ID: 1144981536

View in Genome Browser
Species Human (GRCh38)
Location 17:19172869-19172891
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144981536_1144981553 30 Left 1144981536 17:19172869-19172891 CCCAGGCTGACTGCCCGTGCCCA No data
Right 1144981553 17:19172922-19172944 ATGAAAAGAGGCCCCTCCCTGGG No data
1144981536_1144981542 -9 Left 1144981536 17:19172869-19172891 CCCAGGCTGACTGCCCGTGCCCA No data
Right 1144981542 17:19172883-19172905 CCGTGCCCAGCTGGACTCCAGGG No data
1144981536_1144981546 7 Left 1144981536 17:19172869-19172891 CCCAGGCTGACTGCCCGTGCCCA No data
Right 1144981546 17:19172899-19172921 TCCAGGGCTTGGCAGTCCCCAGG No data
1144981536_1144981544 -4 Left 1144981536 17:19172869-19172891 CCCAGGCTGACTGCCCGTGCCCA No data
Right 1144981544 17:19172888-19172910 CCCAGCTGGACTCCAGGGCTTGG No data
1144981536_1144981548 18 Left 1144981536 17:19172869-19172891 CCCAGGCTGACTGCCCGTGCCCA No data
Right 1144981548 17:19172910-19172932 GCAGTCCCCAGGATGAAAAGAGG No data
1144981536_1144981540 -10 Left 1144981536 17:19172869-19172891 CCCAGGCTGACTGCCCGTGCCCA No data
Right 1144981540 17:19172882-19172904 CCCGTGCCCAGCTGGACTCCAGG No data
1144981536_1144981552 29 Left 1144981536 17:19172869-19172891 CCCAGGCTGACTGCCCGTGCCCA No data
Right 1144981552 17:19172921-19172943 GATGAAAAGAGGCCCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144981536 Original CRISPR TGGGCACGGGCAGTCAGCCT GGG (reversed) Intergenic
No off target data available for this crispr