ID: 1144977700

View in Genome Browser
Species Human (GRCh38)
Location 17:19148291-19148313
Sequence GATAAAGATGTGTTCAAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 2, 1: 0, 2: 6, 3: 26, 4: 293}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144977700_1144977702 25 Left 1144977700 17:19148291-19148313 CCGGCCTTGAACACATCTTTATC 0: 2
1: 0
2: 6
3: 26
4: 293
Right 1144977702 17:19148339-19148361 ATAAAGCAGCAAGCTGCCCCAGG 0: 2
1: 0
2: 0
3: 11
4: 142
1144977700_1144977703 26 Left 1144977700 17:19148291-19148313 CCGGCCTTGAACACATCTTTATC 0: 2
1: 0
2: 6
3: 26
4: 293
Right 1144977703 17:19148340-19148362 TAAAGCAGCAAGCTGCCCCAGGG 0: 2
1: 0
2: 2
3: 11
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144977700 Original CRISPR GATAAAGATGTGTTCAAGGC CGG (reversed) Intronic
901398065 1:8996062-8996084 TATAAAAATGTTTTCTAGGCTGG - Intergenic
901928521 1:12582608-12582630 GACAAACATTTGTTCCAGGCAGG + Intronic
902386437 1:16078506-16078528 GGTAAAGAGGTGTTCTGGGCTGG + Intergenic
905102916 1:35541281-35541303 GATAAATATGTTTTGAAGGAAGG + Intronic
906030160 1:42712984-42713006 AATAAAGAAATGTTGAAGGCTGG - Intergenic
906985280 1:50676522-50676544 TATAAAAATATATTCAAGGCTGG + Intronic
907081038 1:51622224-51622246 CATAAAGATGTGTTACAGTCTGG + Intronic
907151514 1:52292763-52292785 CATAAAGAAATGTTCAAGGCCGG - Intronic
907956558 1:59233551-59233573 GATAAAGACATATCCAAGGCTGG - Intergenic
908644601 1:66263888-66263910 GAAAAAGAAGTGTTCAAGTTTGG + Intronic
908688299 1:66748626-66748648 GATAAAGATGTATTTAAGGTAGG - Intergenic
908933266 1:69341775-69341797 AATAAAGACATGTTCAAGACTGG - Intergenic
909257366 1:73440186-73440208 GATAAAGACATATTCAAGACTGG - Intergenic
909593891 1:77382644-77382666 TACAAAAATGTGTTCTAGGCTGG - Intronic
909884507 1:80924077-80924099 GATAAAGATATGTACCATGCAGG - Intergenic
910919853 1:92332619-92332641 GATTAAGATGATTTCAAGGTGGG + Intronic
911284919 1:95978286-95978308 AATAAAGATGTGTGTAATGCAGG - Intergenic
912954111 1:114140765-114140787 CAGAAAGACTTGTTCAAGGCAGG - Intronic
913060436 1:115200115-115200137 GATTAAGTTGTTTTCAAGGCTGG + Intergenic
916857151 1:168761759-168761781 AATAAAGATGTGCCCAAGACTGG + Intergenic
917418483 1:174836908-174836930 AATAAAAATATGTTCCAGGCGGG + Intronic
917547201 1:175983505-175983527 GATAAAGATATACTCAAGACTGG - Intronic
919175041 1:194009567-194009589 GATAAAGATATAACCAAGGCTGG - Intergenic
922488185 1:225993029-225993051 GGTTAAAATGTGTTCAAGGATGG + Intronic
923769580 1:236926752-236926774 GATAAAGACATTTTCAAGACTGG - Intergenic
1063045135 10:2384189-2384211 GATAAAGACATGTCCAAGACTGG - Intergenic
1065337099 10:24663933-24663955 GATAAAGATGTGTATAAAGAGGG + Intronic
1065820863 10:29523975-29523997 GACACTGATGTGTTCACGGCAGG + Exonic
1065845255 10:29737777-29737799 GATCAAGATGTGGTCAGGGTTGG + Intergenic
1068180140 10:53507125-53507147 GATAAATATGTACTCAAAGCAGG + Intergenic
1068317539 10:55365810-55365832 GATAAAGATGTACTCAAGACTGG - Intronic
1069173731 10:65263659-65263681 GATAAAGACATACTCAAGGCTGG + Intergenic
1069654067 10:70074838-70074860 AATAAAGATGTATCCAAGACTGG - Intronic
1070633388 10:78104718-78104740 GATAAAGACATATTCAAGACTGG - Intergenic
1072268105 10:93749824-93749846 TATAAGGATGTGTTAAAGGTTGG + Intergenic
1074751110 10:116588232-116588254 GATAGAGTTGGGTTCAAGGTGGG - Intergenic
1074905267 10:117856844-117856866 GAGAAAGATGAGGTCATGGCTGG + Intergenic
1075168778 10:120093773-120093795 GATAAAGACGTACTCAAGACTGG + Intergenic
1075389113 10:122079559-122079581 GATAAAGATGAGTGCAGGGGTGG + Intronic
1075640588 10:124061493-124061515 GATAAAGACGTGCCCAAGACTGG - Intronic
1075677059 10:124303206-124303228 GGCAAAGCTGTTTTCAAGGCTGG - Intergenic
1075840595 10:125499070-125499092 TATACAGATGTCTTCAGGGCAGG + Intergenic
1076101189 10:127780024-127780046 GATAAAGATGTATGCAAGACTGG - Intergenic
1076107052 10:127832022-127832044 GATCAAGGTGTGTGCAGGGCTGG - Intergenic
1076945205 10:133642638-133642660 GAAAAAGATGTGTTGAAAACAGG + Intergenic
1078559897 11:12362368-12362390 AAGAAAGCTGTTTTCAAGGCTGG + Intergenic
1080569258 11:33541709-33541731 GACAAAGGTGTGTGCAAGACAGG - Intergenic
1081782914 11:45725831-45725853 GATACAGTGGTGCTCAAGGCAGG - Intergenic
1082049991 11:47763165-47763187 GATGAAGATGTGTTGCAGGCTGG + Intronic
1082614962 11:55348534-55348556 GATAAAGATGTACCCAAGACTGG - Intergenic
1082637608 11:55615455-55615477 GATGAAGATGTGGTCCAGGGTGG - Intergenic
1083131415 11:60626913-60626935 GGTAAACATGTGTTCAACTCTGG - Intergenic
1084739467 11:71129926-71129948 GATCAAGATGTCTGCAGGGCTGG + Intronic
1085113089 11:73905805-73905827 GAAAAGTATGTATTCAAGGCAGG - Intronic
1085560286 11:77466305-77466327 TTTAAAAATGTCTTCAAGGCCGG + Intronic
1087517861 11:99187899-99187921 AAAAAAGAAGTGTTCAAGGATGG - Intronic
1088315685 11:108504183-108504205 GAAAAAGATCTGTTGGAGGCTGG - Intergenic
1089131775 11:116217995-116218017 GATAAAGACATATTCAAGACTGG + Intergenic
1093617938 12:21250855-21250877 GATATAAATGTGTTCCTGGCCGG + Intergenic
1093705548 12:22271193-22271215 ATTAAGGATGTTTTCAAGGCTGG + Intronic
1095122731 12:38438182-38438204 GATAAAGATGTACCCAAGACTGG + Intergenic
1097406249 12:59194292-59194314 GTTAAAGATGTACTCAAGACTGG + Intergenic
1097848125 12:64386825-64386847 TTTAAAGATGTGTTTATGGCTGG - Intronic
1097967942 12:65601387-65601409 AATAAAGATTTGTTGAAAGCTGG - Intergenic
1099178833 12:79454610-79454632 AATAAAGATGTGTTGCAGTCGGG - Intergenic
1100078405 12:90817407-90817429 GATGAAGCTATGTTCAAGACTGG + Intergenic
1102710567 12:114922630-114922652 GGGAAAGGTGTTTTCAAGGCTGG - Intergenic
1105775122 13:23652840-23652862 GATAAATATGTGTTAAATGACGG - Intronic
1110237015 13:73227665-73227687 GATAAAGACCTGCCCAAGGCTGG + Intergenic
1111551598 13:89819428-89819450 GATAAAGATATATCCAAGACTGG - Intergenic
1111706690 13:91758887-91758909 GAGAAAGATGTGCTCAAGAAAGG - Intronic
1112099589 13:96173015-96173037 GATAAAGATGTGAACAAAGTAGG + Intronic
1113028956 13:105972938-105972960 GAAAAAGATATTTGCAAGGCAGG - Intergenic
1113540880 13:111108442-111108464 GATAAAGATTTGGTCAAAGAGGG + Intergenic
1114986205 14:28231636-28231658 GATAAAGACATATTCAAGACTGG + Intergenic
1115132868 14:30073954-30073976 GATAAAGACGTATCCAAGACTGG - Intronic
1115741264 14:36391406-36391428 GATAAAGAAGAGTTCAGAGCTGG - Intergenic
1116206148 14:41869585-41869607 GATAAAGATGTACCCAAGACTGG + Intronic
1117958786 14:61143360-61143382 GATAAAGATGTACCCAAGACCGG + Intergenic
1117996597 14:61483749-61483771 AATAAAGATAGGTTCAAGGCTGG + Intronic
1118125968 14:62904709-62904731 GTTAAAGATGACTACAAGGCTGG + Intronic
1121222340 14:92295949-92295971 TAAAAAGATATGTTGAAGGCTGG + Intergenic
1122080788 14:99266062-99266084 GTGAAAGATGTGATCAAGACTGG + Intronic
1122168583 14:99851601-99851623 GATAAAGAACTGTTCTCGGCCGG - Intronic
1202918538 14_KI270723v1_random:7962-7984 GAAAAAGATGTGTTGAAAACAGG + Intergenic
1202926084 14_KI270724v1_random:26609-26631 GAAAAAGATGTGTTGAAAACAGG - Intergenic
1124205823 15:27719205-27719227 GATGAAGATGTCTTCAGGGTTGG + Intergenic
1124259620 15:28176843-28176865 CATAAAGATGTGTGCATGGTTGG - Intronic
1125149409 15:36515160-36515182 GTTAAAAATGTTTTCCAGGCCGG + Intergenic
1125249270 15:37680924-37680946 ACCAAAAATGTGTTCAAGGCTGG + Intergenic
1127983272 15:64049726-64049748 GATAAAGATGTAACCATGGCAGG + Intronic
1128119890 15:65137968-65137990 GATAAAGACATATTCAAGACTGG + Intergenic
1129380924 15:75165661-75165683 AATAAAGATGTGTTTGAGCCTGG - Intergenic
1130324327 15:82866864-82866886 GATAAAGATATACTCAAGACTGG - Intronic
1130664913 15:85861461-85861483 GTGAAAGATTTGTTCAAGGCCGG + Intergenic
1130959563 15:88650692-88650714 GATAGTGATGTGTCCAAGGCAGG - Intronic
1131005063 15:88971242-88971264 GATAAAGATATATCCAAGACTGG + Intergenic
1134780777 16:16893267-16893289 AATAAGTATGTGTTCAAGACAGG - Intergenic
1134885798 16:17790400-17790422 GATAAAGACATATCCAAGGCTGG + Intergenic
1135674324 16:24402385-24402407 GATATAGATGTGTCCAAACCTGG - Intergenic
1135867729 16:26119720-26119742 GATAAATATTTGTTCAATGATGG - Intronic
1136368823 16:29823005-29823027 GATAAAGATCAGTTTCAGGCCGG - Intronic
1137867124 16:51910529-51910551 GAAAAATCTGTGTTCAAGACTGG - Intergenic
1138031938 16:53566237-53566259 GATATAGATGTGGTCAAGGTGGG - Intergenic
1138872737 16:60911677-60911699 AATAAAGATATGCTCAAGACTGG - Intergenic
1139684533 16:68592532-68592554 GATAAAGATATATCCAAGACTGG - Intergenic
1143290162 17:5822213-5822235 GACAAAGATGATTTCAAGGTGGG + Intronic
1143806772 17:9435035-9435057 GAGAAAGATGTGGTCAAAACAGG - Intronic
1144957456 17:19026225-19026247 GATAAAGATGTGTTCAAGGCCGG + Intronic
1144977700 17:19148291-19148313 GATAAAGATGTGTTCAAGGCCGG - Intronic
1147688924 17:42303744-42303766 GTTGGAGATGTGTTTAAGGCGGG + Intronic
1148485133 17:47985988-47986010 TAGAAAGTTGTGTTCTAGGCCGG + Intergenic
1149016725 17:51916664-51916686 GATAAAGATATACCCAAGGCTGG - Intronic
1150202934 17:63376135-63376157 GATAAATAAGAGTTCAGGGCCGG + Intronic
1154345373 18:13539386-13539408 GAAAAAGAGCTGTTCAAGGGAGG + Intronic
1155370753 18:25097885-25097907 GATAATGAGAAGTTCAAGGCAGG - Intronic
1155576413 18:27252648-27252670 GATAAAGATGTACCCAAGACTGG + Intergenic
1155625908 18:27834275-27834297 GATCAAGATGTGTTGAACCCAGG - Intergenic
1155795964 18:30036662-30036684 TATAAAGGTGTATTCAAGACTGG + Intergenic
1156105101 18:33650076-33650098 CACAAAGATGTTTTAAAGGCTGG + Intronic
1156203865 18:34864547-34864569 GATAAGAATGTGTTCTAGGCCGG - Intronic
1157312697 18:46564052-46564074 GATTTAGATGTTTTGAAGGCTGG + Intronic
1157389053 18:47285833-47285855 TATAAAGAACTGTTCAAGACTGG - Intergenic
1158791560 18:60785646-60785668 GATAAAGAATTGCTCAAGACTGG - Intergenic
1159075334 18:63674861-63674883 GAGAAAGTTATGTTAAAGGCAGG - Intronic
1159159118 18:64620847-64620869 GATAAAGATGTACCCAAGACTGG - Intergenic
1159453293 18:68629798-68629820 GATAAAGATTTTTTTAAAGCAGG - Intergenic
1159641657 18:70870326-70870348 GATAAAGTTGTTTTCAAGAAGGG - Intergenic
1163725229 19:18919572-18919594 GATAAGGATGCGGTCGAGGCTGG + Intronic
1164172917 19:22741254-22741276 AATAAAAGTGTGCTCAAGGCCGG + Intergenic
1165336428 19:35173283-35173305 GATTAAGAGATATTCAAGGCCGG + Intergenic
1166348485 19:42181880-42181902 TCTAAAGGTATGTTCAAGGCCGG - Intronic
1167392591 19:49205834-49205856 GCTAAAGATATGTTGAAGTCCGG - Intronic
925583379 2:5437547-5437569 CATAAAGATGTTTACAAGGAAGG - Intergenic
926979237 2:18549516-18549538 GATAAAGACGTACCCAAGGCTGG - Intergenic
928029126 2:27764032-27764054 GATAAAGATGTCTGCCTGGCTGG + Intergenic
928282273 2:29958763-29958785 GATAAAGACATATTCAAGACTGG + Intergenic
932293984 2:70609199-70609221 GAGAGAGAGCTGTTCAAGGCAGG - Intronic
932491158 2:72121980-72122002 GATAAAGAGCTCTTCCAGGCTGG - Intergenic
934163345 2:89272702-89272724 GTTAAAGAGGTGATCAGGGCAGG - Intergenic
934203929 2:89909822-89909844 GTTAAAGAGGTGATCAGGGCAGG + Intergenic
937319871 2:120954755-120954777 GATAAGGATGTGTGCAGGCCAGG + Intronic
938686217 2:133741152-133741174 GATAAAGACATATTCAAGGCTGG + Intergenic
939647891 2:144723350-144723372 GATAAAGTATTTTTCAAGGCAGG + Intergenic
941269008 2:163402037-163402059 GTTAAAGAACTGTTCAAGCCTGG + Intergenic
941629897 2:167872357-167872379 GATGAAGATGTGTTAAGGGATGG - Exonic
944877967 2:203982212-203982234 GATAAAGACATATTCAAGACTGG + Intergenic
946474880 2:219997461-219997483 CAAAAAGGTGTGATCAAGGCAGG + Intergenic
947276390 2:228396839-228396861 AATAAAGATGTATCCAAGACTGG + Intergenic
1168915331 20:1480683-1480705 GATCAAGATGTCTGCAGGGCTGG - Intronic
1169526069 20:6427141-6427163 AATAAAGATGTGTTTGAGTCTGG - Intergenic
1170540550 20:17383066-17383088 GATAAAGAGGTGAACAAGACAGG - Intronic
1171090087 20:22276829-22276851 AATAAATATGGGTTCTAGGCAGG - Intergenic
1171782529 20:29432638-29432660 GAAAAAGATGTGTTGAAAACAGG + Intergenic
1172365361 20:34344982-34345004 TATAAAGATGTCTTCAAGGCTGG - Intergenic
1172462151 20:35127250-35127272 GATAAAGACGTACTCAAGACTGG - Intronic
1172530651 20:35628907-35628929 GATAATGATGGGTACAAAGCTGG + Intronic
1172927208 20:38548973-38548995 TTTAAAGACATGTTCAAGGCAGG + Intronic
1174361629 20:50032370-50032392 GATAAGTATGTGTTCAAGGGTGG + Intergenic
1174636910 20:52008816-52008838 GATAAGATTGTGTTCATGGCCGG + Intergenic
1175076312 20:56377490-56377512 CATAAAAAGATGTTCAAGGCCGG + Intronic
1178260355 21:31094005-31094027 GATAAAGATATACCCAAGGCTGG - Intergenic
1179251396 21:39674114-39674136 GATAAAGGTGTCGTCAGGGCTGG + Intergenic
1180049809 21:45325980-45326002 TGTGAAGATGTCTTCAAGGCAGG - Intergenic
1181285828 22:21751686-21751708 GATAAAGATGTTATATAGGCTGG - Intergenic
1181539314 22:23564955-23564977 GATGAAGATGTGCTGAGGGCCGG + Intergenic
1182780619 22:32864587-32864609 GTAAAAGATGTTTTCAAGGTGGG - Intronic
1183798797 22:40143790-40143812 TAGAAAGATGTATTCCAGGCCGG - Intronic
949867603 3:8559256-8559278 GACAAAGATATGTTGAAGGCAGG - Intronic
950085324 3:10253352-10253374 GAGAAAGATGTGTTAAAGGCTGG - Intronic
951051871 3:18102721-18102743 GATACAGTTGTGAACAAGGCAGG + Intronic
951398279 3:22198690-22198712 TATAAAAATGTGTACATGGCAGG + Intronic
952042402 3:29276867-29276889 TATAAAGATTTATTCAAGGCTGG - Intergenic
952145048 3:30523360-30523382 AACAAATATGTGTTGAAGGCTGG + Intergenic
953360688 3:42293569-42293591 GATAAAGACGTATCCAAGACTGG - Intergenic
954759723 3:52865412-52865434 GATAAAGATGCATCCAAGACTGG + Intronic
955344990 3:58154244-58154266 GGTTAAGATGTATTCAGGGCTGG + Intronic
956699428 3:71945735-71945757 AATAAAGATGTGTTTGAGCCTGG - Intergenic
957082953 3:75653746-75653768 GAAAAAGATGTGTTGAAAACAGG - Intergenic
958865138 3:99492039-99492061 AATAAAGATATATTCAAGACTGG + Intergenic
959161172 3:102725714-102725736 GATAAAGATGTACCCAAGACTGG - Intergenic
961355582 3:126337886-126337908 GATGAAGGTGCTTTCAAGGCGGG + Intergenic
961406666 3:126684596-126684618 GATAAAGGTGTGGGCAGGGCTGG + Intergenic
961951639 3:130755745-130755767 CATAAAAATGTGTTCAATGATGG - Intergenic
963296796 3:143555333-143555355 GATAAAGATATGTTCAAGACTGG - Intronic
963366881 3:144346500-144346522 GGTAAACATGTGTTCGAGTCAGG - Intergenic
965146431 3:164911843-164911865 GATAAAGATATATCCAAGACTGG + Intergenic
967959012 3:194903783-194903805 GATAAAAATGTGCCCAAGACTGG - Intergenic
970079779 4:12269169-12269191 AAGAAAGAAGTGTTCACGGCTGG + Intergenic
970113003 4:12659778-12659800 GATAAAGACGTACTCAAGACTGG - Intergenic
970144777 4:13023881-13023903 AATAAAGATGTCTTCAATGATGG - Intergenic
970752740 4:19384520-19384542 GATAAAGATGTGCCCAAGACGGG + Intergenic
970763167 4:19516166-19516188 GATAAAGATATACTCAAGACTGG - Intergenic
971139283 4:23906315-23906337 TATAAAGATGTTTTCCAGCCGGG + Intergenic
971661957 4:29429918-29429940 TATAAAGAGGTGTTCCTGGCTGG - Intergenic
972051779 4:34743885-34743907 TATAAAGAAGTGTCCAAGACTGG + Intergenic
972583126 4:40412722-40412744 CAGAATGATGTGTTGAAGGCAGG - Intergenic
973173136 4:47169796-47169818 GCTAAAAATGCTTTCAAGGCCGG - Intronic
974509828 4:62824281-62824303 GATAAATATGTGTTAAGTGCAGG + Intergenic
975092023 4:70415171-70415193 GAGAAAGATGAGTGAAAGGCTGG + Intergenic
976895812 4:90109560-90109582 GATAAAGAAGTGGACAAGGCAGG - Intergenic
977039271 4:91994791-91994813 GATAAAGATGTACCCAAGGCTGG + Intergenic
977133458 4:93271290-93271312 CATAAAAATGTGTGCAATGCTGG + Intronic
980767201 4:137321961-137321983 AATAAAGACCTATTCAAGGCTGG + Intergenic
982324837 4:154119610-154119632 GAAATAGATCTGTTCCAGGCTGG + Intergenic
982477082 4:155867262-155867284 GATAAAGACATATTCAAGACTGG + Intronic
982888856 4:160821143-160821165 AATAAAGAAGTGTTCAAGCTAGG + Intergenic
982923302 4:161303899-161303921 GATAAAGACGTGCCCAAGACTGG - Intergenic
983669234 4:170216316-170216338 GATAAAGATATATCCAAGACTGG - Intergenic
983766253 4:171488630-171488652 GATAAAGAACTGTCCAAGACTGG - Intergenic
983802826 4:171956461-171956483 GATAAAGATGTGTACAAGGATGG - Intronic
985142106 4:186851459-186851481 GATAAATATGTGCCCAAGGTGGG - Intergenic
985448586 4:190043151-190043173 GAAAAAGATGTGTTGAAAACAGG + Intergenic
987323395 5:16790718-16790740 GATAAAGATATGCTCGAGACTGG - Intronic
988129832 5:27089367-27089389 AATAATACTGTGTTCAAGGCAGG + Intronic
988221091 5:28348194-28348216 GATAAAGATATGTGCAAGACTGG + Intergenic
988478687 5:31610984-31611006 AGTAAAGATTTGTTTAAGGCCGG - Intergenic
988708512 5:33749871-33749893 GAGAGAGAGGTGTTCAAGGTGGG + Intronic
991606149 5:68403242-68403264 TATAAAGATGAGTTCCAGCCTGG + Intergenic
991662845 5:68968131-68968153 TATAAAGATGTGATGCAGGCTGG + Intergenic
991938531 5:71827709-71827731 GCTAGGGATGTGTCCAAGGCGGG + Intergenic
991957662 5:72011950-72011972 GGTAAAGAGGTGTTCTCGGCCGG - Intergenic
992348585 5:75906390-75906412 GATCAAGATGTATCCAAGGATGG + Intergenic
993875315 5:93299817-93299839 AAAAAAGATGTGTTTAAGGTCGG - Intergenic
993893825 5:93506477-93506499 GATAAAGATGTACCCAAGACTGG + Intergenic
994136194 5:96289654-96289676 GATAAAGATGTATCCAAGACTGG - Intergenic
994686179 5:102955492-102955514 GATAAATATGTGTTGAATGAAGG - Intronic
995040208 5:107578921-107578943 AATACAAATGTGATCAAGGCTGG - Intronic
995054167 5:107741064-107741086 GAAAAAGAAGTGTTCACTGCAGG + Intergenic
995333681 5:110975238-110975260 GATAAAGACGTACTCAAGACTGG + Intergenic
995631427 5:114137222-114137244 GATAAAAATGTCTTCAATGTGGG + Intergenic
996211361 5:120815323-120815345 GATAAAGATATATCCAAGACTGG + Intergenic
996425629 5:123311122-123311144 GGTAAAAGTGTGTCCAAGGCAGG + Intergenic
996494422 5:124137446-124137468 GATAAAGATGTGTTCCTTGAGGG + Intergenic
996827285 5:127699532-127699554 GAAAAAGATGAGGTCAAGGGAGG + Intergenic
997817427 5:137032810-137032832 GGTAACGAGGTGTTCAAGACAGG + Intronic
998384512 5:141748788-141748810 GATAAAGGTGGGTAAAAGGCTGG - Intergenic
998907825 5:146925595-146925617 GACAATGATGTGTTCAAGTGTGG + Intronic
999696761 5:154193968-154193990 AAGGAAGATGTCTTCAAGGCTGG - Intronic
1000286362 5:159829507-159829529 GATGAAAGTGTGTCCAAGGCTGG + Intergenic
1001192038 5:169640274-169640296 TATAAAGAGGGCTTCAAGGCAGG + Intronic
1002592800 5:180302931-180302953 AATAAAGATGAATTCCAGGCCGG + Intronic
1002598862 5:180342215-180342237 GATAAAGACGTGCCCAAGACTGG - Intronic
1003506110 6:6741503-6741525 GATACTGATGTCTCCAAGGCTGG + Intergenic
1003598771 6:7499376-7499398 GAGAAAGATGTGGGAAAGGCCGG + Intergenic
1005601552 6:27431288-27431310 GCAAAGGATGTGTTCAAGACAGG + Intergenic
1006475756 6:34252146-34252168 AATAAAGATGTTTTCAGGCCAGG + Intergenic
1006801544 6:36763052-36763074 GAAACGGATGTGTGCAAGGCTGG - Intronic
1008244924 6:49160450-49160472 GATAAAGATATATCCAAGACTGG + Intergenic
1008479142 6:51966676-51966698 AATAAACATTTGTTGAAGGCAGG - Intronic
1012194278 6:96319118-96319140 GATAAAGACATGTCCAAGACTGG + Intergenic
1012223985 6:96684769-96684791 GATAAAGACATGCTCAAGACTGG - Intergenic
1012956687 6:105578564-105578586 GATAAAGATGTACCCAAGACTGG + Intergenic
1013639397 6:112058551-112058573 TTTAAAAATGTGTGCAAGGCAGG + Intronic
1013687974 6:112608413-112608435 GATAAAGATGTACCCAAGACTGG - Intergenic
1013856145 6:114574838-114574860 GACAAAGATGTGCGCAGGGCTGG - Intergenic
1014362221 6:120493355-120493377 GGTAGAGATATGTTCAATGCAGG + Intergenic
1015654552 6:135502596-135502618 GATAAAGATGTCTGCAGGGTTGG + Intergenic
1016979266 6:149839189-149839211 ATAAAAGATGTGTCCAAGGCCGG - Intronic
1021927276 7:25545786-25545808 GAAGCAGATGTGATCAAGGCTGG + Intergenic
1023123803 7:36935347-36935369 GATAAAGATATATGCAAGACTGG - Intronic
1023985446 7:45091789-45091811 AAGAAACATCTGTTCAAGGCTGG + Intergenic
1024279109 7:47703900-47703922 AATAAAGATGTGTTTGAGCCTGG - Intronic
1025174879 7:56794010-56794032 GGAAAAGAGGTGTTCAAGGTGGG + Intergenic
1025696925 7:63782404-63782426 GGAAAAGAGGTGTTCAAGGTGGG - Intergenic
1027705729 7:81531056-81531078 GATAATGATATCTTGAAGGCAGG - Intergenic
1027760648 7:82274828-82274850 GATAAATATGTGTTCAATACAGG + Intronic
1027834033 7:83218383-83218405 GATAAAGACATATCCAAGGCTGG - Intergenic
1028695123 7:93700783-93700805 GAAAAAGATGTGTTAAATGGTGG + Intronic
1029129852 7:98321798-98321820 GATAAAAATGAATTCCAGGCCGG + Intronic
1029142839 7:98423937-98423959 GGTGAAGATGTGATCAAGGTGGG + Intergenic
1030458943 7:109807199-109807221 GATAAAGATGTGCCCAAGACTGG - Intergenic
1031334318 7:120508438-120508460 CAGAAAGATGTTTTCAAGGAAGG + Intronic
1035228148 7:157444835-157444857 GATCAAGGTGTGTGCAGGGCTGG - Intergenic
1036944498 8:13082008-13082030 GATCAAGCTGTGAGCAAGGCTGG - Intergenic
1039272924 8:35902739-35902761 TATAAAGAACTGTCCAAGGCTGG - Intergenic
1040825319 8:51613528-51613550 GAAAAAGATGATTTCAAGGATGG + Intronic
1040866911 8:52056653-52056675 GATCAAGATGTCATCAAGGTTGG - Intergenic
1041488402 8:58404892-58404914 GATAAAAATGTTTTAAAGGATGG + Intergenic
1043111289 8:76186311-76186333 GACAAAGATGTACTCAAGACTGG + Intergenic
1043379141 8:79684114-79684136 CATGGAGATGTGTTCAAGACAGG - Intergenic
1043842509 8:85125375-85125397 GATTAAGAGGTGTTCAAGGCCGG + Intronic
1044744085 8:95355398-95355420 GATAAAGATATAGTCAAGGCTGG - Intergenic
1046247224 8:111580538-111580560 GTTAAAGATGTATTTAAGGCTGG + Intergenic
1046506257 8:115141555-115141577 GAAAAATATGTGTTCAATTCAGG + Intergenic
1047204131 8:122789726-122789748 GGAAAAGATGGGTTCCAGGCAGG + Intronic
1047641257 8:126823984-126824006 GATAAAGATATATCCAAGACTGG - Intergenic
1048027691 8:130601723-130601745 GATAAAGACATATCCAAGGCTGG - Intergenic
1048596581 8:135873117-135873139 AATTAAGATGTGTGCCAGGCTGG + Intergenic
1049250533 8:141586403-141586425 GATAAAGATGTGCCTAAGACTGG - Intergenic
1050411964 9:5375549-5375571 GGCAAAGATGTTTTCAAGGAAGG + Intronic
1050462560 9:5889488-5889510 AATAAAGATGTGTTTGAGGCTGG + Intronic
1050602788 9:7269464-7269486 TGTAAAAATGAGTTCAAGGCAGG + Intergenic
1055423651 9:76170596-76170618 GCTAAAGATGTGTTCATGGATGG - Intronic
1055494413 9:76840682-76840704 CATAAAAATTTGTTCTAGGCTGG + Intronic
1055855911 9:80688196-80688218 AAAAAAGATGGGTCCAAGGCAGG - Intergenic
1056018634 9:82418928-82418950 TTTAAAGATTTGTTCCAGGCCGG + Intergenic
1056456027 9:86761514-86761536 GATAAAAATATATTCAAGACTGG + Intergenic
1057171226 9:92964457-92964479 GAGACGGATGTTTTCAAGGCAGG + Intronic
1057494703 9:95552154-95552176 GATAGAGAAGTGGTAAAGGCAGG - Intergenic
1057549245 9:96039920-96039942 GATAAAGATGTGGTCCAGGCCGG + Intergenic
1057647829 9:96893702-96893724 AAAAATGATGAGTTCAAGGCCGG + Intergenic
1058971719 9:110089359-110089381 AATAAAGATCTTTTCATGGCTGG - Intronic
1059045627 9:110862803-110862825 TATAAAGAACTGCTCAAGGCTGG - Intergenic
1059170350 9:112118779-112118801 GATAAAAATGTATTCCTGGCTGG - Intronic
1203760140 EBV:8507-8529 TATTAAGATGTGTCCCAGGCAGG - Intergenic
1203442583 Un_GL000219v1:23618-23640 GAAAAAGATGTGTTGAAAACAGG + Intergenic
1203513391 Un_KI270741v1:142527-142549 GAAAAAGATGTGTTGAAAACAGG + Intergenic
1185843583 X:3416369-3416391 GATCAAGGTGTGGGCAAGGCTGG + Intergenic
1186155302 X:6719174-6719196 GATCAAGGTGTGGGCAAGGCTGG + Intergenic
1187241078 X:17513881-17513903 GATAAAGATATACCCAAGGCCGG + Intronic
1187432493 X:19237660-19237682 GAGAAAGATGTGCTCAAGCTGGG + Intergenic
1187561873 X:20411023-20411045 GCTAAATATGTGTGCAAGGAAGG - Intergenic
1189277901 X:39800080-39800102 GAAAAAGATTTATTCAGGGCTGG - Intergenic
1189405564 X:40720061-40720083 GATACAGATGTGTTTATGTCAGG - Intronic
1189828784 X:44949092-44949114 TATAAAGATTTGTACTAGGCCGG + Intronic
1193609463 X:83611611-83611633 GATAAAGATGGGTTCATAGATGG + Intergenic
1194828799 X:98596017-98596039 GATAAAGACATGCTCAAGACTGG + Intergenic
1198186785 X:134260858-134260880 GATAAACATTTGTGCAAGGAAGG + Intergenic
1198771574 X:140136296-140136318 CATAAAGAGATGTTCCAGGCTGG + Intergenic
1200605932 Y:5263529-5263551 GATAAAGATTTATCCAAGACTGG - Intronic
1201256604 Y:12113753-12113775 GATCAAGGTGTGGGCAAGGCTGG - Intergenic
1201293633 Y:12445853-12445875 GATAAAGGTGTGAGCAGGGCTGG - Intergenic
1201293700 Y:12446322-12446344 GATCAAGATGTGAGCAGGGCTGG - Intergenic
1201548712 Y:15195807-15195829 GACAATGATGTGTTAAAGGGAGG - Intergenic
1201646613 Y:16240433-16240455 GATCAAGATGTAGACAAGGCTGG + Intergenic
1201656200 Y:16344884-16344906 GATCAAGATGTAGACAAGGCTGG - Intergenic