ID: 1144981548

View in Genome Browser
Species Human (GRCh38)
Location 17:19172910-19172932
Sequence GCAGTCCCCAGGATGAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144981541_1144981548 4 Left 1144981541 17:19172883-19172905 CCGTGCCCAGCTGGACTCCAGGG No data
Right 1144981548 17:19172910-19172932 GCAGTCCCCAGGATGAAAAGAGG No data
1144981537_1144981548 17 Left 1144981537 17:19172870-19172892 CCAGGCTGACTGCCCGTGCCCAG No data
Right 1144981548 17:19172910-19172932 GCAGTCCCCAGGATGAAAAGAGG No data
1144981536_1144981548 18 Left 1144981536 17:19172869-19172891 CCCAGGCTGACTGCCCGTGCCCA No data
Right 1144981548 17:19172910-19172932 GCAGTCCCCAGGATGAAAAGAGG No data
1144981531_1144981548 29 Left 1144981531 17:19172858-19172880 CCATCCCCCAGCCCAGGCTGACT No data
Right 1144981548 17:19172910-19172932 GCAGTCCCCAGGATGAAAAGAGG No data
1144981543_1144981548 -1 Left 1144981543 17:19172888-19172910 CCCAGCTGGACTCCAGGGCTTGG No data
Right 1144981548 17:19172910-19172932 GCAGTCCCCAGGATGAAAAGAGG No data
1144981533_1144981548 24 Left 1144981533 17:19172863-19172885 CCCCAGCCCAGGCTGACTGCCCG No data
Right 1144981548 17:19172910-19172932 GCAGTCCCCAGGATGAAAAGAGG No data
1144981539_1144981548 5 Left 1144981539 17:19172882-19172904 CCCGTGCCCAGCTGGACTCCAGG No data
Right 1144981548 17:19172910-19172932 GCAGTCCCCAGGATGAAAAGAGG No data
1144981532_1144981548 25 Left 1144981532 17:19172862-19172884 CCCCCAGCCCAGGCTGACTGCCC No data
Right 1144981548 17:19172910-19172932 GCAGTCCCCAGGATGAAAAGAGG No data
1144981535_1144981548 22 Left 1144981535 17:19172865-19172887 CCAGCCCAGGCTGACTGCCCGTG No data
Right 1144981548 17:19172910-19172932 GCAGTCCCCAGGATGAAAAGAGG No data
1144981534_1144981548 23 Left 1144981534 17:19172864-19172886 CCCAGCCCAGGCTGACTGCCCGT No data
Right 1144981548 17:19172910-19172932 GCAGTCCCCAGGATGAAAAGAGG No data
1144981545_1144981548 -2 Left 1144981545 17:19172889-19172911 CCAGCTGGACTCCAGGGCTTGGC No data
Right 1144981548 17:19172910-19172932 GCAGTCCCCAGGATGAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144981548 Original CRISPR GCAGTCCCCAGGATGAAAAG AGG Intergenic
No off target data available for this crispr