ID: 1144981553

View in Genome Browser
Species Human (GRCh38)
Location 17:19172922-19172944
Sequence ATGAAAAGAGGCCCCTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144981541_1144981553 16 Left 1144981541 17:19172883-19172905 CCGTGCCCAGCTGGACTCCAGGG No data
Right 1144981553 17:19172922-19172944 ATGAAAAGAGGCCCCTCCCTGGG No data
1144981543_1144981553 11 Left 1144981543 17:19172888-19172910 CCCAGCTGGACTCCAGGGCTTGG No data
Right 1144981553 17:19172922-19172944 ATGAAAAGAGGCCCCTCCCTGGG No data
1144981545_1144981553 10 Left 1144981545 17:19172889-19172911 CCAGCTGGACTCCAGGGCTTGGC No data
Right 1144981553 17:19172922-19172944 ATGAAAAGAGGCCCCTCCCTGGG No data
1144981537_1144981553 29 Left 1144981537 17:19172870-19172892 CCAGGCTGACTGCCCGTGCCCAG No data
Right 1144981553 17:19172922-19172944 ATGAAAAGAGGCCCCTCCCTGGG No data
1144981536_1144981553 30 Left 1144981536 17:19172869-19172891 CCCAGGCTGACTGCCCGTGCCCA No data
Right 1144981553 17:19172922-19172944 ATGAAAAGAGGCCCCTCCCTGGG No data
1144981539_1144981553 17 Left 1144981539 17:19172882-19172904 CCCGTGCCCAGCTGGACTCCAGG No data
Right 1144981553 17:19172922-19172944 ATGAAAAGAGGCCCCTCCCTGGG No data
1144981547_1144981553 -1 Left 1144981547 17:19172900-19172922 CCAGGGCTTGGCAGTCCCCAGGA No data
Right 1144981553 17:19172922-19172944 ATGAAAAGAGGCCCCTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144981553 Original CRISPR ATGAAAAGAGGCCCCTCCCT GGG Intergenic
No off target data available for this crispr