ID: 1144978644

View in Genome Browser
Species Human (GRCh38)
Location 17:19154824-19154846
Sequence CCTCCCAATCATGTTTTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 3, 1: 0, 2: 0, 3: 16, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144978644 Original CRISPR CCTCCCAATCATGTTTTGTG TGG Intronic
901440037 1:9272243-9272265 CCTCCCATACATGTGTTCTGGGG + Intergenic
909412576 1:75372464-75372486 CCTCCTAATCTTGTTTTGCTTGG - Intronic
910821662 1:91357087-91357109 ACTTCCAAACATATTTTGTGAGG + Intronic
912271143 1:108209897-108209919 CCTCCCAGAGATCTTTTGTGGGG - Intergenic
912348826 1:108991737-108991759 CCTCTTAATCAATTTTTGTGAGG + Intronic
913362821 1:118001329-118001351 CCTCCCTAACTTGTTTTATGAGG - Intronic
916127242 1:161582182-161582204 CTTCCCCATCATGGTCTGTGTGG - Intronic
916137161 1:161663986-161664008 CTTCCCCATCATGGTCTGTGTGG - Intronic
917161797 1:172065515-172065537 CCTCCAAGTTATTTTTTGTGAGG - Intronic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
919578360 1:199339277-199339299 TCTCCCAATAATATTTTATGGGG - Intergenic
920781400 1:208995056-208995078 CCTCCCTAACTTGTTTTATGAGG + Intergenic
922552015 1:226501769-226501791 CCTCCCTAACATATTTTTTGAGG - Intergenic
922668454 1:227491790-227491812 CCTCCCAATCCACTTGTGTGAGG + Intergenic
1066988257 10:42487440-42487462 CCTCCTCATCATGATCTGTGTGG - Intergenic
1067214294 10:44288081-44288103 CCTGACAATCTTGTTTTGAGTGG + Intergenic
1071124545 10:82318994-82319016 CCTCCCAAACATGTTTATTTTGG + Intronic
1073299187 10:102460543-102460565 CCTCAAAATCAAGTTTTGTTTGG - Intergenic
1081826773 11:46061858-46061880 CCTCCCATACATCTTTTTTGAGG - Intronic
1082653706 11:55826140-55826162 CATCATAATGATGTTTTGTGAGG + Intergenic
1083008834 11:59374582-59374604 TCTCCCAATATTGTTGTGTGGGG - Intergenic
1083487823 11:62994665-62994687 CCTCCAGATCATCTTTGGTGGGG - Exonic
1083507341 11:63170796-63170818 CCTCCCTAACATATTTTATGAGG + Intronic
1087422220 11:97943935-97943957 CTTCTCAATCATGTTTGGTTGGG - Intergenic
1088413845 11:109567559-109567581 CCTCCCAGCCATGGTTTCTGTGG + Intergenic
1089536150 11:119161768-119161790 CCTCCCCATCACCTTTGGTGGGG + Exonic
1090363173 11:126187132-126187154 CCTCCCACACAGGTCTTGTGGGG + Intergenic
1090817505 11:130312019-130312041 ACCCCCAATGATGTTTTTTGGGG - Intronic
1093154320 12:15663213-15663235 CCTCCAAATGATATTTTTTGGGG - Intronic
1096550036 12:52366095-52366117 CCTCCCAAGAAAGTTTTGTCGGG - Intronic
1099300934 12:80893552-80893574 TCTCCCAATGATCTTTTATGAGG - Intronic
1102754802 12:115329627-115329649 CCTTCCAAACATATTTTATGAGG - Intergenic
1102862207 12:116345672-116345694 CCTTGCAAACATGTTTTGTTGGG + Intergenic
1105583833 13:21725630-21725652 TCTGCCAATCAGTTTTTGTGAGG + Intergenic
1112120955 13:96411030-96411052 CCCACCAATAATGGTTTGTGGGG - Intronic
1114897068 14:27004421-27004443 CCTATCAATGATGTTTAGTGAGG + Intergenic
1124117993 15:26866176-26866198 CCTCCCCATCACGTTTTCAGTGG + Intronic
1125358816 15:38844660-38844682 CTCACAAATCATGTTTTGTGAGG - Intergenic
1126555965 15:49987998-49988020 CCTCACAATCAGGATTTCTGAGG + Intronic
1126941887 15:53776341-53776363 CCTCCCTAAAATGTTTTGTGCGG - Intergenic
1127945034 15:63742985-63743007 CTTCCCAACTATATTTTGTGAGG - Intronic
1128827935 15:70738014-70738036 CTTCCCATTAATGTTTTGAGGGG + Intronic
1131442883 15:92472035-92472057 CCTCCCCTTCATGTTCTGTGAGG + Exonic
1132014955 15:98307455-98307477 CCTTCAAATCTTGTTTTGTGTGG - Intergenic
1132243338 15:100276677-100276699 CCTCCAGAGCATGTTTTCTGTGG - Intronic
1136126272 16:28183801-28183823 TCTCCCAATCATATCTAGTGGGG + Intronic
1136530740 16:30867188-30867210 TCCCCCAATCATGTTTTTTTGGG - Intronic
1139263222 16:65615639-65615661 TCTCCCAGTAATGTTTTATGAGG + Intergenic
1140181658 16:72725861-72725883 CCTCTCAATGATGTTAAGTGAGG - Intergenic
1140675108 16:77320305-77320327 CCTTCCAACTATGTTTTCTGTGG + Intronic
1141533674 16:84664128-84664150 TCTGCAAAACATGTTTTGTGGGG - Intronic
1143742332 17:8963874-8963896 CCTCACAGTCCTGGTTTGTGAGG + Intronic
1144969272 17:19097241-19097263 CCTCCCAATCATGTTTTGTGTGG - Intergenic
1144978644 17:19154824-19154846 CCTCCCAATCATGTTTTGTGTGG + Intronic
1144989578 17:19223408-19223430 CCTCCCAATCATGTTTTGTGTGG - Intronic
1148731530 17:49839724-49839746 CCTCCCCATGATGGCTTGTGGGG + Intronic
1150037554 17:61820344-61820366 CTTCACAATCATGTTTTGAATGG + Intronic
1153814014 18:8777423-8777445 GTTCCAAATCATGTTTTGTTTGG - Intronic
926624904 2:15082986-15083008 CCCCCCCACCATGTTTTGGGGGG + Intergenic
928244506 2:29615632-29615654 CCTCCCAGTCAAGGATTGTGGGG - Intronic
929264261 2:39900523-39900545 CCTCCTAGCCATGTTTTCTGAGG + Intergenic
931630782 2:64296656-64296678 CCTCCCTATGATGTTTTGATGGG - Intergenic
932676258 2:73784104-73784126 CCAGCCAATCCTGTCTTGTGGGG + Intergenic
932676844 2:73789005-73789027 CCAGCCAATCCTGTCTTGTGGGG + Intronic
932677429 2:73793902-73793924 CCAGCCAATCCTGTCTTGTGGGG + Intronic
932678015 2:73798800-73798822 CCAGCCAATCCTGTCTTGTGGGG + Intronic
932678601 2:73803700-73803722 CCAGCCAATCCTGTCTTGTGGGG + Intronic
932679181 2:73808599-73808621 CCAGCCAATCCTGTCTTGTGGGG + Intronic
935011786 2:99142420-99142442 CCTGCCAATGATATCTTGTGGGG - Intronic
938979219 2:136509708-136509730 TATCCCAGTTATGTTTTGTGTGG - Intergenic
942320160 2:174729749-174729771 CTTCCCAAGCATGTTTACTGTGG - Intergenic
942413426 2:175734712-175734734 CCTCTTAATCATCTTTTGAGAGG - Intergenic
943104683 2:183529635-183529657 CCTGCCAATTATGTTTTGCTTGG - Intergenic
947897684 2:233690932-233690954 CCTCCAACTCATGTTCTGTAGGG + Intronic
1172438054 20:34944191-34944213 GCTCCCCTTCATGTTTTGTAGGG + Intronic
1173161360 20:40654927-40654949 CCTCACAGTCATGTTCTGTGAGG - Intergenic
1179266383 21:39807168-39807190 CCTCCCAATGATGCTCTGTTGGG - Intergenic
1183234866 22:36609718-36609740 CCTCCCAATCATGCTCTGGGGGG - Intronic
1183234893 22:36609865-36609887 CCTCCCTGTCATGGTTTGCGGGG - Intronic
1183728941 22:39606158-39606180 CCTCCCAATGATGGCTTATGGGG + Intronic
1184669369 22:46004733-46004755 GAGCCCAAGCATGTTTTGTGGGG + Intergenic
949116279 3:328896-328918 ACTCCTACTCATGTTTTGTTAGG + Intronic
950235655 3:11317985-11318007 CCTCCTTATAAGGTTTTGTGAGG + Intronic
951623693 3:24635760-24635782 CCTCCCTAACATATTTTATGAGG - Intergenic
952243015 3:31553120-31553142 CCTCCCTATCAAGTTTTATTTGG - Intronic
953124639 3:40078875-40078897 ACTCCAAATCATGTTTTGACAGG - Intronic
954950869 3:54472029-54472051 CCTCCCTAACATATTTTGTGAGG + Intronic
955079490 3:55645259-55645281 CTTCCCAATCAGGTTGTGTGAGG + Intronic
955110124 3:55940704-55940726 ATTCCCAATGATGTTTTTTGAGG - Intronic
957143178 3:76387227-76387249 CCTCCCAATCCTGTTGGGTTGGG + Intronic
959642674 3:108659124-108659146 CCTCCCTAACTTGTTTTATGAGG + Intronic
959778983 3:110205404-110205426 CCTCCCTAACATATTTTGTGAGG + Intergenic
961051533 3:123751074-123751096 CCTCCCAATCTGGTTTTCAGGGG - Intronic
961291823 3:125853441-125853463 CCTCCCTAACTTGTTTTATGAGG + Intergenic
962623717 3:137204006-137204028 CCTCCCAATGATTTTCAGTGAGG + Intergenic
963427701 3:145153490-145153512 CCTCACAACCATGCTATGTGTGG + Intergenic
964296507 3:155239891-155239913 CCCCCCAATCAAGTAATGTGGGG + Intergenic
964388857 3:156177244-156177266 CTCCCCAATCACGTTATGTGGGG + Intronic
965840455 3:172899962-172899984 CCTCTTCATCATGTTTGGTGGGG - Intronic
973159188 4:46994063-46994085 CCTCCCATTCAGGTGTTATGGGG + Exonic
977515212 4:98013455-98013477 CCTCCCTAACTTGTTTTATGAGG - Intronic
978174840 4:105717310-105717332 CCTCCCAATCAAGTATTTTGGGG - Intronic
980236291 4:130111225-130111247 CCTTGCAATCAGGTTCTGTGGGG + Intergenic
980724640 4:136742634-136742656 CCTTGCAAGCATGTTTTGGGAGG + Intergenic
981743147 4:148024085-148024107 GCTCCCAGTCTTGTTTTGTATGG - Intronic
983226391 4:165089786-165089808 CCTCCCAATCTTCTTTAGTTTGG + Intronic
985190545 4:187367617-187367639 CCTCTCAATCAAATTTTGTGTGG + Intergenic
986880929 5:12170399-12170421 CCTCCAGCTCATGTTTTGAGAGG + Intergenic
987305150 5:16630443-16630465 GCTCCCAAGCATTTTTTGAGTGG + Intergenic
988182120 5:27809723-27809745 CCCCCCACTCATTTATTGTGTGG - Intergenic
989791065 5:45402481-45402503 CCTCCCAATTTTTTGTTGTGAGG - Intronic
991257902 5:64635508-64635530 CATCACACTCATTTTTTGTGAGG - Intergenic
991340103 5:65599702-65599724 AATCCCAATCATGTTTTTTGTGG + Intronic
992112749 5:73511599-73511621 CCTCCCATTCATTTTTTGAATGG - Intergenic
993177353 5:84503698-84503720 TCTCCAAATCCTGTTTTGTGGGG - Intergenic
995302529 5:110600793-110600815 CCTCCCTAACATATTTTATGAGG + Intronic
996517229 5:124384073-124384095 ACTCCCAAGCATTTCTTGTGTGG - Intergenic
999353170 5:150896930-150896952 ACTCCCAGTCATGTATTTTGGGG - Exonic
1001006535 5:168056032-168056054 CCTCTCAGTGATGTCTTGTGAGG + Intronic
1004689451 6:17980317-17980339 CCTTCCAATCATGCTTTCTTAGG + Intronic
1005300721 6:24467856-24467878 CCTCCCAATCTATTTCTGTGTGG + Intronic
1008167370 6:48154947-48154969 CCTCCCCAACTTATTTTGTGAGG + Intergenic
1009435826 6:63617302-63617324 TCTCCCAATCATCTTTTTTGAGG - Intergenic
1009943926 6:70321188-70321210 CCTCCCTAACTTATTTTGTGAGG + Intergenic
1010039800 6:71368032-71368054 CCTGCCATTCAATTTTTGTGAGG + Intergenic
1011273945 6:85609617-85609639 TCTCCCAAGCATGCTTTTTGTGG - Intronic
1011569774 6:88723175-88723197 CCTCCACATCATGTTTGGTTTGG - Intronic
1012277747 6:97294441-97294463 CCTTCCAATTATGTTTTTTAGGG + Intergenic
1013901893 6:115166517-115166539 ACTCTCAATCATATTTTGAGAGG + Intergenic
1021432237 7:20573214-20573236 CCTTCCAACCATATTTTTTGAGG + Intergenic
1021642567 7:22753870-22753892 CCTCCCTAACTTGTTTTATGAGG - Intergenic
1021894394 7:25220421-25220443 CTTCCCAATCATTTTGTGTGAGG + Intergenic
1023350383 7:39314572-39314594 CCTAATAATCATGTTTTGTAAGG + Intronic
1025624243 7:63205264-63205286 CCTCCCACACATGATGTGTGTGG + Intergenic
1026297716 7:69069819-69069841 ACCCCCAATGGTGTTTTGTGAGG + Intergenic
1031533311 7:122902982-122903004 CATCCCACTGATGTTTTGTTTGG - Intergenic
1031738690 7:125399936-125399958 CCACCCAAGCATTTTATGTGGGG + Intergenic
1032073098 7:128821791-128821813 CAACCCAAACATGTTCTGTGGGG - Exonic
1033930616 7:146515780-146515802 CCTCCAAATCATGAGGTGTGAGG + Intronic
1037066044 8:14578535-14578557 CCTCCCAAACTTCTTTTGAGTGG - Intronic
1039881387 8:41627419-41627441 CTTCCCATTCATGCTTAGTGTGG + Intergenic
1041754736 8:61301442-61301464 CCTCCCAACCCTGTTTTCTCAGG + Intronic
1041969327 8:63719173-63719195 GCTGGCAATCATGTTTTTTGAGG + Intergenic
1042038884 8:64570895-64570917 CCTCCCTATCTTATTTTTTGTGG - Intergenic
1042719410 8:71811027-71811049 CCTCACAATCTTGTTTTTTGGGG - Intergenic
1043535017 8:81193320-81193342 ACTTTCAATAATGTTTTGTGAGG - Intergenic
1046346889 8:112941273-112941295 TCTTCCATTCATATTTTGTGTGG - Intronic
1050966897 9:11816082-11816104 CCTCCCAATAACTTTTTGTGAGG + Intergenic
1052506158 9:29357292-29357314 CCTCCCTAACTTGTTTTATGAGG - Intergenic
1053459678 9:38258570-38258592 CCTCCCAATACTGTTGTGTTGGG + Intergenic
1055763627 9:79637372-79637394 CCTGCCACTCCTCTTTTGTGTGG - Intronic
1056416315 9:86379977-86379999 CCTCCCCAACTTGTTTTATGAGG - Intergenic
1186193050 X:7084750-7084772 CTTTCTCATCATGTTTTGTGGGG - Intronic
1187207022 X:17192452-17192474 CCTCCCAATAATCTGTTGGGTGG + Intergenic
1191220978 X:57987960-57987982 TCTCTCAAGCATTTTTTGTGAGG + Intergenic
1191948080 X:66557501-66557523 CCTCCCTAACTCGTTTTGTGAGG + Intergenic
1192998459 X:76537699-76537721 CCTCCCTATCTCATTTTGTGAGG - Intergenic
1194036315 X:88876615-88876637 CCAACAAATCATGTTGTGTGAGG - Intergenic
1199269764 X:145869514-145869536 CCTCCCCATCTCGTTTTATGAGG - Intergenic
1199594731 X:149497562-149497584 TTTCCCTATCATGTTTTATGAGG - Intronic
1199618854 X:149681312-149681334 ACTTGCAATCATGTTTTATGTGG + Intergenic
1199728614 X:150608628-150608650 CCTCACATACATATTTTGTGTGG + Intronic
1201564984 Y:15356193-15356215 CTTTCTGATCATGTTTTGTGGGG - Intergenic