAGGGTAGCTTCAGCTTGG - Intronic
1081741647 11:45445109-45445131 CTCAGAGGGTAGCTTCAGCCAGG - Intergenic
1083764761 11:64836465-64836487 CCCAGCTGGTAGCCCAGGTCAGG - Exonic
1084014874 11:66372165-66372187 CCCAGAGCGTAACCCGAGCCGGG + Intronic
1084679967 11:70661225-70661247 CTCTGAGGGTAGCCACAGTCTGG + Intronic
1084690076 11:70719988-70720010 CCCAGTGGGTGACCCCAGGCAGG + Intronic
1089647142 11:119887800-119887822 CCCTGACAGTTGCCCCAGTCAGG - Intergenic
1091963613 12:4720033-4720055 CCCAGCGGATACCCCGAGTCCGG + Intronic
1092185825 12:6477797-6477819 CTCAGAGGGCAGCGCCAGGCTGG - Intergenic
1095095366 12:38145008-38145030 GCCAGTGGGTACCCCGAGTCCGG - Intergenic
1095658321 12:44697484-44697506 CACAGACTGTGGCCCCAGTCAGG + Intronic
1096725956 12:53562748-53562770 ACCAGAGGCTGGGCCCAGTCAGG + Intronic
1096839846 12:54373580-54373602 CCCCGAGGGGAGCCCCAGTAGGG + Intronic
1101333064 12:103772715-103772737 CCCAGAGGGTTTCCCAAGTTGGG + Exonic
1103110554 12:118273948-118273970 CCCAGAGGGTAGACTGAGGCAGG + Intronic
1104662989 12:130625455-130625477 CTCTGAGAGTAGCTCCAGTCTGG - Intronic
1106227298 13:27794880-27794902 CCCAGAAGGGAGGCCCAATCCGG - Intergenic
1107009854 13:35658851-35658873 CACAGATGGTTGCCCTAGTCAGG - Intronic
1107149003 13:37090732-37090754 CCCATAGGGTATCCAAAGTCTGG - Intergenic
1107247918 13:38319747-38319769 CCCAGCGGGTACCCCGAGTCCGG + Intergenic
1111195373 13:84869689-84869711 CCCAGCAGGTATCCCAAGTCTGG - Intergenic
1111411825 13:87887179-87887201 CCCAGAGGGCAGTTCCAGGCTGG + Intergenic
1113776336 13:112947743-112947765 ACCAGTGTGTAGCCCCAGCCTGG - Intronic
1116369371 14:44110008-44110030 CCCAGATAGTATCCCCAGTGGGG + Intergenic
1116683794 14:48011733-48011755 CCCGGCGGGTACCCCGAGTCCGG - Intergenic
1118743629 14:68758744-68758766 CTCAGAGGGTCTCCCCAGGCAGG + Intergenic
1122569848 14:102689160-102689182 GCCAGATTGTAGGCCCAGTCTGG + Intronic
1122819731 14:104335388-104335410 CCCAGTGGGGAGGCCCAGTGGGG + Intergenic
1122820958 14:104344601-104344623 CCCAGACAGAAGCCTCAGTCTGG + Intergenic
1123039725 14:105485583-105485605 CCCAGGACTTAGCCCCAGTCGGG + Intergenic
1125038182 15:35151497-35151519 CACAGATGGTGGCCCCAGCCTGG - Intergenic
1129656264 15:77527413-77527435 CCCTGAGGGCTGCCCCAGGCGGG + Intergenic
1129681752 15:77662187-77662209 CCCAGTGCACAGCCCCAGTCAGG + Intronic
1131261267 15:90889277-90889299 CCGAGACGGGATCCCCAGTCAGG - Intronic
1131561110 15:93440861-93440883 CACAGACGGTGGCCCCAGTGAGG - Intergenic
1132258494 15:100400147-100400169 CCCAGAGGCTCACCCCAATCAGG + Intergenic
1132629263 16:908943-908965 TCCAGAGGGTTGTCCCAGGCAGG - Intronic
1132764812 16:1528982-1529004 CCGAGATGGTAGCCCCGGGCAGG + Intronic
1133032028 16:3015656-3015678 CCCAGAGGTGAGCACCAGGCGGG + Exonic
1133125173 16:3641766-3641788 CCCAGTGGGCAGCCCCACCCAGG - Intronic
1133296070 16:4752922-4752944 GTCAGAGGCCAGCCCCAGTCAGG - Exonic
1135075937 16:19393607-19393629 CCCAGTGGGTACCCTGAGTCTGG + Intergenic
1138584695 16:57962316-57962338 CTCAGAGGGTGGCCCCACCCAGG + Intronic
1138594461 16:58022459-58022481 CCCAGAGGGTAGACCTAGTCTGG - Intergenic
1139215259 16:65121129-65121151 GCCAGAGGCGAGCCCGAGTCTGG + Intronic
1139546980 16:67654025-67654047 CCCCTAGGGTCACCCCAGTCTGG + Intronic
1142190241 16:88714080-88714102 CCCAGAGGCCAGCCCCAGGCTGG - Intronic
1143249062 17:5509236-5509258 CTCACAGGTTAGCCCCAGGCAGG - Intronic
1144141029 17:12348212-12348234 CCCACAGGGTGGCCTCAGTGAGG - Intergenic
1144958087 17:19029688-19029710 CCCAGAGGGTAGCCCCAGTCTGG - Intronic
1144977071 17:19144832-19144854 CCCAGAGGGTAGCCCCAGTCTGG + Intronic
1145259509 17:21346510-21346532 CCCAGAGGGAAGACACAGACAGG - Intergenic
1145317108 17:21741438-21741460 CCCAGAGGGAAGACACAGACAGG + Intergenic
1145916323 17:28576151-28576173 ACCAGAGGTTGGCCCCAGTGGGG + Intronic
1146156596 17:30529704-30529726 CCCAGAGGCCAGCACCAGCCTGG - Intergenic
1146679437 17:34796425-34796447 CTCAGAGGGTAGTCCCTGTGCGG - Intergenic
1146951913 17:36912783-36912805 CCCAGATGGCAGACCCAGCCAGG - Intergenic
1147986242 17:44309089-44309111 CCCAGAGGGAGGCTGCAGTCTGG + Intronic
1151539955 17:74759747-74759769 CCCAATGGGTTGCCCCATTCTGG + Intronic
1151555983 17:74846992-74847014 CCCAGAGCCCAGCCCCAGTGTGG + Intronic
1151971437 17:77459462-77459484 CCCAGAGCACAGCCCCAGCCAGG + Intronic
1152889805 17:82874010-82874032 CCAAAAGAGGAGCCCCAGTCAGG - Intronic
1152898154 17:82925447-82925469 CCCAGAGGTCAGCCCCACGCTGG + Intronic
1153388469 18:4527644-4527666 CCCAGCGGGTACCCCGAGTCCGG + Intergenic
1153389883 18:4544558-4544580 CACAGATGGTGGCCCCAGCCAGG - Intergenic
1154270347 18:12912644-12912666 CCCAGAGGAGCGCCCCAGCCGGG + Intronic
1155164375 18:23220693-23220715 CCCAGAGGGCAGCCCGTGTGTGG - Intronic
1155536645 18:26825505-26825527 CCCAGAGGGTCACCCCAGTGTGG - Intergenic
1155536658 18:26825549-26825571 CCCAGAGGGTCATCCCAGTGCGG - Intergenic
1157325905 18:46668812-46668834 CCCAGAAGCTAGCCACAGTGAGG + Intronic
1157580566 18:48771694-48771716 CCCAGAGGGTCACCCCTGGCTGG + Intronic
1160404780 18:78638004-78638026 CCGAGAGGGTGGCCACGGTCAGG - Intergenic
1160716644 19:579797-579819 CCCAGAGGGAAACCCCAGGGAGG + Intronic
1161380841 19:3964210-3964232 CCCAGTGGGCAGCCCCGGCCTGG - Intronic
1162475586 19:10897558-10897580 GCCAGCGAGTAGCCCCAGGCTGG + Intronic
1162656874 19:12137989-12138011 CCCAGAGGATAGCCTGAGGCAGG - Intronic
1163187477 19:15649180-15649202 CTCAGAGGGTAGTGCCCGTCTGG + Exonic
1163221506 19:15924840-15924862 CTCAGAGGGCAGCGCCAGACTGG - Exonic
1165831072 19:38730729-38730751 GCCAGAGACTAGCCCCAGACAGG + Exonic
925188242 2:1864115-1864137 CCCAGAGGGAAGGCACAGCCCGG - Intronic
925196094 2:1927097-1927119 CCCAGCGGTCAGCCCCAGGCTGG - Intronic
926045727 2:9708288-9708310 CCCACAGGGGAGCCTCAGCCTGG - Intergenic
927146198 2:20168170-20168192 CCCAGAGAGAAGCCCCATTCAGG + Intergenic
927708646 2:25312115-25312137 CCCCGAGTGTCGCCCCACTCTGG - Intronic
933066809 2:77808138-77808160 CCCAGTGGGTACCCCAAGTCCGG - Intergenic
933362355 2:81304456-81304478 CCCAGCTGGTACCCCAAGTCCGG + Intergenic
933418910 2:82023196-82023218 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
933419855 2:82031232-82031254 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
933835959 2:86245709-86245731 CCCATAGGGTAGCTGAAGTCCGG - Intronic
934515062 2:94981236-94981258 CCCAGAGTGCAGCCTCAGTGGGG + Intergenic
936817974 2:116484080-116484102 CCCAGAGAGTCTCCCCAGTGTGG + Intergenic
937715155 2:125024234-125024256 CCCAGTGGGTACCCTGAGTCCGG + Intergenic
942830989 2:180237390-180237412 CCCAGCGGGTACCCGGAGTCTGG - Intergenic
943833208 2:192487900-192487922 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
947767785 2:232648585-232648607 CCCATAGGGTAACCCCAGGAGGG + Intronic
948506054 2:238427479-238427501 GCCAGAGGGTAGCCCTAGGGAGG + Intronic
1169206395 20:3742522-3742544 CCCAGTGGGGAGCCCCAGACTGG - Intronic
1169331218 20:4717785-4717807 CCCAGAGGGTGGCCACAGCTTGG - Intergenic
1171175560 20:23049105-23049127 CGCAGAGGGGAGCCCCATTGAGG + Exonic
1172064670 20:32210555-32210577 CACAGAGGGTAGGACCAATCAGG - Intronic
1174277394 20:49413857-49413879 CCCTGAGGCTGGACCCAGTCTGG - Intronic
1175223167 20:57429105-57429127 CACCGAGGGTAGCACCAGGCTGG - Intergenic
1175539129 20:59737190-59737212 TCCAGAGGGCCGCCCCAGTGGGG - Intronic
1176103107 20:63373403-63373425 CCCAGAGGGAAGCCCCGTGCCGG + Intronic
1176973520 21:15291731-15291753 CCCAGAGGGTAGAGCCAGGCTGG - Intergenic
1178568544 21:33712669-33712691 CCCACAGGTGGGCCCCAGTCAGG - Intronic
1183368939 22:37421592-37421614 CCCAGAGAGGAGCCCCTGCCTGG - Intronic
1184439683 22:44501523-44501545 CCAACAGGGTAGGCCCAGTTTGG + Intergenic
950303528 3:11901358-11901380 CCTAGAGGGCAGCTTCAGTCAGG + Intergenic
952149883 3:30577951-30577973 CCCAGAGGTTGGCCCCACTGTGG + Intergenic
953718648 3:45336587-45336609 TCCAGAGGCTAGCCACAGTGCGG + Intergenic
957694551 3:83618435-83618457 CCCAGCGGGTACTCCGAGTCCGG + Intergenic
958949384 3:100400673-100400695 CCCGGAGGGCAGGGCCAGTCCGG - Exonic
959963040 3:112322287-112322309 CAGAGAGGGGAGCCCCAGTGGGG - Intergenic
962703334 3:138020106-138020128 CCCAGAGGGTAGGACCATGCAGG + Intronic
966971506 3:185049433-185049455 CCCACAGGATGTCCCCAGTCAGG - Intronic
967872816 3:194246262-194246284 CCTAGAGTTTGGCCCCAGTCAGG + Intergenic
969106305 4:4809452-4809474 GACGGAGGGTAGCACCAGTCTGG - Intergenic
976306544 4:83565694-83565716 CCCGGTGGGTACCCCGAGTCCGG + Intronic
977534974 4:98246732-98246754 TACAGAAGGTAGCCCCAGTAGGG + Intergenic
978318260 4:107464463-107464485 CCCAGATTATAGCCCCAGTAGGG + Intergenic
979126607 4:116980760-116980782 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
983327431 4:166274578-166274600 CCCAGCGGGTACCCCGAGTCCGG - Intergenic
983936221 4:173504424-173504446 CCCAGTGGGTAGAACCAGACAGG + Intergenic
983978036 4:173960576-173960598 CCCAGACGATAGCCCCAGCAGGG + Intergenic
985421012 4:189785308-189785330 TCCAGAGGGATGGCCCAGTCAGG + Intergenic
985706243 5:1403007-1403029 CCCAGCGCGTTGGCCCAGTCGGG + Exonic
990699150 5:58457213-58457235 CCCAGAGGATCGTCCCAGTTTGG - Exonic
992586453 5:78245047-78245069 CCCATAGGGTACCCAAAGTCCGG + Intronic
994787006 5:104178811-104178833 ACCAGGGGATAGCCCCAGCCAGG - Intergenic
995394423 5:111672557-111672579 CCCAGAGTGATGCCCCAGTGAGG - Intronic
997272944 5:132557056-132557078 CCCGGCGGGCAGCCCCAGGCTGG + Exonic
1001282415 5:170396285-170396307 CCCTGAGGGTCTCCCCAGGCTGG - Intronic
1002563759 5:180099011-180099033 CTCTGAGGCAAGCCCCAGTCAGG + Intergenic
1002948626 6:1786520-1786542 CCCAGTGTGTGGCCCCAGCCTGG - Intronic
1003395727 6:5750492-5750514 ACCAGAGAGGAGGCCCAGTCAGG + Intronic
1003872757 6:10415030-10415052 CCCAGAGAGTAGCTCCACTTGGG - Exonic
1011935378 6:92770295-92770317 ACCAGTGTGCAGCCCCAGTCTGG + Intergenic
1013355564 6:109343126-109343148 CCCAGAGGGTTGGCACAGTAAGG - Intergenic
1017058669 6:150460344-150460366 CCCAGAGGGGAAGCCCAGCCAGG + Intergenic
1017191594 6:151659613-151659635 CCCAGACGGTACCCACAGTGAGG - Intronic
1018718907 6:166557239-166557261 CGCAGAGGGTAGCTCCTGCCGGG + Intronic
1019340968 7:508774-508796 CCCAGATGGGAGCCCCAGGGAGG + Intronic
1020790478 7:12621441-12621463 CCCAGTGGGCGGACCCAGTCTGG - Intronic
1020939216 7:14509780-14509802 CCCAGCAGGTACCCCGAGTCTGG - Intronic
1022477737 7:30722839-30722861 CCCTAGGGGAAGCCCCAGTCTGG + Intronic
1023940472 7:44765870-44765892 CCCAGAGGGGGGCCCCAGATGGG - Intronic
1027250888 7:76397973-76397995 CCCACAAGCTACCCCCAGTCTGG - Intronic
1028192262 7:87867028-87867050 CCCAGTGGGTACCCCAAGTCTGG - Intronic
1028581494 7:92413820-92413842 CCCACAGGGAAGCCCCAGCCAGG + Intergenic
1029375295 7:100173834-100173856 CCCAGATAGTTGCCCCAGTCAGG + Exonic
1030121084 7:106111872-106111894 CCCAGAGGGGAGCTCCGGTGTGG + Intronic
1030972085 7:116072007-116072029 CCCAAAGATTAGCCCCATTCTGG + Intronic
1033669104 7:143472697-143472719 CCCAGCGGGTACTCCGAGTCCGG - Intergenic
1034459006 7:151187676-151187698 CCCAGATGGTGTCCCCAGTGGGG + Intronic
1036912408 8:12768197-12768219 CCCAGAGAGCAGCCCAAGTGTGG + Intergenic
1037945169 8:22985114-22985136 CCCATAGGGTACCCAAAGTCTGG + Intronic
1038482431 8:27910828-27910850 CCTGGAGGGCAGCCCCACTCGGG - Intronic
1039092320 8:33845298-33845320 CCAAGAGGGAAGCCCCAATAGGG - Intergenic
1040542414 8:48372207-48372229 CCCAGAGGATAGGCCAAGTGGGG + Intergenic
1040787072 8:51178618-51178640 CCCAGAGGGTACCCTGAGTCTGG + Intergenic
1042020416 8:64368436-64368458 TCCAGAGGGGAGGCCCAGTTGGG + Intergenic
1043295335 8:78654629-78654651 CCCAGTGTGTACCCCAAGTCCGG - Intergenic
1044142075 8:88668806-88668828 GCCAGAGGGTAGCACCAAACAGG + Intergenic
1047581850 8:126224405-126224427 CCCCGATGGTAGCCCAGGTCAGG - Intergenic
1056965576 9:91160921-91160943 CCCAGAGGGGAGCAGCAGGCAGG + Intergenic
1057441488 9:95086826-95086848 CCCAGAGGCTGGTCCCAGCCAGG + Exonic
1061811877 9:133167053-133167075 CCCAGAGGTAAGGCCCAGCCGGG - Intergenic
1061841573 9:133361413-133361435 TCCTGAGGGGAGCCCCATTCAGG + Intergenic
1062031715 9:134364875-134364897 CCGAGAGGCCAGCCCCAGCCTGG - Intronic
1185536043 X:862350-862372 TCCTGAGGGTGGCCCCAGGCAGG + Intergenic
1190219741 X:48504132-48504154 CCTTGAGGGTAGCCCCGGTGTGG - Intergenic
1198064822 X:133085856-133085878 CCCAGACAGTAGCCCCAGCCGGG - Intronic
1200079586 X:153569416-153569438 CACAGAGGCTGGCCTCAGTCAGG + Intronic
1201783215 Y:17745357-17745379 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
1201818338 Y:18160630-18160652 CCCAGTGGGTACCCTGAGTCTGG + Intergenic
1202174576 Y:22085606-22085628 CCCAGTGGGTACCCCGAATCTGG - Intronic
1202544369 Y:25974760-25974782 CCCAGTGGGTACCCCGAATCTGG + Intergenic