ID: 1144981545

View in Genome Browser
Species Human (GRCh38)
Location 17:19172889-19172911
Sequence GCCAAGCCCTGGAGTCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144981545_1144981548 -2 Left 1144981545 17:19172889-19172911 CCAGCTGGACTCCAGGGCTTGGC No data
Right 1144981548 17:19172910-19172932 GCAGTCCCCAGGATGAAAAGAGG No data
1144981545_1144981553 10 Left 1144981545 17:19172889-19172911 CCAGCTGGACTCCAGGGCTTGGC No data
Right 1144981553 17:19172922-19172944 ATGAAAAGAGGCCCCTCCCTGGG No data
1144981545_1144981552 9 Left 1144981545 17:19172889-19172911 CCAGCTGGACTCCAGGGCTTGGC No data
Right 1144981552 17:19172921-19172943 GATGAAAAGAGGCCCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144981545 Original CRISPR GCCAAGCCCTGGAGTCCAGC TGG (reversed) Intergenic
No off target data available for this crispr