ID: 1144986671

View in Genome Browser
Species Human (GRCh38)
Location 17:19205317-19205339
Sequence ATGAAAAGAGGCCCCTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144986671_1144986685 17 Left 1144986671 17:19205317-19205339 CCCAGGGAGGGGCCTCTTTTCAT No data
Right 1144986685 17:19205357-19205379 CCTGGAGTCCAGCTGGGCACGGG No data
1144986671_1144986679 10 Left 1144986671 17:19205317-19205339 CCCAGGGAGGGGCCTCTTTTCAT No data
Right 1144986679 17:19205350-19205372 GCCAAGCCCTGGAGTCCAGCTGG No data
1144986671_1144986683 16 Left 1144986671 17:19205317-19205339 CCCAGGGAGGGGCCTCTTTTCAT No data
Right 1144986683 17:19205356-19205378 CCCTGGAGTCCAGCTGGGCACGG No data
1144986671_1144986677 -1 Left 1144986671 17:19205317-19205339 CCCAGGGAGGGGCCTCTTTTCAT No data
Right 1144986677 17:19205339-19205361 TCCTGGGGACTGCCAAGCCCTGG No data
1144986671_1144986687 29 Left 1144986671 17:19205317-19205339 CCCAGGGAGGGGCCTCTTTTCAT No data
Right 1144986687 17:19205369-19205391 CTGGGCACGGGCAGTCAGCCTGG No data
1144986671_1144986681 11 Left 1144986671 17:19205317-19205339 CCCAGGGAGGGGCCTCTTTTCAT No data
Right 1144986681 17:19205351-19205373 CCAAGCCCTGGAGTCCAGCTGGG No data
1144986671_1144986688 30 Left 1144986671 17:19205317-19205339 CCCAGGGAGGGGCCTCTTTTCAT No data
Right 1144986688 17:19205370-19205392 TGGGCACGGGCAGTCAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144986671 Original CRISPR ATGAAAAGAGGCCCCTCCCT GGG (reversed) Intergenic
No off target data available for this crispr